ID: 1082026763

View in Genome Browser
Species Human (GRCh38)
Location 11:47578450-47578472
Sequence AGGACCTGGCCACTAGGCCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 103}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082026763_1082026774 28 Left 1082026763 11:47578450-47578472 CCCCGGCCTAGTGGCCAGGTCCT 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1082026774 11:47578501-47578523 CTCCATATGAAGCCTAGCCTGGG 0: 1
1: 0
2: 0
3: 11
4: 110
1082026763_1082026773 27 Left 1082026763 11:47578450-47578472 CCCCGGCCTAGTGGCCAGGTCCT 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1082026773 11:47578500-47578522 GCTCCATATGAAGCCTAGCCTGG 0: 1
1: 0
2: 0
3: 5
4: 103
1082026763_1082026768 -5 Left 1082026763 11:47578450-47578472 CCCCGGCCTAGTGGCCAGGTCCT 0: 1
1: 0
2: 1
3: 6
4: 103
Right 1082026768 11:47578468-47578490 GTCCTCTCCTTCCCAGCGCATGG 0: 1
1: 0
2: 1
3: 12
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082026763 Original CRISPR AGGACCTGGCCACTAGGCCG GGG (reversed) Intronic
903589038 1:24440427-24440449 AGGACCTGGCTAGGAGGGCGAGG - Intronic
903738595 1:25545071-25545093 AGGGCTGGGCCACTAGGCCAGGG + Intronic
904143031 1:28368725-28368747 AGGAGCTTGGCACTAGGCCCCGG + Intergenic
904335332 1:29793574-29793596 AGGACCTGCCCCCGAGGCTGGGG - Intergenic
905614406 1:39384972-39384994 AGGACCAGGCTATTAGGCTGAGG - Intronic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
911756800 1:101567765-101567787 ACGTCCTGGCCACTAGGGGGAGG - Intergenic
915007030 1:152647874-152647896 AGAACCTGGTCACTGGGCTGAGG - Intergenic
915316812 1:155033399-155033421 AGGACCTGCCCCCTAGCCCTGGG + Intronic
917632757 1:176905988-176906010 GGGCCATGGCCACTAGGCCGAGG + Intronic
918147999 1:181774786-181774808 TGCACCTGGCCACTTGGCCTGGG + Intronic
922021170 1:221706243-221706265 AGGACCTGGACACCATGCAGCGG - Exonic
1071481095 10:86065516-86065538 AGCACCTGGCCACAGGGCAGGGG - Intronic
1073255162 10:102146414-102146436 AGGACCTGGCTACTAGGTTTGGG + Intronic
1077679056 11:4222674-4222696 GAAATCTGGCCACTAGGCCGAGG - Intergenic
1079611449 11:22437306-22437328 TGCACTAGGCCACTAGGCCGAGG - Intergenic
1082026763 11:47578450-47578472 AGGACCTGGCCACTAGGCCGGGG - Intronic
1083642185 11:64151415-64151437 AGGCCCTGGCCCCTGGGCCCTGG - Intronic
1085316385 11:75547765-75547787 AGGACCTGCCCACTGGCCTGGGG + Intergenic
1089966380 11:122657069-122657091 AGGGCCTGGCCGCTGGGCCTTGG - Intronic
1090235899 11:125146907-125146929 AAGAAATGGCCACTGGGCCGAGG + Intergenic
1091799541 12:3316240-3316262 AGGGCCTGGCCAGCAGGCTGGGG + Intergenic
1100433168 12:94548300-94548322 GGGACCTGGCCACCAGGAAGCGG - Intergenic
1102034044 12:109760853-109760875 AGGCCCTGGCCACCTGGCCCAGG - Intronic
1102437713 12:112938422-112938444 AGGACCTGGCCAGCTGGGCGTGG + Exonic
1104980795 12:132572387-132572409 AGGTCCTGGCCACGGGGCGGTGG + Intronic
1105813030 13:24011103-24011125 AGGTCCTGACCACCTGGCCGTGG + Intronic
