ID: 1082039752

View in Genome Browser
Species Human (GRCh38)
Location 11:47675115-47675137
Sequence CTGGATAATACAACTTTAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 183}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082039752_1082039753 -5 Left 1082039752 11:47675115-47675137 CCTATTAAAGTTGTATTATCCAG 0: 1
1: 0
2: 0
3: 14
4: 183
Right 1082039753 11:47675133-47675155 TCCAGCTCAAACCTCAGACTTGG 0: 1
1: 0
2: 1
3: 7
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082039752 Original CRISPR CTGGATAATACAACTTTAAT AGG (reversed) Intronic
902745231 1:18469443-18469465 CTGGAGAATATAGCTTTACTGGG + Intergenic
904958583 1:34311115-34311137 CTGGATATTAGAACCTTCATCGG - Intergenic
909115395 1:71527756-71527778 CTTGATGATACAATTTTAAAAGG + Intronic
911042766 1:93604433-93604455 ATGGATAACAGAAATTTAATGGG - Intronic
911959675 1:104285162-104285184 CTGGAAAATAAGAATTTAATAGG - Intergenic
912761974 1:112376312-112376334 TTTGATAATACCATTTTAATTGG + Intergenic
914934448 1:151966030-151966052 CTGGATCATACAACTGAATTTGG + Intergenic
916050943 1:161036721-161036743 CTGGATTTAACAAATTTAATTGG - Intronic
916633525 1:166642265-166642287 CTGGATACTATACCTTTAACAGG - Intergenic
916658326 1:166897812-166897834 CTTGATAATAAAATTGTAATTGG + Intergenic
916915007 1:169396826-169396848 CTGGTAAATGCAACTTTTATTGG + Intronic
918776991 1:188645294-188645316 ATGGATAATCCAACTTAAAATGG - Intergenic
918887445 1:190213674-190213696 CTGGGTACCACAACTTTTATTGG - Intronic
919413387 1:197275349-197275371 TTGGTTAATACCACTTTTATTGG + Intronic
921799438 1:219385182-219385204 CTGGAGAATACACCTTCCATTGG + Intergenic
922215106 1:223513761-223513783 CTGGATAATACATCATTCAAAGG - Intergenic
922882874 1:228995508-228995530 CTGAATAATACACTTTAAATGGG + Intergenic
924166175 1:241285542-241285564 CTTAATAATACTACTTTAAAAGG - Intronic
1064013859 10:11758069-11758091 CTGGATAAGACAACATGTATGGG + Intronic
1065182613 10:23142004-23142026 CTGGATATTAGACCTTTATTGGG - Intergenic
1067356642 10:45534553-45534575 CTGGATAATTTACGTTTAATTGG - Intronic
1068279362 10:54848871-54848893 CTGAATCATACAACATTATTAGG + Intronic
1068710961 10:60133257-60133279 CTGGACAATAAAACTTTTAAAGG - Intronic
1071584205 10:86803457-86803479 CTGGAAAACACTACTGTAATGGG - Intronic
1074351602 10:112743168-112743190 CTGGAAAATAGAACATTATTAGG + Intronic
1074693472 10:116027483-116027505 TTGGATGATACTAATTTAATTGG + Intergenic
1075957999 10:126541449-126541471 CTGGATATTAAACCTTTATTTGG - Intronic
1077866610 11:6227253-6227275 GTGGATAATAATACTTAAATGGG - Intronic
1078342910 11:10513299-10513321 CTGGATAGTAGGATTTTAATAGG - Exonic
1080455745 11:32417090-32417112 CTTGATAATACAACCATAATAGG - Intronic
1080736106 11:35015465-35015487 CTGGTAAATACAGCTTCAATTGG + Intronic
1081238979 11:40680130-40680152 CTGGATAATCGAACTTGCATGGG + Intronic
1081464409 11:43303142-43303164 CTGGATAATAAAACTTGATCAGG - Intergenic
