ID: 1082033234

View in Genome Browser
Species Human (GRCh38)
Location 11:47622334-47622356
Sequence GTGGTTATGAAAGGTGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 177}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082033230_1082033234 8 Left 1082033230 11:47622303-47622325 CCAGCTCTGTCAATACCACTGTG 0: 1
1: 0
2: 0
3: 10
4: 201
Right 1082033234 11:47622334-47622356 GTGGTTATGAAAGGTGAGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 177
1082033232_1082033234 -7 Left 1082033232 11:47622318-47622340 CCACTGTGACAAATAAGTGGTTA 0: 1
1: 0
2: 1
3: 13
4: 132
Right 1082033234 11:47622334-47622356 GTGGTTATGAAAGGTGAGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082033234 Original CRISPR GTGGTTATGAAAGGTGAGTT TGG Intronic
902129260 1:14244640-14244662 GTGGTTAAGGAAGGTGGTTTTGG + Intergenic
902148327 1:14421787-14421809 AGGGTTTTGAAAGGTGAGCTTGG - Intergenic
904802716 1:33106405-33106427 GTGGTTTTGTAAAATGAGTTTGG - Intronic
907283193 1:53363817-53363839 GTGCTTGTGAAGGGTGAGGTGGG - Intergenic
907667355 1:56445061-56445083 AAGGTTATGCAATGTGAGTTGGG - Intergenic
915163282 1:153934083-153934105 GTGGTTAGGAAAGCTGACTGGGG + Intronic
916364370 1:164007518-164007540 GTGGTGAAGTTAGGTGAGTTAGG - Intergenic
917449849 1:175138427-175138449 GGGTGAATGAAAGGTGAGTTTGG + Intronic
920050054 1:203158877-203158899 GTCTTTATAAAAGATGAGTTTGG - Intronic
921756816 1:218866855-218866877 GTGGTGATGACAGCTGAGTGGGG + Intergenic
1063043318 10:2366468-2366490 GTGGTTAGGAAATGTGATATTGG + Intergenic
1065482671 10:26211551-26211573 GCAGTTTGGAAAGGTGAGTTTGG - Intronic
1067524677 10:47031123-47031145 GGGTTTCTGATAGGTGAGTTTGG - Intergenic
1072049704 10:91691188-91691210 GTGGTTATGAATAGAGAGATTGG - Intergenic
1072270824 10:93774594-93774616 CTGGTTTAAAAAGGTGAGTTGGG - Intronic
1073035297 10:100560671-100560693 GGAGACATGAAAGGTGAGTTTGG + Intergenic
1073289597 10:102407001-102407023 GTTGTTATGACAAGTGGGTTGGG - Intronic
1073517016 10:104085563-104085585 TTGGTTATAAAAGATGACTTTGG - Intronic
1074382885 10:112994712-112994734 GTGGTTATAAAAAGTGGTTTGGG + Intronic
1074427306 10:113362803-113362825 ATGGTTTTGAAAGGAGAGCTGGG + Intergenic
1075048835 10:119166727-119166749 GAGGTTAAGAAAAGTGAGCTAGG - Intergenic
1076519433 10:131071772-131071794 ATGGATATGAAATGTGAGTCAGG + Intergenic
1078314672 11:10284381-10284403 GTGGTTATAAAAGGGTAATTGGG - Intronic
1078598524 11:12710798-12710820 GTTGTTGTGACACGTGAGTTAGG + Intronic
1079294471 11:19220018-19220040 TTGGTTTAGAAAAGTGAGTTTGG + Intergenic
1082033234 11:47622334-47622356 GTGGTTATGAAAGGTGAGTTTGG + Intronic
1088809714 11:113383252-113383274 GTGGTTGTCAGAGGTGAGATTGG - Intronic
1090463920 11:126916279-126916301 GTGCTTCTGAAGGTTGAGTTAGG + Intronic
1092754511 12:11750737-11750759 GAGGTTTTTAAAGGTGAGGTGGG - Intronic
