ID: 1082040513

View in Genome Browser
Species Human (GRCh38)
Location 11:47681031-47681053
Sequence CAGTAAAAGGAAAATGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 819
Summary {0: 1, 1: 0, 2: 5, 3: 81, 4: 732}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082040509_1082040513 22 Left 1082040509 11:47680986-47681008 CCATCTCACTAAGCAGTACCTAC 0: 1
1: 0
2: 0
3: 9
4: 108
Right 1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG 0: 1
1: 0
2: 5
3: 81
4: 732
1082040510_1082040513 4 Left 1082040510 11:47681004-47681026 CCTACAATGCAAGTACTATTATT 0: 1
1: 0
2: 15
3: 86
4: 519
Right 1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG 0: 1
1: 0
2: 5
3: 81
4: 732
1082040508_1082040513 29 Left 1082040508 11:47680979-47681001 CCATGCACCATCTCACTAAGCAG 0: 1
1: 0
2: 3
3: 8
4: 149
Right 1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG 0: 1
1: 0
2: 5
3: 81
4: 732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082040513 Original CRISPR CAGTAAAAGGAAAATGAGGC TGG Intronic
900468779 1:2840406-2840428 AAGTAAAATGATACTGAGGCAGG - Intergenic
901106572 1:6760912-6760934 CAAGAAAAGGAAAAAGGGGCCGG + Intergenic
901854569 1:12036407-12036429 CAGAAAAAGAAAAAAGAGGCTGG + Intergenic
901854755 1:12037609-12037631 CAGTAAACAGAAAATGTGTCAGG + Intergenic
902138843 1:14334607-14334629 CAGGAAAAGGGAAGTCAGGCAGG + Intergenic
903044856 1:20556984-20557006 CTGTAAAATGAAAATGAGAATGG + Intergenic
903080882 1:20811407-20811429 CAGAAAATTGAAAATGAGCCAGG - Intronic
903347424 1:22695722-22695744 TAATAAAAGTGAAATGAGGCCGG + Intergenic
903395841 1:23001369-23001391 AAGTAAAAGCAAAGAGAGGCGGG + Intergenic
903752548 1:25635743-25635765 CATTAAAAAGAAAATGAGGTGGG - Intronic
903753503 1:25645011-25645033 TAGTAAAGGGAAAAGCAGGCTGG - Intronic
903950164 1:26991976-26991998 AAGTAGATGGAAACTGAGGCAGG + Intergenic
904068896 1:27777528-27777550 CAGTACAAGGGGAAAGAGGCAGG - Intronic
905064244 1:35166360-35166382 AAGAAAAAGGAAATTGTGGCTGG + Intergenic
905200192 1:36310248-36310270 CATTAAAAGATAAATAAGGCTGG - Intronic
905550555 1:38834709-38834731 CATTAAAAAGAAAATTAGCCAGG + Intergenic
905810733 1:40911194-40911216 GAGGGCAAGGAAAATGAGGCTGG + Intergenic
905856792 1:41319834-41319856 CTGTAAATGAAAAATGAGGAGGG - Intergenic
906179263 1:43804435-43804457 CAGTAACATGACTATGAGGCTGG + Intronic
906379486 1:45323360-45323382 CAGAAAAAGAAAAATTAGCCAGG - Intergenic
906468851 1:46109950-46109972 AAGTAATAGGAAAATGAGCTTGG - Intronic
906716801 1:47976053-47976075 CATGAAAAGGAACATGAAGCAGG - Intronic
906921697 1:50071191-50071213 TAGTATAAGGAAAACAAGGCAGG - Intronic
909573574 1:77146806-77146828 AAGTAAAAGAAAAATTAGCCAGG + Intronic
909581420 1:77240017-77240039 CAGTAATAGGAAGTTGAGGGGGG - Intergenic
909805937 1:79874394-79874416 GAGTAAAATGAAAATGATGTGGG - Intergenic
910268239 1:85364161-85364183 CAGTGAAGTGAAAATGAGGATGG - Intronic
910505793 1:87948994-87949016 AAGCAAAAGGAAGAGGAGGCAGG + Intergenic
910716873 1:90241825-90241847 TACTAAAAGGGAAATGAGACTGG + Intergenic
911429809 1:97771019-97771041 CATTAAAAAGAAAAATAGGCTGG + Intronic
911596838 1:99807501-99807523 CAGTGAAAAGAAACTGAGGGTGG - Intergenic
912416589 1:109512451-109512473 CAGAAAGAGGAAAGGGAGGCCGG - Intergenic
912939599 1:114033241-114033263 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
913451575 1:118996394-118996416 CAGCAAAAGGATAATGGGGCAGG + Intergenic
913577664 1:120193485-120193507 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
913590951 1:120324080-120324102 CAGGGAAAGGGACATGAGGCAGG + Intergenic
913630506 1:120704855-120704877 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
913652417 1:120931023-120931045 CAGGGAAAGGGACATGAGGCAGG - Intergenic
913676159 1:121142699-121142721 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
914028052 1:143930643-143930665 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
914168691 1:145198027-145198049 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914230740 1:145763399-145763421 CAATAAAATAAAAATGGGGCTGG + Intronic
914523812 1:148441986-148442008 CAGGGAAAGGGACATGAGGCAGG + Intergenic
914559577 1:148804916-148804938 CAGGAAAAAGAGAGTGAGGCGGG - Intergenic
914599862 1:149193862-149193884 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914613256 1:149325307-149325329 CAGGAAAAAGAGAGTGAGGCGGG + Intergenic
914642593 1:149625154-149625176 CAGGGAAAGGGACATGAGGCAGG - Intergenic
914712417 1:150226753-150226775 GAGGAAGAGGAAAATGAAGCTGG - Exonic
914831751 1:151175422-151175444 CAATAAAAGGGAAATGAGGATGG - Intronic
915301624 1:154954913-154954935 CAGGAAAAGGGAAGTGAGGCTGG + Intronic
915585892 1:156843745-156843767 CTGCAAGAGGAAAATGGGGCTGG - Intronic
915694279 1:157723079-157723101 CAGGAACAAGAAAAAGAGGCAGG + Intergenic
918301024 1:183203992-183204014 CATTTAAAGGACAATGGGGCAGG + Intronic
918378791 1:183934571-183934593 AAGTAAAGTTAAAATGAGGCTGG - Intronic