1082039752 11:47675115-47675137 CTGGATAATACAACTTTAATAGG - Intronic
1084039796 11:66535492-66535514 CTGCAAAATACAAAATTAATGGG - Intronic
1084802939 11:71557168-71557190 GTGGATAATAAAATTCTAATTGG - Intronic
1084840825 11:71845544-71845566 CTACAGAATACAATTTTAATAGG - Intergenic
1087826848 11:102774778-102774800 CTGTGTTATAAAACTTTAATCGG - Intronic
1092189771 12:6510664-6510686 CTGGATGATACAACTTTGAGTGG + Exonic
1094145518 12:27224858-27224880 TTAGCTAATACATCTTTAATAGG - Intergenic
1094158492 12:27363620-27363642 CTGGATAAAATAACTTGAATAGG - Intronic
1095041627 12:37448568-37448590 GTAGATAATTTAACTTTAATAGG + Intergenic
1095484405 12:42670339-42670361 CTGCAAAATACCAATTTAATTGG - Intergenic
1096947649 12:55425550-55425572 CTGAAAAATACTACATTAATTGG + Intergenic
1098530621 12:71537621-71537643 CAGGACAATAGAACTTTAAAGGG - Intronic
1098618168 12:72556257-72556279 TTGCATAATACAACCCTAATGGG - Intronic
1100221569 12:92509675-92509697 CTGGGTAATACATCTTGAACTGG - Intergenic
1100566901 12:95804695-95804717 TATGATAATACAGCTTTAATAGG + Intronic
1100571563 12:95848023-95848045 CTTAATAATACAATTTTAAAAGG + Intergenic
1100643737 12:96507670-96507692 CTGGATAATATATTTTTAAAAGG + Intronic
1107159065 13:37204487-37204509 CTGAATACTACAACTTTCAGTGG - Intergenic
1110855431 13:80292407-80292429 CTGGATATTATAACTTTATCAGG - Intergenic
1111775219 13:92653107-92653129 CTTGATAACAAAACTTTTATTGG - Intronic
1114890026 14:26908554-26908576 ATAGATAATACAATTTTAATAGG + Intergenic
1115297088 14:31840704-31840726 CTCTATAATACAACTTTTTTTGG - Intronic
1116826777 14:49680582-49680604 AGGGAAAATACAACTTTAAGAGG + Intronic
1117054129 14:51893271-51893293 CTGGAAATTACCACTCTAATGGG + Intronic
1117171492 14:53104242-53104264 CTGGATTTTACAACTTTAAATGG - Intronic
1117784595 14:59269525-59269547 CTGGAGAACCCAACTTTCATCGG - Intronic
1119196428 14:72720179-72720201 CTGGAATATACCACTTTAAATGG + Intronic
1120343502 14:83253244-83253266 CTGGTAAATAAAGCTTTAATAGG - Intergenic
1122652564 14:103233423-103233445 CTAGACAATCCAACTTTAAAAGG + Intergenic
1125194098 15:37027003-37027025 GAGGATAATACACCTTTAAAGGG + Intronic
1127004965 15:54558593-54558615 CTAAATATTAAAACTTTAATTGG + Intronic
1127418815 15:58784397-58784419 CTAGATAATAAAAATTTATTTGG + Intronic
1129067514 15:72918660-72918682 CTTGATAATACACCTTTTATAGG + Intergenic
1130124478 15:81081516-81081538 CTTGATAAAGCACCTTTAATTGG - Intronic
1136184843 16:28581392-28581414 CTGGATTATACACTTTAAATGGG - Intronic
1138622065 16:58219375-58219397 CTGGATAGCACACCTTTTATTGG - Intergenic
1139698821 16:68694680-68694702 CAAGATAATGCAACTTTCATAGG - Intronic
1139909328 16:70387630-70387652 CTGGATTATACACATTAAATAGG + Intronic
1140731636 16:77861905-77861927 CTTGATAACACATCTTTTATTGG + Intronic
1144455559 17:15415515-15415537 ATGGATAATATGACTTTACTGGG - Intergenic
1146361933 17:32184110-32184132 CGGAATAGTACAACTTTAAAAGG - Intronic
