ID: 1082028800

View in Genome Browser
Species Human (GRCh38)
Location 11:47590498-47590520
Sequence CCAGCGCCTGCACCTCGTCG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 89}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082028797_1082028800 -3 Left 1082028797 11:47590478-47590500 CCGCCGCTGCTCGTCGAAGGCCA 0: 1
1: 0
2: 0
3: 2
4: 43
Right 1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG 0: 1
1: 0
2: 1
3: 13
4: 89
1082028795_1082028800 2 Left 1082028795 11:47590473-47590495 CCTGGCCGCCGCTGCTCGTCGAA 0: 1
1: 0
2: 0
3: 1
4: 41
Right 1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG 0: 1
1: 0
2: 1
3: 13
4: 89
1082028798_1082028800 -6 Left 1082028798 11:47590481-47590503 CCGCTGCTCGTCGAAGGCCAGCG 0: 1
1: 0
2: 0
3: 9
4: 31
Right 1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG 0: 1
1: 0
2: 1
3: 13
4: 89
1082028794_1082028800 9 Left 1082028794 11:47590466-47590488 CCGCGCGCCTGGCCGCCGCTGCT 0: 1
1: 0
2: 2
3: 36
4: 276
Right 1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG 0: 1
1: 0
2: 1
3: 13
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082028800 Original CRISPR CCAGCGCCTGCACCTCGTCG CGG Exonic
900246903 1:1640554-1640576 CCAGCGCCAGCACCTCCCAGCGG - Intronic
900258125 1:1707686-1707708 CCAGCGCCAGCACCTCCCAGCGG - Intronic
900266351 1:1759216-1759238 CCAGCGCCTCGACCTCTTCCTGG + Exonic
900369920 1:2327701-2327723 GCCGCGCCTGCCCCTCCTCGTGG - Intronic
903460345 1:23516449-23516471 CCGGCTCCTGCACCTCCTCTGGG + Exonic
905997323 1:42392534-42392556 CCAGCACCTGCACCTGTTAGAGG + Intronic
908474022 1:64470867-64470889 CCAGCACTTGCGCCTCGTCCAGG - Exonic
908474099 1:64471216-64471238 CCAGCGCCTTCATCTCGTCAAGG + Intronic
914914082 1:151807549-151807571 CCAGCACCTCCACCCCATCGTGG - Exonic
915324044 1:155071368-155071390 CCAGCGCCTGCAGCCCGTCTCGG - Intergenic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
923680042 1:236111718-236111740 CCAGCGCCTGCAGCTCCTGGAGG + Intergenic
1069438322 10:68406635-68406657 CCAGTGCCCGCACCTTGCCGGGG + Intronic
1069566509 10:69466946-69466968 CCAGCGCCTGCAGCTGGCCTGGG + Intronic
1073180381 10:101579701-101579723 CCGGCGCCTGGACATCATCGTGG - Exonic
1077273475 11:1692626-1692648 CCAGCCCCTGCCCCTCCCCGGGG - Intergenic
1081594787 11:44451798-44451820 CCAGAGCCTGCTCCCCGTGGAGG - Intergenic
1082028721 11:47590039-47590061 TCATGGCCTGCACCTCGTCGCGG + Exonic
1082028800 11:47590498-47590520 CCAGCGCCTGCACCTCGTCGCGG + Exonic
1085266697 11:75241682-75241704 CCAGCGCGCGCAGCTCGTCGGGG - Exonic
1087052828 11:93903829-93903851 CCTGCACCTGCACCTCCTCCTGG + Intergenic
1090879780 11:130823505-130823527 CCATCCCCTGCACCTTGTTGAGG + Intergenic
1091124501 11:133082782-133082804 CCGGCGCCTGGGCCTCCTCGCGG + Intronic