918630325 1:186709735-186709757 CAATAAAACGTAAATGAGCCTGG - Intergenic
918883349 1:190156599-190156621 CAGTAAAAGAAAAACGGGGATGG + Intronic
919016035 1:192038061-192038083 CAGAAAAAGAACACTGAGGCCGG + Intergenic
919087588 1:192938860-192938882 CAGAAAAAGGAAAATAAGCAGGG + Intergenic
919791426 1:201293201-201293223 CAGTGAAAGGGAGATGAGGGGGG + Intronic
920036996 1:203072556-203072578 CAGTGATAGGAAAGTGAGGAGGG - Intronic
920159773 1:203987476-203987498 AAGGAAAAGGAAAATTAGGTGGG + Intergenic
920188942 1:204180012-204180034 CATTAAAAAGCAAATGGGGCTGG + Intergenic
920463526 1:206161537-206161559 AAGAAAAAGAAAAATCAGGCCGG + Intergenic
921591342 1:217007824-217007846 CAGTCAAAGGCAAATAAGGGGGG + Intronic
921613441 1:217238598-217238620 AAATAAAAGGGAAATGAGGCGGG - Intergenic
921780728 1:219159773-219159795 CAGCAGCTGGAAAATGAGGCTGG - Intergenic
921879729 1:220242091-220242113 CAGTAATAGCAAAATTAGGCTGG - Intronic
921918118 1:220636262-220636284 TATAAAAAGGAAAATGAAGCAGG - Intronic
923762744 1:236862024-236862046 CAGCAGAAGGAAAACAAGGCTGG - Intronic
924260438 1:242224611-242224633 CAGTAACAGGACAAAGGGGCTGG - Intronic
1063192487 10:3709284-3709306 AAGTAAAGGGAAAAGGAGGGTGG - Intergenic
1063325745 10:5099994-5100016 CAGAAAGAGAAAAATTAGGCCGG + Intronic
1063724010 10:8616534-8616556 CAGTAAATGAAAAATGAGCACGG - Intergenic
1064508157 10:16056627-16056649 AGGTATATGGAAAATGAGGCTGG + Intergenic
1064520944 10:16200184-16200206 AATTAAAAGAAAAAGGAGGCTGG + Intergenic
1065034612 10:21624977-21624999 CAGTAAGAGGAAGAGGAGGAAGG - Intronic
1065337344 10:24666526-24666548 ACGTAAAAGGACAATCAGGCTGG - Intronic
1065487776 10:26251192-26251214 TAGAAAAAGAAAGATGAGGCTGG - Intronic
1065941175 10:30565192-30565214 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1066664781 10:37771968-37771990 GATTAAAAGGTAAAGGAGGCCGG + Intergenic
1066746459 10:38606486-38606508 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1068015403 10:51510093-51510115 CAGTGAAAGGAAAGGGAGGTTGG - Intronic
1068496535 10:57790626-57790648 AAGGAAAAAGAAAATGAGGAAGG + Intergenic
1068513791 10:58000674-58000696 AAGAAAGAGGAAAAGGAGGCAGG + Intergenic
1068589072 10:58834924-58834946 AAGAAAAAGAAAAATTAGGCAGG + Intergenic
1069176364 10:65293774-65293796 AAGGAAAGGGAAAATGAGGCAGG - Intergenic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069665681 10:70155853-70155875 CAGTAAAAAGAAACAGAGGGAGG + Intronic
1069686607 10:70322975-70322997 GATTAAAAGCAACATGAGGCAGG - Intronic
1069694400 10:70376213-70376235 CAGTCAAAGGACAAGCAGGCAGG + Intronic
1070086608 10:73244197-73244219 GATAAAAAGGAACATGAGGCCGG + Exonic
1070148445 10:73791227-73791249 CAGCAAGAGGAGGATGAGGCAGG - Intronic
1070667129 10:78353186-78353208 CTGCAAAAGGAAAATGAGCAAGG - Intergenic
1070991644 10:80738705-80738727 GAGAAAAAGGAAAAAGGGGCGGG - Intergenic
1071069535 10:81675460-81675482 CAGCAAAAGGAAAAAGAGCTTGG + Intergenic
1071516503 10:86301148-86301170 CAGAAAAGAGACAATGAGGCCGG + Intronic
1073308747 10:102524299-102524321 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1073416957 10:103391802-103391824 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1074122211 10:110501189-110501211 CAGTCAAGAGAGAATGAGGCAGG - Intronic
1074201796 10:111243967-111243989 AAGGAAAAGAAAAATGAGGGAGG + Intergenic
1074253085 10:111773108-111773130 AATTAAGAGGTAAATGAGGCTGG + Intergenic
1075106867 10:119544971-119544993 CAAAAAAAGGAAAAAAAGGCCGG + Intergenic
1075585711 10:123656653-123656675 CAGTAAAAGGAAACAGAGACAGG - Intergenic
1076080100 10:127572059-127572081 AAGGATAAGGAGAATGAGGCAGG + Intergenic
1076270685 10:129149787-129149809 CACAAGAAGGAAACTGAGGCTGG + Intergenic
1076565783 10:131398184-131398206 GAGAAAAGGGAAAATGAGGCAGG - Intergenic
1076924443 10:133475327-133475349 CATTGAAAGGAAAATTAGGTGGG - Intergenic
1077857171 11:6139778-6139800 CATAAAAAGAAAAATGAAGCTGG + Intergenic
1078364582 11:10695539-10695561 CTTCAAAAGGAAACTGAGGCTGG + Intergenic
1078758817 11:14235380-14235402 CAATAAAAAGTAAATAAGGCAGG + Intronic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079691450 11:23423371-23423393 CAGCAGAAGGCAAATGATGCGGG - Intergenic
1082040513 11:47681031-47681053 CAGTAAAAGGAAAATGAGGCTGG + Intronic
1082834586 11:57642187-57642209 AATTACAAGGAAATTGAGGCCGG + Intergenic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1083105180 11:60350738-60350760 TAGTATAAGTAATATGAGGCAGG + Intronic
1084180741 11:67444461-67444483 AAGTAAAAGAAAAATTAGCCAGG - Intergenic
1084185955 11:67471321-67471343 CCATAAAATGAACATGAGGCCGG - Intergenic
1085009955 11:73132324-73132346 CTGTGAAAGTAAAATGAGACAGG - Intronic
1085802404 11:79602515-79602537 AAGTAAAATGGAAATGAGGAAGG + Intergenic
1086041122 11:82480706-82480728 CAGTAAAAGTAAAACCAAGCTGG - Intergenic
1086453786 11:86942168-86942190 CAATAAAAGGAAAGGGAAGCAGG + Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1087402172 11:97681672-97681694 CTGTAAAAAGACAAAGAGGCTGG - Intergenic