1147273616 17:39295820-39295842 TTGTATAATACACCTTTTATAGG - Intronic
1147749132 17:42717360-42717382 TTGTATAATATAATTTTAATAGG + Intronic
1147880205 17:43648530-43648552 CAGGATAGTACAACTTTGTTAGG + Intronic
1149572778 17:57685435-57685457 CTGGAGAATACAGCTTTCCTGGG - Intergenic
1150588824 17:66543004-66543026 CAGCATAATTCAACTTTAATTGG - Intronic
1153750251 18:8222236-8222258 CTGGAAAAGACACCTTTCATGGG + Intronic
1153752917 18:8252028-8252050 CTGCATAAGACATTTTTAATAGG + Intronic
1156409713 18:36816271-36816293 CTGGACAATGCAACTTTATTAGG - Intronic
1157659644 18:49428831-49428853 CTGAATAATACACTTTAAATGGG + Intronic
1167828695 19:51999573-51999595 CTGGCTTATACACCTTAAATGGG + Intronic
925545234 2:5008842-5008864 CTGGATACCAAAACTTAAATAGG + Intergenic
926623989 2:15074637-15074659 CTATATAATATAACTATAATAGG + Intergenic
928562759 2:32508388-32508410 CTGTATAATACAATTTTATTAGG + Intronic
930965483 2:57318861-57318883 CTGGATATTAGACCTTTGATGGG - Intergenic
932441686 2:71741308-71741330 CTTGATAATACTCCTTTTATCGG - Intergenic
936445364 2:112590573-112590595 CTTGATAATGCACCTTTTATTGG - Intergenic
938219686 2:129554741-129554763 CTGTATTATACAATTTAAATAGG - Intergenic
942035995 2:172011111-172011133 CTGAATTATACACCTTAAATAGG - Intronic
942183604 2:173403461-173403483 CTGGATCAGACAAATTTAAGTGG - Intergenic
943017746 2:182534144-182534166 GTGCATAATACAATTTTAAAAGG - Intergenic
944294524 2:198047545-198047567 CTGAAGAACACAATTTTAATAGG + Intronic
946181648 2:217952702-217952724 CTGGCTAAAACAACATGAATGGG + Intronic
946263913 2:218521866-218521888 CTGGAAAAGACAACGTTAAGTGG - Intronic
947378140 2:229518227-229518249 CTGGATAATTTAACTTAAACTGG + Intronic
947946385 2:234106588-234106610 CTGTATCATATCACTTTAATTGG + Intergenic
948791470 2:240379764-240379786 CTGGATCCTACAAGTTTGATAGG - Intergenic
1170769302 20:19318206-19318228 CTGGATAACACAAGCTTTATGGG + Intronic
1171839200 20:30188752-30188774 GTAGATAATTTAACTTTAATAGG + Intergenic
1175043913 20:56084363-56084385 GTAGATAATACAATTTTAAAAGG - Intergenic
1175643838 20:60654350-60654372 GTGAATAATTCAACTGTAATAGG - Intergenic
1177190879 21:17849790-17849812 CTCAATAATATATCTTTAATTGG - Intergenic
1181891530 22:26067662-26067684 CTGGATAATGCACCTTCTATTGG + Intergenic
950161797 3:10765888-10765910 CTTGATAATACACCTTTCATGGG - Intergenic
950871619 3:16234562-16234584 CTTGATAATGCATCTTTAACTGG + Intergenic
951069011 3:18303729-18303751 CTGGAAAATATATCTTTAATAGG - Intronic
952222775 3:31341432-31341454 CTGGCTAATACTAATTTAATGGG - Intergenic
952746378 3:36785467-36785489 CTGGAGAAGAAAATTTTAATTGG - Intergenic
953522034 3:43652611-43652633 CTGGATAGTACACCTTAAGTGGG + Intronic
954055761 3:48022982-48023004 TTGGATATTGCAGCTTTAATAGG - Intronic
955082592 3:55671982-55672004 CTGGATTAAACAGCATTAATAGG - Intronic
957901163 3:86493580-86493602 CTGGATTTTACAATTTTAAATGG - Intergenic