1094095056 12:26694441-26694463 GTGTTTGTGTAAGGTGATTTGGG - Intronic
1094401149 12:30061507-30061529 GTAGTTGAGAAAGGTGAATTAGG - Intergenic
1095910813 12:47424668-47424690 GTGGTAATGACAGGTTGGTTGGG - Intergenic
1096574322 12:52543287-52543309 GTGGTTCTGGAAGGTGGGATAGG + Intergenic
1096706879 12:53427727-53427749 GTGTTTGTGAAGGGTAAGTTTGG - Intronic
1097479493 12:60103896-60103918 ATGGTTTTGAAAGGTCATTTTGG + Intergenic
1099448883 12:82784684-82784706 GTGGTTAGGAAATGTGGGGTTGG + Intronic
1100122982 12:91390723-91390745 GAGGCTATGAATGGTGAGTGGGG - Intergenic
1103013351 12:117475034-117475056 GTGGGTATGAAAGCTGAGAATGG - Intronic
1105659109 13:22473374-22473396 GTGGTTAAGACACCTGAGTTTGG + Intergenic
1108344612 13:49532932-49532954 CTGGTTATGGAAGGTGACTTTGG - Exonic
1108399857 13:50029268-50029290 GAGGATATGAAAGGTGAGCTGGG - Intergenic
1109584563 13:64381975-64381997 TTGGATATGAAAGGAGAGATTGG - Intergenic
1109706531 13:66100389-66100411 GTGGTTTTGAAGGTTGAGGTTGG - Intergenic
1111018198 13:82408410-82408432 GTGGTTAAGACAGGTGAGTTGGG - Intergenic
1111735879 13:92138646-92138668 GTTGTTATTAAAGGTTTGTTGGG + Intronic
1113083768 13:106546229-106546251 GTGGTCAAGAAAGGTGAGTCTGG - Intronic
1115200657 14:30850949-30850971 GTGTTTATGACAGTTGTGTTGGG - Intergenic
1116922593 14:50595836-50595858 GTGGAAATGAAAGATGAATTAGG + Intronic
1117845309 14:59905580-59905602 GTGGATATGAAAGGATAGTGTGG + Intergenic
1119635786 14:76272112-76272134 GTGGAGAAGAAAGGTGACTTTGG + Intergenic
1121331570 14:93052882-93052904 GTGGTGACGAAAGGTGTGGTTGG - Intronic
1122807461 14:104267203-104267225 GGGGTGAGGGAAGGTGAGTTTGG - Intergenic
1125246650 15:37648109-37648131 GTGTTTTTGGAAGGTGATTTGGG - Intergenic
1129043934 15:72716284-72716306 GTGGCTAAGAAAGGGGAGATAGG - Intronic
1129996506 15:80010799-80010821 GTGGTAAAGAAATGTGAGTAAGG - Intergenic
1130654500 15:85782567-85782589 GTAGCTATGAAAGGAGAGATTGG - Intronic
1131731096 15:95282201-95282223 GTAGTTAGCAAGGGTGAGTTGGG + Intergenic
1131948288 15:97651988-97652010 GTGTTTATGAAATGCTAGTTCGG - Intergenic
1131985383 15:98038489-98038511 GTGATTTTGAAAGGGGTGTTAGG + Intergenic
1133899931 16:9964500-9964522 GTGGTTCTGAAATGTGAAATGGG + Intronic
1134135800 16:11675631-11675653 GTGGTCATGAACACTGAGTTGGG + Intronic
1138214527 16:55191570-55191592 CTGGGTTTGAAAGGTGAGTTGGG + Intergenic
1138537607 16:57668172-57668194 TGGGTTGTGAAAGGTGAGTGTGG - Exonic
1140300091 16:73749088-73749110 GTAGTTTAGAAAGGTGAGTTTGG - Intergenic
1140329817 16:74044111-74044133 GTGATAAGGAAAGGTGTGTTAGG + Intergenic
1141167344 16:81669365-81669387 GTGGGTGTGGAAGGTGAGGTGGG - Intronic
1145088506 17:19965394-19965416 GTGTTTATGAAAGGTTAGTCTGG - Intronic
1146811875 17:35910346-35910368 GTGGCTCTAAAAGCTGAGTTGGG + Intergenic
1147159163 17:38560593-38560615 GAGGGAATGAAAGGTGAGATGGG - Intronic