1087460572 11:98440373-98440395 AAGAAATAGGTAAATGAGGCTGG - Intergenic
1087778883 11:102282663-102282685 AATTAAAAAGAAAATTAGGCCGG + Intergenic
1087903381 11:103667861-103667883 CAAAAAAAGGAAAGTAAGGCTGG - Intergenic
1088105654 11:106204072-106204094 AAATAAAAGGAGAATAAGGCAGG + Intergenic
1088615232 11:111619639-111619661 ATTTAAAAAGAAAATGAGGCTGG - Intronic
1088792251 11:113236117-113236139 CTGTAGAAGGAAGATGAGACAGG - Intronic
1088912757 11:114204434-114204456 GAATAAAAGAAAAATGAGACCGG - Intronic
1089038499 11:115422370-115422392 GATTAAAAGGAAAAACAGGCAGG + Intronic
1090428917 11:126629692-126629714 CGGAAATAGGAAAATGAGGTTGG + Intronic
1090520610 11:127475121-127475143 CATTAAAGGGAAAATGATGAGGG - Intergenic
1090588900 11:128244039-128244061 CAGTAGAGGGGAGATGAGGCAGG + Intergenic
1092615232 12:10210937-10210959 CATCAAAACTAAAATGAGGCCGG - Intergenic
1093145947 12:15567190-15567212 GAGTCAAAGGAAAATGAGAGGGG - Intronic
1093462481 12:19419268-19419290 CATTACAAGGAAACTGAGGCAGG - Intronic
1093892525 12:24539787-24539809 GAGTAAAATGAAAATGAAGTAGG - Intergenic
1093961682 12:25280301-25280323 TAGTAACAGGAAATTGTGGCAGG - Intergenic
1094013748 12:25838828-25838850 CAGAAAAATAAAAATGATGCAGG - Intergenic
1094266190 12:28563231-28563253 TATAAAAAGGAAAATGAAGCAGG + Intronic
1094546329 12:31407758-31407780 CAGGAAAAAGACAATGAGCCTGG + Intronic
1094565259 12:31592630-31592652 CTATAAAAATAAAATGAGGCCGG + Intergenic
1094824966 12:34262905-34262927 CAAAAAAAGAAAGATGAGGCCGG - Intergenic
1095086037 12:38058077-38058099 CAAAAAAAGAAAGATGAGGCCGG + Intergenic
1095156335 12:38860038-38860060 CAGCAAAAGCAAAATTAGGTGGG + Intronic
1095583856 12:43829791-43829813 CAGTAAAAGGAACTGTAGGCCGG + Intergenic
1095610523 12:44122338-44122360 CACAAAAAAGAAAAAGAGGCTGG - Intronic
1095694476 12:45129192-45129214 AAGAAAAAAGAAAAGGAGGCCGG + Intergenic
1096173386 12:49492797-49492819 AAGAAAAAGAAAGATGAGGCCGG + Intronic
1096604926 12:52757851-52757873 AAGAAAAAGGAAAATCAGGTGGG - Intergenic
1096929882 12:55196058-55196080 CAGTGAAAAGAAAATGTGTCCGG - Intergenic
1097081838 12:56437514-56437536 CAGAATACAGAAAATGAGGCAGG + Intronic
1097205220 12:57315335-57315357 AAGTAATAGAAAAATTAGGCTGG - Intronic
1097285560 12:57874386-57874408 CGGAAAAAGGAAAAGGAGCCTGG - Intergenic
1097947837 12:65391969-65391991 CTGTAGCAGGAAAATCAGGCAGG - Intronic
1098085431 12:66837520-66837542 CAGCAAAAGTGAAATGAGGCTGG + Intergenic
1098085861 12:66842459-66842481 CACCCAAAGGAAACTGAGGCAGG - Intergenic
1098249826 12:68558019-68558041 CAGAAAATGGAAGTTGAGGCTGG - Intergenic
1098528711 12:71516110-71516132 GAGGAAAAGGAGAATGAGGGAGG + Intronic
1099243830 12:80170728-80170750 CAGTAATAAGAAAAGAAGGCTGG - Intergenic
1099726575 12:86437447-86437469 TATTAAAAAGAAAATGAGGAAGG + Intronic
1099734913 12:86555069-86555091 CCTTAAAAGGAAAAGGAGGCAGG - Intronic
1099771657 12:87067026-87067048 TAGAAAGAGGAAAATAAGGCAGG - Intergenic
1100823349 12:98452528-98452550 CAATAAAATAAAATTGAGGCCGG - Intergenic
1100991659 12:100257785-100257807 AAATAAAAGGAAAACCAGGCTGG - Intronic
1101231513 12:102746331-102746353 CAGTAAAAGGAAGATGAAGTGGG + Intergenic
1101390740 12:104297659-104297681 CATTAAAAACAAAATCAGGCCGG - Intronic
1102288323 12:111677954-111677976 CACTAAAAAGAGAATGAGGCCGG + Intronic
1102324466 12:111967955-111967977 CAGGAAATGGAAACTGAGGGAGG + Intronic
1102539397 12:113607779-113607801 CAGTAAAACAAGACTGAGGCCGG + Intergenic
1102678226 12:114672882-114672904 AAGCAAAAGGAAACTGGGGCTGG + Intronic
1102691498 12:114764924-114764946 ATTTAAAAGGAAAATGGGGCTGG + Intergenic
1103603454 12:122069258-122069280 AAAGAAAAGGAAAAAGAGGCTGG - Intergenic
1103658477 12:122494184-122494206 CAGGAAAAGAAATATGAGGCAGG - Intronic
1103787445 12:123443762-123443784 CAGTGAAAGTTAAAAGAGGCCGG - Intergenic
1104225930 12:126833047-126833069 AAGCAAAACAAAAATGAGGCAGG - Intergenic
1104683553 12:130768972-130768994 AAGGAAAAGAAAAATGAGGCCGG + Intergenic
1104900751 12:132188478-132188500 CAGAAACAGAAAACTGAGGCAGG + Intergenic
1105060511 12:133146116-133146138 CAGTAATACGAGAATGAGGTGGG + Intronic
1105352915 13:19632106-19632128 CAGTTAAAGGAAAAAGAGGGAGG - Intergenic
1105551333 13:21398734-21398756 CAGTGAAATGAAAATGAGGTTGG + Intronic
1105736600 13:23278128-23278150 CTGTAAAAGTAAGTTGAGGCTGG - Intronic
1106224846 13:27777280-27777302 CAGGTAAAGGGAATTGAGGCTGG - Intergenic
1106513978 13:30436805-30436827 AAGAAAGAGGAAAAGGAGGCTGG - Intergenic
1106717328 13:32405211-32405233 GATAAAAAGTAAAATGAGGCCGG + Intronic
1107131388 13:36900067-36900089 GAGTAGAAGGAAAAGAAGGCAGG - Intronic
1107147646 13:37075911-37075933 CAATAAAAGCAAAATGAGGTTGG - Intergenic
1107416976 13:40209994-40210016 CTAGAAAAGGAAAATGAGGCCGG + Intergenic
1107470676 13:40688377-40688399 CAAAAAAAGAAAAAAGAGGCCGG - Intergenic
1107722125 13:43259768-43259790 TATCAAAAGGAAAATAAGGCCGG - Intronic
1107763033 13:43702307-43702329 AATTAAAAGGCAAATGAAGCAGG + Intronic