1110753218 13:79140244-79140266 AGGTCCTGGCCTCTAGGACTAGG + Intergenic
1113914011 13:113860414-113860436 AGGACCTGGGCAGTAGGGCTGGG + Intronic
1118626127 14:67660968-67660990 AAGACCAGGCCACTAGACTGTGG - Intronic
1118902883 14:70001368-70001390 AGGAGCTGACCACTGGGCAGTGG + Intronic
1121105707 14:91278126-91278148 GGGACCTGGCCACTTTGCCCCGG - Exonic
1122931364 14:104934103-104934125 AGGACCTGTCCCCTCAGCCGCGG - Exonic
1123415176 15:20090014-20090036 AGGACCTGGCCAGCTGGCCTGGG - Intergenic
1123524518 15:21097128-21097150 AGGACCTGGCCAGCTGGCCTGGG - Intergenic
1124653996 15:31494034-31494056 AGGATCGGGCCCCTAGGCTGGGG + Intronic
1129390616 15:75218850-75218872 TGGGCCGGGCCACTAGGCTGAGG + Intergenic
1129473657 15:75768764-75768786 TGGGCAGGGCCACTAGGCCGAGG - Intergenic
1130043639 15:80427220-80427242 AGGACCTGACCACTGGGGCTGGG + Intronic
1132887030 16:2186820-2186842 AGGACCTGGCCAGTAAGGTGGGG + Exonic
1133224166 16:4332743-4332765 AGGACCTGCACCCTAGGCTGTGG + Intronic
1133395299 16:5442324-5442346 AGGGCCAGGCCACAAGGCCAAGG + Intergenic
1136382262 16:29901142-29901164 AGGCCCTGGCCAAGAGGCCTGGG - Exonic
1136778625 16:32884326-32884348 AGGCCCTGGCCAGCAGGCTGGGG + Intergenic
1136891995 16:33977188-33977210 AGGCCCTGGCCAGCAGGCTGGGG - Intergenic
1137496569 16:48973765-48973787 AGGACCTGTCCACTCAGCCCTGG - Intergenic
1142173666 16:88635225-88635247 GGGACGAGGGCACTAGGCCGAGG + Intergenic
1203081041 16_KI270728v1_random:1146420-1146442 AGGCCCTGGCCAGCAGGCTGGGG + Intergenic
1142642955 17:1295311-1295333 AGGCCCTGGCCACTTCTCCGGGG + Intronic
1143508170 17:7381000-7381022 GGGACCTGGCCGCTGGCCCGGGG - Exonic
1143590903 17:7885383-7885405 CGGACCGGGCCACTCGGTCGCGG + Intronic
1151599608 17:75098111-75098133 AGGAGCTGGCCACCATGCCCAGG - Exonic
1152271894 17:79329674-79329696 CGGGGCTGGCCATTAGGCCGGGG - Intronic
1162813926 19:13181802-13181824 AGGCCCTGGCTACCAGGCCCTGG - Intergenic
1163298240 19:16426277-16426299 AGGACCTGGCAGCCAGGCCCAGG + Intronic
1163699942 19:18781965-18781987 TGGACTTGGCCAGTAGGCCTGGG + Exonic
1163769027 19:19179607-19179629 AGTGCCTGGCCAATAGGCAGGGG + Intronic
1166658670 19:44630588-44630610 AGGTCTTGGCCACAAGGGCGGGG - Intronic
1166790954 19:45398171-45398193 AGGACCTGGCCTCCTGGCAGGGG + Intronic
925194925 2:1915039-1915061 AGGACATGGGCATGAGGCCGGGG - Intronic
926088992 2:10037934-10037956 AGGACATGGGCACTTGGCAGGGG - Intergenic
927945127 2:27131013-27131035 AGGAACTGGCCACAAGGCTGAGG + Exonic
938072075 2:128314060-128314082 AGGACCTGGGGACCAGGCTGGGG - Intronic
1169119091 20:3084623-3084645 AGGAGAAGGCCAGTAGGCCGAGG + Exonic
1170570742 20:17631002-17631024 AGGAGGTGGCCACTAGGCCGTGG + Intronic
1172555866 20:35840793-35840815 TGGACCTGGCCACTAACCCAAGG + Intronic
1174768382 20:53274674-53274696 AGGACTTGGTCACAAGGCCATGG + Intronic
1175981242 20:62739721-62739743 AGGGCGTGGCCACTAGGCGCTGG + Intronic
1176383600 21:6126205-6126227 AGGAGCTGACCACTAGGTCGGGG - Intergenic