1147232659 17:39030495-39030517 GTGGCTCTAAAAGCTGAGTTGGG - Intergenic
1147266953 17:39240176-39240198 GTGGAAAAGGAAGGTGAGTTTGG + Intergenic
1148849574 17:50548149-50548171 ATGGTTCAGAAAGGTGGGTTGGG + Intronic
1149106534 17:52974293-52974315 GTGGTTATCAAAGCTGGGATAGG - Intergenic
1149207754 17:54268082-54268104 GTGGGCAGGATAGGTGAGTTTGG - Intergenic
1149369986 17:55984153-55984175 GTGGTTATTAGAGCTGAGGTTGG + Intergenic
1149762777 17:59247495-59247517 ATGTTTATGAAAGATGAGTATGG - Intronic
1150784353 17:68150795-68150817 GTGGCTCTAAAAGCTGAGTTGGG + Intergenic
1152163333 17:78683545-78683567 GTGGTTCTGAGAGCTGAGTGAGG + Intronic
1152814572 17:82399855-82399877 GTGCTTATGACAGCTGAGCTGGG - Intronic
1153249854 18:3110410-3110432 CTGGTTATGATGGGTGAGCTGGG - Intronic
1155932980 18:31725752-31725774 GTGGCTCTAAAAGCTGAGTTGGG - Intergenic
1156696176 18:39771064-39771086 GTGGTTAAGCAAGGTGTATTGGG - Intergenic
1159927034 18:74278667-74278689 ATGGTTCTTAAAGGTTAGTTAGG + Intronic
1165082956 19:33320876-33320898 GTGGTTTTGAAAGGTATGTAGGG + Intergenic
1165153484 19:33774060-33774082 GTGGTTTTGTCAGGTGAGTGGGG - Intergenic
1168253440 19:55154393-55154415 GTGGTTTTGAGAGGTGAGGCTGG - Intronic
1168591606 19:57640576-57640598 GTTTTTAGGAAAAGTGAGTTGGG - Intronic
927311348 2:21635303-21635325 GGGGTTATGAAAAGTGATTGGGG + Intergenic
928927173 2:36591959-36591981 TTGGTTGTGAAATTTGAGTTTGG - Intronic
929011251 2:37447471-37447493 GTGGTTGTGCAAGGGGATTTGGG - Intergenic
932763202 2:74453630-74453652 GTGATTATGAAAAGGGATTTTGG - Intergenic
934863192 2:97781433-97781455 GTGGTTATGACCAATGAGTTTGG + Intronic
934972659 2:98775489-98775511 GTGTTTACTCAAGGTGAGTTTGG - Intergenic
940004151 2:148996209-148996231 GTGGTTGTGATAGGGTAGTTGGG + Intronic
940265266 2:151829186-151829208 GTAGTTAGGAGAAGTGAGTTGGG - Intergenic
940556205 2:155232035-155232057 GTGCTTATGAAGGGTGCATTGGG - Intergenic
941290305 2:163666127-163666149 CTGGTTTTGAAACCTGAGTTTGG + Intronic
944419426 2:199513537-199513559 GTGGTGATGAGAGGGTAGTTGGG - Intergenic
945034596 2:205693718-205693740 GTTGTTGTAAAAGGTGAGTCTGG - Intronic
947903123 2:233739246-233739268 GTGGTAAAGAAATGTGAGGTTGG + Intronic
947904539 2:233750911-233750933 GTGGTAAAGAAATGTGAGGTTGG + Intronic
1169414863 20:5407286-5407308 GTGGTTGGGAAATGTGAGTGTGG + Intergenic
1170217509 20:13907316-13907338 GTGCTTTGGAAAGCTGAGTTTGG + Intronic
1170839850 20:19915730-19915752 GTGGGTATGAAAAGGGAATTTGG - Intronic
1172250554 20:33476195-33476217 GGGGTTATAAAATGTGATTTTGG + Intergenic
1174092514 20:48060595-48060617 GTGATTATGAAAGGGTAGATGGG + Intergenic
1177657626 21:24039689-24039711 GTTGTTATGAGAGGTGAAATGGG - Intergenic
1182693658 22:32181360-32181382 GTGATTTGGAAAGGTCAGTTTGG - Intergenic
1182989446 22:34753087-34753109 CTGGTTGTGCAAGGTGAGTCTGG + Intergenic
949840991 3:8319786-8319808 GAGGAAATGAAAGGTCAGTTTGG - Intergenic