1107869400 13:44733318-44733340 CAGTAAAATAGAAAAGAGGCAGG + Intergenic
1107971907 13:45651256-45651278 CAGTCAAGGGAAAAGGAGGTTGG - Intergenic
1108004665 13:45934624-45934646 CAGTATCAGGAAGAGGAGGCTGG + Intergenic
1108558764 13:51622582-51622604 CTGTAAAATGAAAATGAACCAGG + Intronic
1110220958 13:73072734-73072756 CGGTAAAAGGAAAAGGGAGCAGG - Intronic
1110323001 13:74181384-74181406 CAGAAAATTGAGAATGAGGCTGG + Intergenic
1110347288 13:74463352-74463374 CAGGACAAAGAAAATCAGGCTGG - Intergenic
1110382188 13:74865629-74865651 AAAGAAAAGGAAAATGATGCTGG - Intergenic
1110401477 13:75096623-75096645 CAGGGAAAGTAAAATGAGTCTGG + Intergenic
1110714405 13:78684652-78684674 CAGAATAAAGAAAATCAGGCTGG - Intergenic
1111347610 13:86980809-86980831 CAGTAAAAGGAAGATAAAGTTGG - Intergenic
1111476112 13:88750179-88750201 CATTAAAAGGAGGCTGAGGCAGG + Intergenic
1111986368 13:95070581-95070603 CAGTGAAAGGAAAACAAGGAGGG - Intronic
1111991429 13:95121089-95121111 CATGAAAGAGAAAATGAGGCAGG + Intronic
1112492234 13:99877379-99877401 CAGGGCAAGGAAAATGAGGGTGG - Intronic
1114935065 14:27524867-27524889 CAATAAAAGCAAAAATAGGCCGG - Intergenic
1114987551 14:28250049-28250071 CAGCAAAAGAAAAATGAGGAAGG + Intergenic
1115163717 14:30424593-30424615 CAGAGAAGAGAAAATGAGGCAGG + Intergenic
1115530474 14:34322441-34322463 CAGTAAAGGAAAAATCTGGCTGG + Intronic
1115570004 14:34657461-34657483 CAGAAAAAGCAAGATTAGGCCGG - Intergenic
1115607983 14:35024323-35024345 CATTAAAATGGAAGTGAGGCCGG - Intronic
1116665043 14:47764153-47764175 CAATAAAAGGATGAGGAGGCCGG + Intergenic
1116827150 14:49683701-49683723 AAGGAAAGGAAAAATGAGGCAGG + Intronic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1118335601 14:64851202-64851224 CAGTACAAGGATTAAGAGGCAGG + Intronic
1118486634 14:66220492-66220514 CAGAAATACAAAAATGAGGCTGG - Intergenic
1119216152 14:72870776-72870798 CATTAAAAGGGTAACGAGGCTGG + Intronic
1119216281 14:72871635-72871657 CATTAAAATGGTAATGAGGCTGG + Intronic
1119679423 14:76580883-76580905 CTGTAACAGGAAGATGAGGCTGG + Intergenic
1119918787 14:78426994-78427016 CTTCAAAAGGAAAATCAGGCTGG + Intronic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1121043049 14:90765940-90765962 GAGAAAGAGAAAAATGAGGCTGG - Intronic
1121219472 14:92274922-92274944 CAGGAGAAGGAAGGTGAGGCGGG - Intergenic
1121365837 14:93309100-93309122 CATTAAAAGGAACATGAAGTTGG - Intronic
1121843413 14:97153155-97153177 CAGTAAAAGAAAAATAGGCCTGG - Intergenic
1122730363 14:103792772-103792794 CAAAAAAAAGAAAAAGAGGCTGG + Intronic
1123453303 15:20388254-20388276 TAGTATAAGAAAAATGAGGGTGG + Intergenic
1123821133 15:24031522-24031544 CAGAAAAAGGAAAAGGACTCAGG + Intergenic
1123849962 15:24344336-24344358 CAGTCAATGCAAATTGAGGCAGG + Intergenic
1124181288 15:27477742-27477764 TATTAAAAAGAAAAGGAGGCCGG + Intronic
1124350590 15:28952989-28953011 CAGGAAAAGGAAGAACAGGCGGG + Intronic
1125718633 15:41834579-41834601 CAGTAATAGAAAGATGAGGACGG - Intronic
1126623766 15:50666505-50666527 GAGGAAAAAGAAAAAGAGGCCGG + Intronic
1127217732 15:56842591-56842613 CAGAAAAAGTAAAATGAAGGGGG + Intronic
1127465337 15:59238864-59238886 CATGAAAAGGAAAAAGAGCCAGG - Intronic
1127582174 15:60348446-60348468 TAATAAAAGTAAAATGTGGCCGG + Intronic
1127822635 15:62672860-62672882 CAGGAAAAGAAAAATGAATCAGG + Intronic
1127853667 15:62937050-62937072 CATTAAAAGAAACAAGAGGCCGG - Intergenic
1128230049 15:66028071-66028093 CAGTAAAAGGGAGCTGAGACAGG - Intronic
1130020432 15:80226180-80226202 CAGTAAAAAGAGAATGAGGTGGG + Intergenic
1130079496 15:80720094-80720116 CAACAAAAAGAAAAGGAGGCTGG - Intronic
1130685317 15:86032011-86032033 CAGTTACAAGACAATGAGGCTGG - Intergenic
1131408911 15:92189563-92189585 CATTACAATGAAAAGGAGGCAGG + Intergenic
1131573288 15:93561020-93561042 ATGGAAAAGGAAAAAGAGGCTGG + Intergenic
1132526994 16:421946-421968 CAATAAAATAAAAATAAGGCTGG - Intergenic
1132664144 16:1073988-1074010 CAGGAGAGGGAAACTGAGGCAGG - Intergenic
1133146478 16:3790826-3790848 CAGTAAAAGGAAAACCACGGGGG + Intronic
1133217875 16:4304390-4304412 CAGGGAAAGGAAAACAAGGCAGG + Intergenic
1133293204 16:4736333-4736355 AACTAGAAGGAAACTGAGGCAGG + Intronic
1133788162 16:8989030-8989052 CAATAAAATGAAAATTAGGCAGG - Intergenic
1134267635 16:12705459-12705481 CATAAAAAAGAAAATTAGGCTGG + Intronic
1134794497 16:17022551-17022573 AAATAAAAAGAACATGAGGCTGG - Intergenic
1135513006 16:23104247-23104269 CATTAGAAGGAAAATGTGCCAGG - Intronic
1135553471 16:23416323-23416345 CAGAAAAAGAAACATCAGGCTGG - Intronic
1135703736 16:24656164-24656186 AAAGAAAAGAAAAATGAGGCCGG + Intergenic
1135943118 16:26840154-26840176 TAGTAAAATAAAAAGGAGGCTGG + Intergenic
1136050154 16:27644459-27644481 GACTAAAAGAAAAATGATGCAGG - Intronic
1136143219 16:28300478-28300500 CATTAAAAAAAAAATGAGCCAGG - Intronic
1136148367 16:28329669-28329691 ATGTTAAAGGAAAATGGGGCCGG + Intergenic
1136677204 16:31921424-31921446 TATTAAAAGGAAAAATAGGCCGG - Intergenic