960249593 3:115437469-115437491 CTGGAGAATAGAACTGTAAAAGG - Intergenic
960252012 3:115465854-115465876 CTCGATAACACAATTTGAATTGG + Intergenic
960538070 3:118834834-118834856 CTGAATATTACCACTCTAATGGG + Intergenic
960892220 3:122460973-122460995 GTGGATAATACTTCTCTAATAGG - Intronic
960894629 3:122489706-122489728 CAGGAAAACACAACTGTAATGGG - Intronic
961922578 3:130443625-130443647 CTGGTTAATAACACTTTATTAGG + Intronic
963295312 3:143539618-143539640 CAGGATGATAAAACTGTAATGGG + Intronic
964206263 3:154178274-154178296 CTAAATTATACAATTTTAATGGG - Intronic
965229430 3:166031263-166031285 TTGGATAGAACAACTTTAGTAGG + Intergenic
965908211 3:173737284-173737306 CTGAATCATACACCTTAAATAGG - Intronic
966505388 3:180695201-180695223 ATGGCTAATACAACTTTGACTGG + Intronic
967604344 3:191426432-191426454 CTGGATAATAGATTTTTACTTGG - Intergenic
969781924 4:9411540-9411562 CTACAGAATACAATTTTAATAGG - Intergenic
970198704 4:13579193-13579215 CTGAATAACACAGCTTTAATTGG + Intronic
971418742 4:26456587-26456609 CTGGATAATGCACCTTTATGTGG - Intergenic
972144715 4:36008797-36008819 CTGGATAATAGACCTTTGTTGGG - Intronic
972145019 4:36013076-36013098 ATGGATAATAAAACTTCATTAGG - Intronic
972732802 4:41811889-41811911 CTGGACAGTACAACTTTAGAGGG + Intergenic
978489481 4:109296991-109297013 CTGTAAAATTCAACTCTAATTGG - Intronic
981106534 4:140888140-140888162 CTGCATAATTCACCTTTAGTTGG + Intronic
981526668 4:145713547-145713569 TCTCATAATACAACTTTAATAGG + Intronic
984832908 4:183992259-183992281 CTGTAAAATACAATTGTAATAGG - Intronic
986620074 5:9663719-9663741 CTGGTGAATGCAACTTTATTTGG + Intronic
988312558 5:29580138-29580160 CTGGATTATACACTTTAAATGGG - Intergenic
990209760 5:53469834-53469856 GTGGATAATACACCTTTATATGG + Intergenic
990976676 5:61566799-61566821 CTCGAAAATACACCTTCAATGGG + Intergenic
991097233 5:62752286-62752308 CTGGCTTAAACAACATTAATTGG - Intergenic
992299446 5:75363482-75363504 TTGGCTAATAAAAATTTAATTGG + Intergenic
993565946 5:89475642-89475664 GTGGAAAATAAAACTTTTATGGG + Intergenic
994303430 5:98174125-98174147 CTTGATAGTACATCTTTTATTGG - Intergenic
997665949 5:135629596-135629618 CTGGCTAACACATCTTTTATCGG - Intergenic
998211056 5:140198733-140198755 TTGGATTGTACAACTTTAAATGG - Intronic
999860782 5:155643449-155643471 CTGGTTAATTCACCTTGAATTGG + Intergenic
999973316 5:156886643-156886665 CTGGACAACAAAACTGTAATTGG - Intergenic
1000633717 5:163619742-163619764 CTGGCTAATAAATATTTAATGGG + Intergenic
1001334576 5:170786909-170786931 GTGGATAAAACAACTGTTATCGG + Intronic
1003123919 6:3340106-3340128 CTGGATAATACCGCTTTTGTGGG - Intronic
1003330871 6:5127383-5127405 CTGAATAATATACCTTAAATGGG + Intronic
1003445660 6:6181518-6181540 GTAGATAATACAATATTAATAGG - Intronic
1003594836 6:7465010-7465032 CTGAATTATACACCTTCAATGGG + Intergenic
1005335334 6:24790473-24790495 CTTCATAATACATCTTTTATTGG + Intergenic
1007266160 6:40597752-40597774 TTTGATTATACAACTTTTATTGG - Intergenic