1092508435 12:9127794-9127816 CCAGAGCCCGCACCTTGTCCAGG - Intergenic
1096692302 12:53328678-53328700 CCAGTGCTTGCACCCCGTGGGGG + Exonic
1098819087 12:75207485-75207507 CCAGCGCCTCCTCGGCGTCGCGG + Exonic
1100464635 12:94834305-94834327 CCAGGGCGTGCACCTTGTCCAGG - Intergenic
1106146671 13:27055282-27055304 CCAGTGCCTTCACCTTGTCCAGG + Intergenic
1107129406 13:36879359-36879381 CCAGCGGCTTCAGCTCGTGGTGG + Exonic
1127965952 15:63923112-63923134 CCAGGGCCTCCACATCGTCCTGG + Intronic
1128532204 15:68462065-68462087 CCAGAGCCTGCACCTTGGTGTGG + Intergenic
1128877658 15:71215286-71215308 CCAGCGCTGGCGTCTCGTCGCGG - Exonic
1136536866 16:30904626-30904648 CCAGCACCTCCAGCTCGTGGAGG - Intergenic
1137300287 16:47143083-47143105 GCGGCGCCTGCACCTCGCGGCGG - Intronic
1138658856 16:58506395-58506417 CCAGCCCCTCCACCAGGTCGGGG - Exonic
1141729302 16:85810932-85810954 CCAGGGCCTGCATCTCCACGTGG + Intergenic
1142386815 16:89770551-89770573 CCCGCGCCTTCACCTCTCCGGGG + Exonic
1143042664 17:4050811-4050833 CCAGTGCATGCAGCTCGTCGGGG - Exonic
1148461333 17:47840714-47840736 CCACCTCCTGCACCTCGTCCCGG + Exonic
1151508785 17:74545753-74545775 CCAGGGCCTGGGCCTCGTGGCGG - Exonic
1160575694 18:79852656-79852678 CCAGCGCCTGCACCTGGGCGTGG + Intergenic
1161015018 19:1979173-1979195 CCAGCGCCTCCAGGTCGTCGCGG - Exonic
1161379904 19:3959397-3959419 CCAGCGCCTCCACGTCCTCGTGG + Exonic
1161469440 19:4448976-4448998 CCAGCCCCTGCCCCTCCCCGAGG + Intronic
1163124984 19:15239776-15239798 CCAGCCCCAGCCCCTCGTGGTGG - Exonic
1163746495 19:19051867-19051889 CCAGGGCCTGCAGCTCCTAGTGG + Exonic
1163786965 19:19279712-19279734 CAAGCGCCTGCAGCTCCTCAGGG + Intronic
1165782322 19:38441690-38441712 CCAGCCCCTGCCCCTCCTCCAGG - Intronic
1166706067 19:44908704-44908726 GCATGGCCTGCACCTCGCCGCGG - Exonic
1166706151 19:44909034-44909056 CCTGCTCCTTCACCTCGTCCAGG - Exonic
924962197 2:45689-45711 CCAGGGCCTCCACCACCTCGGGG + Exonic
927501791 2:23588168-23588190 CCAGTGCCTGCTCCTCCTCCTGG + Intronic
930096402 2:47570124-47570146 CCCGCGCCTCCGCCTCGCCGGGG + Exonic
932105130 2:68935378-68935400 CCAGGGCCTGCAGCTCCTCCAGG + Intergenic
932416392 2:71576112-71576134 CCAGCCCCTGCACCTGGGTGAGG + Intronic
932780548 2:74556069-74556091 ACAGCCCCTGCACCTTGTCCCGG - Exonic
935165798 2:100567684-100567706 CCAGCGCCTCCAGCTCCTCAGGG - Intronic
935590517 2:104843136-104843158 CCAGCGCGAGGACCTCGGCGCGG + Intergenic
935818278 2:106868310-106868332 CCAGGCCCTGCACCTTGCCGGGG - Intronic
935997167 2:108786906-108786928 GCGGCGGCTTCACCTCGTCGGGG - Exonic
941738287 2:169005029-169005051 ACAGCACCTGCACCTGGTGGAGG + Intronic
949011276 2:241680273-241680295 CCAGGGCGTGACCCTCGTCGTGG - Exonic
1169496720 20:6122851-6122873 CCAGCGCCCGCTCCTCGGCTCGG - Exonic
1172447424 20:35000533-35000555 CCAGAGCCTGCGCCTGCTCGTGG - Exonic