1136736602 16:32473156-32473178 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
1137856956 16:51804267-51804289 CATTAAAAGCAAAATCAGGCTGG - Intergenic
1138241856 16:55433882-55433904 GAGGAGAAGGAAAATGAGGCAGG + Intronic
1139449578 16:67018736-67018758 AAGAAAAAAGAAAAGGAGGCAGG + Intergenic
1139612288 16:68067576-68067598 TAATAGAAAGAAAATGAGGCTGG - Intronic
1139624041 16:68170787-68170809 CAATAAAAGAAAATCGAGGCCGG - Intronic
1139939780 16:70596881-70596903 CTGTAAAATGGAAATGAGGCTGG - Intronic
1139952148 16:70677700-70677722 CAGTAAAGGGGAAAAGAGGATGG - Intronic
1140086096 16:71798584-71798606 GATTAAAAGATAAATGAGGCCGG + Intronic
1140235856 16:73158007-73158029 CAGGAAAAAAAAAATGAGACAGG + Intergenic
1140275808 16:73507654-73507676 CATTAAAAGAAAAATCAGCCAGG - Intergenic
1140395144 16:74620033-74620055 CAGAACAAAGAAACTGAGGCAGG + Intergenic
1140468260 16:75199358-75199380 CTGAAAAAGTAAAAAGAGGCCGG - Intergenic
1141278951 16:82613379-82613401 TTGTAAAAGAAAAATGAGACCGG + Intergenic
1203016466 16_KI270728v1_random:356421-356443 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1203034801 16_KI270728v1_random:629579-629601 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1142882887 17:2895153-2895175 CCATAAAAGGAAAATCAGGGTGG + Intronic
1143545788 17:7594422-7594444 CCATATAAAGAAAATGAGGCTGG - Intronic
1144220383 17:13094630-13094652 CAGTATCAGGAAAGTGGGGCAGG - Intergenic
1144388490 17:14771765-14771787 CAGTAAAAGGGGAGTGAGGCAGG - Intergenic
1144694740 17:17295144-17295166 AAGAAAAAAGAGAATGAGGCCGG - Intergenic
1146402000 17:32507100-32507122 TAGTAAAAGTAAAAATAGGCTGG + Intronic
1146649237 17:34596544-34596566 CAAAAAAGGGAAACTGAGGCAGG + Intronic
1147195360 17:38762921-38762943 AAGTAAAAGGACAAGGAGGATGG - Intronic
1147228293 17:38998034-38998056 AAATAAATGGAAAATGAGCCGGG - Intergenic
1147547870 17:41417192-41417214 TGGTAAAAGGAAAATGGGGCCGG - Intergenic
1147698036 17:42371372-42371394 CAGTAAAAGCCAAAACAGGCGGG + Intronic
1147958446 17:44151162-44151184 CACTAAAAGGCATTTGAGGCAGG + Intronic
1148624965 17:49062284-49062306 CAGTAAAGATACAATGAGGCCGG - Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148726737 17:49797445-49797467 CTGTAATAGGAAAAAGAGACTGG + Intronic
1148791747 17:50177092-50177114 GAGGAAAAGGAGAAGGAGGCTGG - Intergenic
1149045287 17:52238039-52238061 CAGGCAAAGGAAACTGAGTCTGG - Intergenic
1149185378 17:53991329-53991351 AAAAAAGAGGAAAATGAGGCAGG - Intergenic
1149400601 17:56292125-56292147 CATGAAAAGGAAAACGAGGGAGG - Intronic
1149611904 17:57963730-57963752 CATTAAAAAAAAAATAAGGCGGG + Intergenic
1149681663 17:58511923-58511945 CAGAGCTAGGAAAATGAGGCAGG + Intronic
1149827268 17:59840476-59840498 CAGTATAAGGAAAATCTGGTTGG + Exonic
1149837035 17:59922335-59922357 CTACAAAAGGAAAAAGAGGCCGG - Intronic
1149971066 17:61219027-61219049 CAGCAAACAGAAAATGAGGAGGG - Intronic
1149972557 17:61233659-61233681 AAGTAAAAGAAACATGAGACAGG - Intronic
1150060230 17:62061670-62061692 CAATGAAAGAAAAAGGAGGCTGG + Intronic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1150441847 17:65197640-65197662 AAGAAAAAAGAAAATCAGGCTGG - Intronic
1150447716 17:65240369-65240391 CAGGAGAAAGAAAATGAAGCTGG - Intergenic
1150464623 17:65381558-65381580 CAGAAAAGAGAAAATGAGGCAGG + Intergenic
1150910885 17:69386371-69386393 CAGTAAAAACGAAATGAGGGAGG + Intergenic
1151383570 17:73741756-73741778 GAGAAAAAGAAAAAGGAGGCAGG - Intergenic
1151429317 17:74051726-74051748 GAGGAACAGGAAAATGAGGCTGG + Intergenic
1151479729 17:74362836-74362858 CAATGTAAGGAAACTGAGGCAGG + Intergenic
1151594052 17:75066058-75066080 CAGTAAAATGAAAGGGAGGAGGG - Intergenic
1151853852 17:76708289-76708311 CAGTTAATGGAAAATGAAGAGGG + Intronic
1152329898 17:79666588-79666610 CAGAAAAGAGAGAATGAGGCTGG + Intergenic
1152374277 17:79910941-79910963 GAGTGAAACGAAAATGTGGCAGG - Intergenic
1152478787 17:80536423-80536445 AAGAAAAAGAAAAATGGGGCCGG - Intergenic
1153224023 18:2884250-2884272 CAAAAAAAAGAAAAAGAGGCTGG - Intronic
1153261662 18:3230266-3230288 AGCTAAAATGAAAATGAGGCAGG + Intergenic
1153273342 18:3344587-3344609 GAGGAAAAGGAAAACTAGGCAGG + Intergenic
1153853731 18:9123789-9123811 TTGTAAAAGAAAAATGAGGCAGG - Intronic
1154088647 18:11334981-11335003 CAGAAAAAGGAAAATGATATAGG - Intergenic
1154144118 18:11851971-11851993 CAGGAAATGGCAGATGAGGCGGG + Exonic
1154265861 18:12878368-12878390 AAGAAAAAGAAAAATGTGGCTGG + Intronic
1154330826 18:13427841-13427863 AAATATATGGAAAATGAGGCAGG - Intronic
1154387433 18:13907498-13907520 CAACAAAAGCAAAATCAGGCAGG + Intronic
1154996824 18:21648492-21648514 CCATAAAAGGAACATCAGGCTGG + Intergenic
1155277000 18:24198082-24198104 CAGTAGAAGGAAAATTTGGCTGG - Intronic
1155280846 18:24238080-24238102 CAGTACATGGAAAATGATGTTGG - Intronic
1155345331 18:24851958-24851980 CAGTAGAAGGAAGGTGAGGGAGG - Intergenic
1155788606 18:29934142-29934164 CAGAAAAAGGAAAATAAGACAGG + Intergenic
1155952817 18:31931894-31931916 CAGTAAAAGGAAAAAGAAAGGGG + Intronic