1007503865 6:42319305-42319327 CTGGAGCATGCATCTTTAATGGG - Intronic
1011351584 6:86429720-86429742 CTGGATTATACACTTTAAATGGG + Intergenic
1011747907 6:90424917-90424939 CTTAATAAAACAATTTTAATGGG + Intergenic
1011818812 6:91225694-91225716 CTGGATGCTTCAACTTTAATGGG + Intergenic
1012610188 6:101208249-101208271 CTGGATAAAACCAGTTCAATAGG + Intergenic
1015121224 6:129703576-129703598 GAAGATAATATAACTTTAATAGG + Intronic
1017874201 6:158511061-158511083 CTGGCTGATAAAACTCTAATGGG + Exonic
1022929835 7:35099474-35099496 GTAGATAATTTAACTTTAATAGG - Intergenic
1024586529 7:50846547-50846569 GTGTATAATAGAAATTTAATGGG + Intergenic
1025287713 7:57680187-57680209 GTAGATAATTTAACTTTAATAGG + Intergenic
1027571481 7:79873554-79873576 CTGGACAATACAAAATAAATAGG - Intergenic
1028074161 7:86490584-86490606 ATAGATAATACAATTTTAAAAGG - Intergenic
1031622371 7:123950074-123950096 CTTAAAAATGCAACTTTAATAGG + Intronic
1036519603 8:9478226-9478248 CTGGATAATAAAAATTAATTTGG + Intergenic
1038129079 8:24708767-24708789 CTGGCTAACACAACTAAAATGGG - Intergenic
1039363305 8:36903592-36903614 CTGGATTATACAATTTTTAAAGG + Intronic
1043267957 8:78289912-78289934 CTGGTTTATACAATTTTATTTGG + Intergenic
1046788779 8:118297579-118297601 ATTGAGAATACAATTTTAATTGG - Intronic
1050058897 9:1684769-1684791 CCTGATAATAGAACCTTAATTGG - Intergenic
1050144677 9:2554540-2554562 CAGGATAATAAAAAATTAATTGG + Intergenic
1050488202 9:6158234-6158256 CTGCATAATCCACCTCTAATTGG + Intergenic
1050986167 9:12085731-12085753 CTTGATGATAAAACTTTTATAGG - Intergenic
1053600696 9:39606030-39606052 GTGGGTTATACAATTTTAATTGG + Intergenic
1053858343 9:42359838-42359860 GTGGGTTATACAATTTTAATTGG + Intergenic
1054252833 9:62736399-62736421 GTGGGTTATACAATTTTAATTGG - Intergenic
1054566949 9:66770898-66770920 GTGGGTTATACAATTTTAATTGG - Intergenic
1056304191 9:85273128-85273150 CTTGATAATACATCCTTTATTGG - Intergenic
1056725430 9:89110365-89110387 CTGTATAATATAACTTAATTAGG + Intronic
1058160610 9:101566274-101566296 TTGGATAATACAAATTTGAAGGG - Intergenic
1058205636 9:102102195-102102217 CTTGAAAATTCAAATTTAATTGG + Intergenic
1058487952 9:105461225-105461247 CTGGATAATACAGACTTAAGAGG - Intronic
1186074319 X:5860909-5860931 CTAGATGATACAGTTTTAATTGG - Intronic
1188352693 X:29151573-29151595 CTTGATAACACACCTTTTATTGG - Intronic
1189548891 X:42072619-42072641 CTTGATACTGCACCTTTAATTGG - Intergenic
1193630469 X:83880473-83880495 CTAGATTATACAACTTGCATGGG - Intronic
1194592980 X:95822903-95822925 CTGCATAACACAACTTAGATTGG + Intergenic
1195447330 X:104969305-104969327 CTGGTTAATACACGTTTAAAAGG + Intronic
1196296998 X:114009459-114009481 CTGTATACTACACCTTTAAGGGG + Intergenic
1199475935 X:148245292-148245314 CTGGATTATACTAATGTAATTGG + Intergenic
1201442343 Y:14022019-14022041 ATAGATAATACAGCTTTATTGGG - Intergenic
1202011604 Y:20346678-20346700 CTGGACATAACAACTTTAAGTGG - Intergenic