950046851 3:9953467-9953489 GTGGTTATCAAAAATGAGATAGG + Intergenic
951448801 3:22813259-22813281 GTGGTTATGGCAGGTGAGCCTGG + Intergenic
951786768 3:26429071-26429093 TTAGATATGAAAAGTGAGTTTGG - Intergenic
953725664 3:45395733-45395755 GTGGTTATGAAAAATGAGTAAGG + Intronic
957528005 3:81402479-81402501 GTGATTATCAGAGGTGAGGTGGG - Intergenic
960380019 3:116948446-116948468 GTGATTATGACAGGTGAGTGTGG + Intronic
961813289 3:129533980-129534002 GTGTTCCTGAAAGATGAGTTGGG - Exonic
963804658 3:149710990-149711012 GTGGTTATGAGAGCAGATTTTGG - Intronic
970031147 4:11676229-11676251 ATGGTTATGACATGTCAGTTAGG + Intergenic
970600903 4:17640170-17640192 GTGGTTATGAAAATTAAATTGGG + Intronic
971532973 4:27712395-27712417 GTGGTTATGAAAAGTGGGAAGGG + Intergenic
971695032 4:29889946-29889968 GTGGTTATGTAAGGTTAGGGTGG + Intergenic
973059028 4:45696147-45696169 ATGGTTAGGAAAGGAGACTTTGG - Intergenic
974963566 4:68732911-68732933 GTGGTTACAAAGGGTGAGGTTGG + Intergenic
975033242 4:69650125-69650147 GTGGACATCAAAGGTGAGGTTGG - Intronic
975761692 4:77626358-77626380 GTGGTTACCAGAGGTGAGGTGGG - Intergenic
976523753 4:86061196-86061218 ATAGGTATGAAAGATGAGTTAGG - Intronic
977559765 4:98520396-98520418 GTGGCTAGGTAAGATGAGTTGGG + Intronic
978863888 4:113484139-113484161 GTGGGTAAGAAAGGGAAGTTTGG - Intronic
980490725 4:133524561-133524583 GTGGTTGAGGAAGGTGAGTCAGG + Intergenic
982148304 4:152423517-152423539 GTGGTTATTAAACTTGATTTTGG + Intronic
987807815 5:22792748-22792770 GTGGTCAGGAAACGGGAGTTGGG + Intronic
989547718 5:42693800-42693822 GTGGTTGTGGAAGATGAGGTAGG - Intronic
990626560 5:57619203-57619225 GAGGAAATGAAAGGTGAGTTAGG + Intergenic
992586099 5:78241804-78241826 TTTGTCATGAAAGATGAGTTTGG - Intronic
993005430 5:82424050-82424072 GTTGTTATGTAAGGTGGGTGTGG + Intergenic
993303669 5:86247828-86247850 TTAGAAATGAAAGGTGAGTTAGG - Intergenic
993407407 5:87528605-87528627 GGGGTGATGAAAGGTTAGCTGGG + Intergenic
997313009 5:132905284-132905306 CTGGTCATGAAAATTGAGTTTGG - Intronic
997464492 5:134078288-134078310 GTGGTCAGGAAAGGTGAAGTGGG + Intergenic
997467744 5:134099551-134099573 GTGGTTGAGAAAGGTGAGAAAGG - Intergenic
997599571 5:135130136-135130158 GTGGTTAAGAAGGATGAGCTGGG - Intronic
999223398 5:150000410-150000432 GTGGCTCTGAAAGGTGAGGCGGG + Intronic
1000800279 5:165718246-165718268 CTGCTTATGAAAGGGAAGTTAGG + Intergenic
1003110754 6:3250382-3250404 GTGCTTGTGAAGGGTGAGTGGGG + Intronic
1005563994 6:27070452-27070474 GTGCTTATGTCAGCTGAGTTAGG + Intergenic
1008495339 6:52127427-52127449 GTAGTTATCAAAGTTGACTTTGG + Intergenic
1008957891 6:57235678-57235700 GTGGTTAAGAATTGTGAGATGGG + Intergenic
1013016246 6:106163239-106163261 TTGGTTATAAAAAGGGAGTTTGG - Intergenic
1013485457 6:110591868-110591890 GTTTATATGAAAAGTGAGTTAGG - Intergenic
1018167820 6:161116092-161116114 TTGGATGTGAAAGGTGAGTGAGG + Intronic