1156079769 18:33318296-33318318 CAGTAAAATGAATATCAGGGAGG + Intronic
1156637330 18:39047331-39047353 CAGTGATAGGAAAATGAGAGAGG - Intergenic
1156844770 18:41652657-41652679 CAGTGAAAGAAGAATGGGGCAGG + Intergenic
1156920077 18:42511433-42511455 CAGTGAAAGGATATTGAGCCGGG - Intergenic
1157348720 18:46865241-46865263 AAGTAAAGGCAAAATGAGGCCGG + Intronic
1157849485 18:51034545-51034567 AAGAAAAAGGAAAAAAAGGCTGG - Intronic
1158106646 18:53892446-53892468 TAAGAAAAGGAAAATTAGGCTGG + Intergenic
1158146962 18:54325155-54325177 CAGGATAAGGGAAATGAGGGAGG - Intronic
1159044762 18:63358880-63358902 AATTAAAAAGAAAAAGAGGCAGG + Intronic
1159347450 18:67225408-67225430 AAGTTAAAGAAAAATAAGGCCGG - Intergenic
1159554637 18:69932603-69932625 GCGCAAAAGCAAAATGAGGCTGG - Intronic
1159699708 18:71609627-71609649 AAGTGAAAGGAAAATGAGACAGG - Intergenic
1159862377 18:73664098-73664120 CAGCAAAAGAAAAAAGTGGCCGG + Intergenic
1160589533 18:79935490-79935512 GAGGAAAAGGAAAATGTTGCTGG - Intronic
1160606644 18:80056333-80056355 CAGCAAGAGAAAAATAAGGCAGG - Intronic
1161276716 19:3422419-3422441 CCTTGAAAGGAAAGTGAGGCCGG + Intronic
1161712293 19:5855707-5855729 AGGTAAAAGCAAAAAGAGGCTGG - Intergenic
1161822259 19:6537066-6537088 CATAAAAAGGAAGAAGAGGCCGG - Intergenic
1161955213 19:7490152-7490174 AAGGAAAAGGACATTGAGGCCGG - Intronic
1162173895 19:8815109-8815131 CATTACAAGAAAAATGAAGCTGG + Intronic
1162575124 19:11494915-11494937 CAGTAAAAGGCAGAGGAGGGCGG + Intronic
1163023987 19:14498948-14498970 CTTTAAAAGAAAAAAGAGGCCGG + Intergenic
1163082021 19:14950947-14950969 AAAAAAAAAGAAAATGAGGCAGG + Intronic
1163703075 19:18796240-18796262 GAGTAAAAGGAGAATGGGGCTGG - Intergenic
1163998570 19:21076136-21076158 AAGAAAAAAGAAAAAGAGGCCGG - Intergenic
1164839791 19:31384245-31384267 CTGTAAAAGCAATTTGAGGCCGG - Intergenic
1165009253 19:32831977-32831999 AATTAAAAAGAAAATGGGGCTGG + Intronic
1165066308 19:33230845-33230867 GAGAACAGGGAAAATGAGGCAGG - Intergenic
1165527588 19:36369136-36369158 TACTAAAAGGAAAGTGGGGCCGG - Intronic
1165726728 19:38117945-38117967 GCGTAAAGAGAAAATGAGGCTGG - Intronic
1166116825 19:40661461-40661483 CAGTAACAGGAAGCTGAGGTGGG - Intergenic
1166536774 19:43579600-43579622 GAGTAAAATGAAAGGGAGGCCGG + Intronic
1167026655 19:46924505-46924527 CAGGCAAAGGAAAATCAGACAGG - Intronic
1167407338 19:49321350-49321372 GAGTTAAAGGAAAATACGGCTGG + Intronic
1167625529 19:50585942-50585964 CAGCAGAAAGAAAATCAGGCTGG + Intergenic
1167726094 19:51213830-51213852 AAGAAAAAGAAAAATGAGGCTGG - Intergenic
1167854248 19:52225316-52225338 AATTAAAAGTAAAATCAGGCCGG - Intronic
1168103540 19:54153521-54153543 CAGGAGAAGGAAAATGAGACAGG - Intronic
1168565532 19:57419175-57419197 CAGTAAAAGGAACAGGTGGCTGG - Intronic
925073547 2:990491-990513 CTGTAATAGGAGAAAGAGGCAGG - Intronic
925290114 2:2742150-2742172 CAGTAGGAGAAACATGAGGCAGG + Intergenic
925673647 2:6337798-6337820 CAGTGCAAGGAAATTGAGGCGGG - Intergenic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
925850301 2:8075290-8075312 TAAGAAAAGGAAGATGAGGCCGG + Intergenic
926172036 2:10558606-10558628 CAGTGTGAGGAAACTGAGGCAGG + Intergenic
926481996 2:13410978-13411000 TAGTATAAGAAAAATGAGGGTGG - Intergenic
926871628 2:17425193-17425215 TAGTAAAAGTTAAATGTGGCAGG - Intergenic
926873014 2:17444223-17444245 GAGGAAAAGGAGAATGAGGAAGG + Intergenic
926935406 2:18082806-18082828 GAGTAAAAAGAAAAAGAGGAGGG - Intronic
927893484 2:26766800-26766822 CTGTATAAGGAAACTGAGGTAGG + Intronic
930044137 2:47154382-47154404 CAGAATAAGGAAAATGAGATGGG + Intronic
930636936 2:53816564-53816586 CATTAATAAGAAAATGGGGCTGG - Intronic
931273499 2:60723326-60723348 CAGAAAAAAGAAAATCAGCCGGG - Intergenic
931415847 2:62079541-62079563 GAGGGCAAGGAAAATGAGGCTGG - Intronic
931972225 2:67601296-67601318 CACTCAAAGGAAGATAAGGCAGG - Intergenic
932261928 2:70334213-70334235 CTTGAAAAGGAAAATAAGGCTGG - Intergenic
932511476 2:72297345-72297367 GAGGAACAGGAAAATGAGGAGGG - Intronic
932615907 2:73231413-73231435 CAAAAAAAAGAAAAAGAGGCCGG - Intronic
932928087 2:76000298-76000320 CAGACAGAGGAAACTGAGGCAGG - Intergenic
933591155 2:84233990-84234012 CAGTAAAAACAAAATGAAGTTGG + Intergenic
933620348 2:84531604-84531626 TTGTAAAAGGAAAATAAGGGAGG - Intronic
933736465 2:85499251-85499273 CAGGAAAAGGAAAATGGGCTGGG - Intergenic
934187756 2:89762273-89762295 CAGGGGAAGGAAAATGGGGCAGG - Intergenic
934308861 2:91845675-91845697 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
934557566 2:95295518-95295540 CAGTGAAAGGAGGATGGGGCTGG + Intergenic
935165374 2:100564590-100564612 CATCAAAAGAAAAATGAGGCCGG - Intronic
936388482 2:112052521-112052543 AAAAAAAAGGAAAATGAGGAAGG - Intergenic
936572149 2:113626278-113626300 CTGTGAAAGGAAAATGAATCTGG + Intergenic
936691121 2:114890212-114890234 GAGTAAAATGAATTTGAGGCAGG + Intronic
936847214 2:116851759-116851781 CAGAAAGAGGAAAATGGGGAAGG - Intergenic
937017041 2:118615847-118615869 TAGCAAAGGGAAAATGAGTCAGG - Intergenic