1175872791 20:62216408-62216430 CCAGCTCCGGCAGCTCCTCGAGG - Exonic
1175914391 20:62418980-62419002 CCAGGGCCAGCACCTCCCCGTGG - Intronic
1179624860 21:42643166-42643188 CCAGTGCCTTCACCTGGACGTGG - Intergenic
1179726546 21:43344289-43344311 CCAGCGACTGCTCCTCATCTTGG - Intergenic
1179796723 21:43789354-43789376 CCTGCGCCTGCGCCTCGCTGGGG - Intergenic
1179928476 21:44551408-44551430 CCAGCGCCTGCACCAACTCCTGG - Exonic
1182704617 22:32269386-32269408 CCAGGGCCTGCACATCGATGAGG - Intergenic
1183308350 22:37095999-37096021 GCAGTGCCTGCACCACCTCGGGG + Exonic
1183546298 22:38456059-38456081 CCAGCCCCTGCTCCGCGCCGCGG - Intergenic
954304625 3:49719060-49719082 CCAGCGCCCCCAGCCCGTCGAGG + Exonic
959105417 3:102059382-102059404 CCAGCGTCTGCACCTGGTGAGGG - Intergenic
969439986 4:7211315-7211337 CCATGGCCTGCCCCCCGTCGTGG - Intronic
969605221 4:8199110-8199132 ACAGGGCCTGGACCTCGTCCAGG + Intronic
981615025 4:146637341-146637363 CCAGTGCCTGCACCTGCTCCCGG + Intergenic
985515724 5:343750-343772 CCACCTCCTGCTCCTCCTCGTGG - Intronic
990980928 5:61602077-61602099 CCAGCTCCTGCAACTCTTTGAGG + Intergenic
993646904 5:90473968-90473990 CCAGCGCCTCGGCCTCGGCGTGG + Exonic
998449472 5:142223020-142223042 CCAGCGCCTGCTCCTGGTCTTGG + Intergenic
1006258240 6:32848050-32848072 CCAGCGCCGTCACCTCGCCAGGG + Exonic
1013201291 6:107898927-107898949 CCAGCTGCTGCACCTTGTAGCGG - Intronic
1018103716 6:160464059-160464081 CCAGAGCCTGCCCTTCGTCATGG - Intergenic
1018774164 6:166998707-166998729 CCCGCCCCTGCACCTCGGCCTGG + Intergenic
1018790197 6:167142379-167142401 CCAGCGCCTGCACCTGCTCCTGG + Intergenic
1019190668 6:170249010-170249032 CCAGCGGCTGCCCCTCGGTGTGG + Intergenic
1019716487 7:2541717-2541739 CCAGCGGCTGCAGCTCCTCCAGG + Exonic
1024326019 7:48109776-48109798 CCAGCCCCTGCAGCTCGTGCTGG - Intergenic
1025188251 7:56877432-56877454 GCAGCTCCTGCACCTCCTCGGGG + Intergenic
1025683675 7:63699488-63699510 GCAGCTCCTGCACCTCCTCGGGG - Intergenic
1028997499 7:97117480-97117502 GTCGCGCCTGCGCCTCGTCGTGG - Exonic
1029543075 7:101196056-101196078 CCAGCGCCTCCACCCCACCGAGG - Exonic
1034192656 7:149223912-149223934 CCAGAGCCTGCCCCCCATCGCGG + Exonic
1034262567 7:149765946-149765968 CCAGCGGCTGCACCGGGGCGAGG - Exonic
1035752002 8:2002722-2002744 CCGCCGCCTGCGCCTCGCCGCGG - Exonic
1036910725 8:12755240-12755262 CCAGCGCCAGCAGCTCCCCGCGG + Exonic
1037402015 8:18503193-18503215 CCAGCCCCTCCACCCCGACGAGG + Intergenic
1038429832 8:27491235-27491257 GCAGCGCCAGCACCCCGTCAAGG - Exonic
1056753069 9:89365419-89365441 CCAGCACCTGCCCTTCCTCGAGG + Intronic
1056928589 9:90855428-90855450 CCAGGGCCTGCTCCTGGACGAGG + Intronic
1062048220 9:134434121-134434143 TCAGCGCCTCCACCTCGGCCGGG - Exonic
1195755176 X:108192646-108192668 ACAGCTCCTGCACCTCTTCTTGG - Intronic