1179739870 21:43412033-43412055 AGGAGCTGACCACTAGGTCGGGG + Intergenic
1181361722 22:22343009-22343031 AGCACCTGGCCACTAGGGGGAGG + Intergenic
1182104952 22:27682648-27682670 AGGACCCGGCCACCAGCCCCTGG + Intergenic
1185402498 22:50626164-50626186 ATGACCTGGCCAGAAGGCCAAGG + Exonic
950716690 3:14852882-14852904 AGGGCCTGGCCCCCAGGCTGTGG + Intronic
961624767 3:128254305-128254327 AGGAACTGGCCACTGGGAAGGGG + Intronic
961761412 3:129171706-129171728 ACGATCTGGCCACTGGGCCCGGG - Exonic
968516337 4:1017169-1017191 AGGACCTGGCCACGGGGTGGGGG - Intronic
968549540 4:1214992-1215014 AAGCCCTGGCCACGAAGCCGAGG - Intronic
968919009 4:3512908-3512930 AGGACCTGGGCTCTTGGCCGTGG - Exonic
969701179 4:8768673-8768695 TTGTCCTGGCCACAAGGCCGAGG + Intergenic
974351374 4:60751301-60751323 TGGACCTGGTCCCTAGGCCAAGG + Intergenic
976198411 4:82556304-82556326 AGTACCAGGCCACAAGGCAGTGG - Intronic
976416310 4:84780209-84780231 AGGCCATGGCCACCAGGCCCAGG + Exonic
976564012 4:86532844-86532866 AGGACCAAGCCACAAGGCAGAGG - Intronic
976983074 4:91256374-91256396 AGGACAAGGTCACTAGGCCAGGG - Intronic
985611576 5:892488-892510 AGGTCCTGGCCACGAGGGAGGGG - Intronic
985827861 5:2205856-2205878 AGTACGTGGCGACTTGGCCGCGG + Intergenic
986743835 5:10727245-10727267 AGTACCTGGCCACTGCCCCGGGG + Intronic
991646074 5:68801774-68801796 AGGACCAGTCCAGTAGGCCAGGG + Intergenic
992934434 5:81687325-81687347 AGGTTCTGGCCACTGGGCTGGGG - Intronic
994056705 5:95424710-95424732 AGGCCCTTGCCACTAGGGAGAGG + Intronic
1007648881 6:43404435-43404457 AGGAGCTGGCCACTTGGAGGTGG + Intergenic
1008666575 6:53722820-53722842 AGGACATGGCATCAAGGCCGTGG + Intergenic
1009752094 6:67887210-67887232 AAAACCTGGCCACTGGGCCAAGG - Intergenic
1010533420 6:76993516-76993538 AGGAACAGGCCACTAGGCTCAGG - Intergenic
1011304784 6:85914112-85914134 AGGCCCTGGGCTCTAGGCTGTGG - Intergenic
1023866673 7:44241674-44241696 AGGCCCTGGCCCCTAGTCCCAGG - Intronic
1024345585 7:48310241-48310263 AGCACCTGGCCACTCTGCAGTGG + Intronic
1029304687 7:99610323-99610345 GGGACCTGACCTCTAGGGCGTGG + Intergenic
1035020607 7:155797904-155797926 GGAACCTGGACACTGGGCCGAGG + Intergenic
1037174765 8:15933527-15933549 TGGACCTTGCCTCTAGGCCAAGG - Intergenic
1038024825 8:23578962-23578984 AGGACCTGGCATATAGGCCAAGG + Intergenic
1045376441 8:101579102-101579124 AAGACCTGGTGACTAGGACGGGG + Intronic
1057068120 9:92073905-92073927 AAAACCTGGCCACTGGGCCAAGG + Intronic
1062081081 9:134623762-134623784 AGGAGCTGCCCATTAGGCAGGGG - Intergenic
1062600064 9:137315546-137315568 AGGGCCTGGGCAGGAGGCCGAGG + Intronic
1190370565 X:49736528-49736550 AGGAACTAGACACTAGGCCTAGG - Intergenic
1193150300 X:78117979-78118001 AGGAGCTGGCCTCTAGGACTAGG + Intronic
1195668488 X:107450375-107450397 AGGAGGTGGCCACTTAGCCGGGG + Intergenic
1199698846 X:150362252-150362274 AGGGCCTGGCCGCTAGCCCTAGG + Intronic
1199808696 X:151327752-151327774 AGGGCCTGGCCAGGAGGCTGGGG + Intergenic