937404619 2:121615382-121615404 CAGCATAAGTAAAATGAGGGAGG + Intronic
937677632 2:124609290-124609312 AAATAAATGGAAAATAAGGCTGG + Intronic
938212946 2:129483848-129483870 CAGAAAGAGGAAAATGGGGGAGG - Intergenic
938295915 2:130179415-130179437 CAAAAAAAGAAAAAAGAGGCTGG - Intronic
938419949 2:131137241-131137263 CAAAAAAAGTAAAAAGAGGCCGG - Intronic
938452257 2:131431944-131431966 CAGTAAAAGCAAGATGTGGCTGG - Intergenic
938621558 2:133059932-133059954 CAGAAAAAAAAAAATGAGGGAGG + Intronic
938709140 2:133960404-133960426 AAGAAAAAGAAAAAAGAGGCTGG - Intergenic
938709186 2:133960733-133960755 AAGTAAAAGAAACATGAGGCCGG - Intergenic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939275954 2:139996406-139996428 TAGTCAGAGAAAAATGAGGCTGG - Intergenic
939500135 2:142974230-142974252 CAGTAAAGGGAAAAGTGGGCTGG + Intronic
939619011 2:144395292-144395314 CAGAAAAGGGAATATGAGCCAGG - Intronic
939683170 2:145164065-145164087 TCGAAAAAGGAAAATGAGACTGG - Intergenic
940071611 2:149694644-149694666 CTGTGAAAGTGAAATGAGGCTGG + Intergenic
940072186 2:149701266-149701288 CAGTAAATGGAAAATGAGAAAGG - Intergenic
940165779 2:150769249-150769271 CAGTAAAGTGAAAAAGAGGAGGG + Intergenic
940199485 2:151134665-151134687 TATTAAAAGGAAAAATAGGCTGG + Intergenic
940217004 2:151312127-151312149 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
940421685 2:153486229-153486251 CATTAAAAGGAAGGTGAGGCTGG - Intergenic
940691052 2:156921448-156921470 CAGTAAGAGGAAAAATAGCCAGG - Intergenic
940828522 2:158440883-158440905 TATTAAAAAGAAAATGAGCCAGG + Intronic
942110494 2:172677870-172677892 GAATAAAAGGGAAATTAGGCCGG + Intergenic
942495944 2:176540185-176540207 CAGTAAAAGGCAGAAGAGGAGGG + Intergenic
942782451 2:179661183-179661205 TGGTAAAAGGAAAATGGGGAAGG + Intronic
942813425 2:180023418-180023440 CAGAAAAAGGAGCATGATGCTGG + Intergenic
943037125 2:182761195-182761217 CAGTAAAATTAGAATGAAGCTGG + Intronic
943351884 2:186805916-186805938 CACTCACAGGAAAATGAGACTGG + Intergenic
943608049 2:189999066-189999088 CAATAAAAGAAAAAATAGGCTGG - Intronic
944159644 2:196644816-196644838 GAGTAAAAAGAAAAATAGGCTGG + Intronic
944928169 2:204486672-204486694 CAGTAAATGGTAAATGATGGTGG + Intergenic
944932959 2:204539160-204539182 CAGGAAGAGGAAAATGATTCAGG - Intergenic
945113121 2:206383122-206383144 AAATAAAAAGAAAAGGAGGCCGG - Intergenic
946184634 2:217973194-217973216 AAGTAAAAAGAAAATTAGCCAGG + Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946243267 2:218369780-218369802 AAGAAAAAGGAAATTGAGGCTGG - Intergenic
946718453 2:222578541-222578563 ATGTAAAAGAAAAAGGAGGCCGG + Intronic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
947419471 2:229929228-229929250 TATTAAAAAGAAAAAGAGGCCGG - Intronic
947552885 2:231059617-231059639 CAGGAAAGGGAAAGTGAGGTGGG - Intronic
947992935 2:234501056-234501078 CTGTAAATGGAGAATGGGGCTGG + Intergenic
948568443 2:238901270-238901292 GAGCAAAAGGCAAAGGAGGCCGG - Intronic
948823508 2:240562380-240562402 TAGTAATAGAAAAAGGAGGCTGG - Exonic
948978237 2:241477422-241477444 CACAAAAAGGAACATGAGGCCGG - Intronic
1169108334 20:3016449-3016471 CATTAAAAAGTAATTGAGGCCGG + Intronic
1170295451 20:14819804-14819826 CATTGAAAGGACAATGTGGCTGG + Intronic
1171223023 20:23418639-23418661 CATTAAAAGATCAATGAGGCTGG + Intronic
1171954062 20:31446207-31446229 CAGTATAATGTAAATGAAGCAGG + Intronic
1172056624 20:32158684-32158706 CATTGAAAGTGAAATGAGGCTGG + Intronic
1173071651 20:39774069-39774091 CATGAGAAGGAAAATAAGGCAGG + Intergenic
1173102084 20:40096617-40096639 AAGTGAAAGCAAAAAGAGGCTGG - Intergenic
1173135617 20:40436393-40436415 AATAAAAAGAAAAATGAGGCCGG + Intergenic
1173213487 20:41056962-41056984 CATTAAAAAAAAAATGTGGCCGG + Intronic
1173416333 20:42859470-42859492 CAGTAAAAGGAAAAATAATCCGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174325361 20:49774480-49774502 AAGAAAAAAAAAAATGAGGCTGG + Intergenic
1175674455 20:60934730-60934752 CTGCAAACGGAAAATGAGGATGG - Intergenic
1178671232 21:34593516-34593538 CAGTAAATGCAAAAGGTGGCAGG - Intronic
1178875471 21:36410905-36410927 AAGCAAGAGGAAACTGAGGCGGG - Intronic
1179095172 21:38307896-38307918 CAGAAAAAGAGAGATGAGGCTGG - Intergenic
1179768476 21:43594249-43594271 CAGAAAAAGGAAAATGACGTTGG + Intronic
1180535944 22:16392763-16392785 CAGGGGAAGGAAAATGGGGCAGG + Intergenic
1180663796 22:17493266-17493288 TATTTAAAGGAAAAAGAGGCCGG - Intronic
1181007580 22:20021274-20021296 CAGAAAGGGGAAACTGAGGCAGG - Intronic
1181314652 22:21963567-21963589 CAGGAGAAGGCAAATGAGGAAGG - Intronic
1181328413 22:22069603-22069625 CAGTAAGGGGAAAATGCGGAGGG - Intergenic
1181379707 22:22491769-22491791 TAGTTTAAGAAAAATGAGGCTGG - Intronic
1181473274 22:23153665-23153687 AAGTGGAAGGAAAGTGAGGCTGG - Intronic
1182038627 22:27219011-27219033 CAGGAAATGGAAGCTGAGGCTGG - Intergenic
1182106755 22:27695205-27695227 CAGGAAGAGGAGAAAGAGGCGGG + Intergenic
1182133798 22:27881214-27881236 CAGTAAAGGCAAGATGAGACAGG + Intronic