1018881275 6:167883796-167883818 GTGGTTGCTGAAGGTGAGTTAGG + Intronic
1019201517 6:170320124-170320146 GTGGTTAAGATAGTTAAGTTTGG - Intronic
1021571949 7:22074948-22074970 GTGTTTAGGAAAGTTAAGTTGGG + Intergenic
1021921944 7:25494537-25494559 GAGGTTAAGAATGGTGACTTTGG + Intergenic
1026403257 7:70038094-70038116 GTGGTTTTGACAGGTGAGTGTGG + Intronic
1026679149 7:72452119-72452141 CTGGTTATGTTAGGTGTGTTAGG + Intergenic
1027653021 7:80894711-80894733 ATAGTTATGAAAGGTAAATTAGG - Intronic
1027668301 7:81066792-81066814 CTGGTTAAGAAAGTTTAGTTAGG - Intergenic
1028209494 7:88055759-88055781 AGCGTTATGAAAGGTGTGTTAGG - Intronic
1029295974 7:99540811-99540833 GTGGTGATGAGAGCTGAGCTTGG + Intergenic
1029898239 7:104009890-104009912 GTTTTCATGAAAGGAGAGTTAGG - Intergenic
1030955583 7:115848050-115848072 GTGGATATGTAAGGTAATTTTGG - Intergenic
1032450651 7:132027622-132027644 TGGGTTATTAAAGGTGGGTTGGG + Intergenic
1033440489 7:141373765-141373787 TTGGTTCTGAAGGGTGAGCTGGG + Intronic
1038130140 8:24720832-24720854 ATGGTTATGAGTGGTGAGATGGG - Intergenic
1038676608 8:29628572-29628594 GTTGTTATGAAAGGTGCTTTGGG + Intergenic
1038852021 8:31288601-31288623 GTGGTTAAGAAAGTGGACTTTGG + Intergenic
1039830406 8:41209146-41209168 GTGCTTTTGAAAGCTGAGGTGGG + Intergenic
1040878369 8:52176410-52176432 GTTGTTAAGAAAGTTGAGGTTGG - Intronic
1042266779 8:66916588-66916610 GAGGTTTTGATAGGTGAGTGTGG + Intronic
1045836917 8:106533405-106533427 GTGTTTATGAAAGCTATGTTGGG + Intronic
1046510477 8:115196175-115196197 GTGTTTATGAAAGATGAATAGGG + Intergenic
1046935397 8:119880723-119880745 GTGGTTTTAAAAAGTGAATTTGG + Intronic
1051545330 9:18267663-18267685 ATACTTATTAAAGGTGAGTTGGG - Intergenic
1052086215 9:24269194-24269216 GTTGTTTAGAAAGGTGAGGTAGG - Intergenic
1054834522 9:69662286-69662308 GTGGTTATGAAGAGTAAATTAGG + Intronic
1058844271 9:108940387-108940409 CTGGGTAAGAAAGGTGGGTTAGG - Exonic
1059056626 9:110988586-110988608 GTAGTTATGAAGTGTGAATTTGG - Intronic
1059554355 9:115264223-115264245 GGGGTGTTGGAAGGTGAGTTTGG + Intronic
1059563125 9:115354400-115354422 GTGTTCAAGAAAGGTTAGTTAGG - Intronic
1187437264 X:19284050-19284072 GTGGTTATTAAAGAAGATTTAGG + Intergenic
1187607011 X:20895962-20895984 GTAGTTATGAAATGTTATTTTGG + Intergenic
1188789595 X:34392221-34392243 TTGGTTATGTAATGGGAGTTGGG - Intergenic
1190785104 X:53638972-53638994 GTCTTTATGAAAAGTGACTTTGG - Intronic
1191914625 X:66188180-66188202 GTGGTTTTAAATGGGGAGTTTGG + Intronic
1192938757 X:75890451-75890473 TTGGTTTTTAAAGGTCAGTTGGG - Intergenic
1197330523 X:125148660-125148682 TTGGTTAGGAAAGGTGATGTTGG - Intergenic
1198093143 X:133351650-133351672 AAGGTTCTGAAAGGTGAGATTGG - Intronic
1200384890 X:155880668-155880690 GGGGTTAAGAAAGGTGACTTTGG + Intergenic
1202199104 Y:22328280-22328302 GTGATGATAAAGGGTGAGTTTGG + Intronic