1182227418 22:28809800-28809822 CAATTAATGGAAAAAGAGGCCGG + Intergenic
1182344201 22:29648889-29648911 CAGTTAAATGAAAATGAGCTGGG - Intronic
1182480064 22:30602516-30602538 AAATAAAAGAAAAAAGAGGCCGG - Intronic
1182505053 22:30776090-30776112 AAGAAAAAGAAAAATGAGTCTGG - Intronic
1182541276 22:31043909-31043931 CCGAAAAAAGAAAAAGAGGCTGG + Intergenic
1183223181 22:36530357-36530379 TACTAAAAGGAAAATTAGCCGGG - Intergenic
1183293074 22:37014724-37014746 CTGGAAAAGGAGACTGAGGCTGG + Intronic
1184697906 22:46150237-46150259 CAGCCAAGGGAAACTGAGGCCGG - Intergenic
1185304942 22:50109852-50109874 AAGAGAAAGGAAAAGGAGGCTGG + Intronic
1185428043 22:50784602-50784624 CTGTGAAAGGAAAATGAATCTGG - Intergenic
949183979 3:1168316-1168338 CAGTAAATGGTAAGTGAGACAGG + Intronic
949347769 3:3092782-3092804 CAGTAGAAGGAAAAAGAAGAAGG - Intronic
949479916 3:4483965-4483987 CAGAAAAAGCAAAATGGGCCTGG - Intergenic
950051272 3:9991674-9991696 CTGCAAAAGGATAATCAGGCTGG - Intronic
950232348 3:11287128-11287150 CATTGAAAGGAATATGAGCCAGG + Intronic
950269122 3:11599296-11599318 CAATAAAAGAAAAATGAGGGGGG + Intronic
950300082 3:11869252-11869274 CTGCAAAAGGATAATCAGGCTGG - Intergenic
950403923 3:12792763-12792785 AAGAAAAAAGAAAAAGAGGCTGG - Intergenic
950851162 3:16063581-16063603 TGGTAAAGGGAACATGAGGCTGG - Intergenic
951221231 3:20070598-20070620 CAGTATAAGAAAAGAGAGGCCGG - Intronic
951482674 3:23178442-23178464 CATTAAAAGGAAATTTAGTCAGG - Intergenic
951897862 3:27627539-27627561 TATTAAAAGAAAAAGGAGGCCGG + Intergenic
952130157 3:30352774-30352796 CAGAAAGAGGAAAATGAGACAGG + Intergenic
952470916 3:33650723-33650745 CGATAAAAGGAAAAAGAGGAGGG + Intronic
952672608 3:35988601-35988623 AATTAAAATGCAAATGAGGCTGG - Intergenic
953538314 3:43792762-43792784 CTGTAAAATGAAAGAGAGGCAGG + Intergenic
953858676 3:46523053-46523075 AATTAAAAGGAAAATGAAGTGGG - Intronic
954272673 3:49522008-49522030 AAGTAAAAAGAAAATTAGCCGGG - Intronic
954273509 3:49527408-49527430 CAGCTACAGGAGAATGAGGCAGG + Intronic
954403587 3:50332488-50332510 CATTTAAAGTAAAATCAGGCTGG + Intronic
954482614 3:50815117-50815139 CTATAAAAATAAAATGAGGCTGG - Intronic
954822246 3:53340220-53340242 CATTAAAGGGAAAATTCGGCTGG - Intronic
954933099 3:54301300-54301322 CAGAAAAAAAAAAAAGAGGCCGG + Intronic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955333975 3:58069960-58069982 AAGTATTAGGAAAATGAGGATGG + Intronic
955681603 3:61507252-61507274 AAGTAAAAGTAAAATGATACTGG - Intergenic
955824731 3:62934055-62934077 CAAAAAAATCAAAATGAGGCCGG + Intergenic
956058224 3:65323000-65323022 TAGAAAAAGAAAAAGGAGGCCGG - Intergenic
956720406 3:72112569-72112591 TTGTAGAAGGAAAATGAGACTGG + Intergenic
956783954 3:72626866-72626888 CTGCAAAAGGAAAAAGAGCCAGG + Intergenic
957199001 3:77107926-77107948 AAGAAGAAAGAAAATGAGGCAGG - Intronic
957744779 3:84325349-84325371 CAGAAATAGGAAAATGATACAGG + Intergenic
957857752 3:85899851-85899873 CTGTGTAAGGAAACTGAGGCTGG - Intronic
958415390 3:93867701-93867723 AAGGAAATGGAAAGTGAGGCAGG - Intergenic
958723862 3:97879285-97879307 CAGTGAGTGGAAAATGTGGCAGG - Intronic
958929479 3:100193669-100193691 CAAAAAAAGAAAAATTAGGCTGG - Intronic
959002676 3:100982677-100982699 AATTAAAAGGAAAATGATTCTGG - Intronic
959932087 3:111996172-111996194 CATAGAAAGAAAAATGAGGCTGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960330386 3:116352477-116352499 CAGTATAAAGTAAATGAGGTTGG - Intronic
960630413 3:119725153-119725175 CAGGTAAAGGAAAGGGAGGCTGG - Intronic
960911471 3:122653346-122653368 AAGGAAAAGGAAAAAAAGGCAGG + Intergenic
961565721 3:127762041-127762063 CTGTAAAATGAAAATGACGATGG + Intronic
961588028 3:127950733-127950755 CAAATAAAGAAAAATGAGGCCGG + Intronic
961711449 3:128831616-128831638 AAGTAAAAGCAAAGAGAGGCTGG + Intergenic
962508814 3:136077577-136077599 CAGTGAAAGGGAAATGAAGTGGG + Intronic
962952186 3:140229486-140229508 GAGAAAAAGGAAAAGGAGGGTGG - Intronic
963390008 3:144649303-144649325 AAGGAAAAGGTAAATGATGCTGG - Intergenic
964236002 3:154528592-154528614 AAGAAAAAGGAAAAGGAGGAAGG - Intergenic
965073498 3:163946662-163946684 TATTAAAAGGAAAAATAGGCTGG + Intergenic
965553313 3:169992809-169992831 GAGAAAAAGGAAGATGAGGAGGG + Exonic
965888099 3:173474129-173474151 AAGGAAAAGGAAAAGGAGGAGGG - Intronic
966351714 3:179038415-179038437 TAAAAAAAGAAAAATGAGGCAGG + Intronic
967290176 3:187911895-187911917 CAGTAAATTGAAATGGAGGCAGG + Intergenic
968075969 3:195816307-195816329 CTGTGTAAGGAAAAGGAGGCCGG - Intergenic
969226844 4:5804232-5804254 CTTTAAAAGTAAAGTGAGGCCGG - Intronic
970681376 4:18512349-18512371 GAGTAAAAGGAAAAAGAGGAGGG - Intergenic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
972520977 4:39856517-39856539 ATTTAAAAGGAAAATGCGGCTGG + Intronic
972586677 4:40443900-40443922 TATTAAAAGATAAATGAGGCTGG + Intronic
972610593 4:40652172-40652194 CACAAAAAGAAAAAAGAGGCCGG + Intergenic
972737855 4:41863345-41863367 CAGTAAAAACAAAATCAGGTGGG - Intergenic
973230473 4:47835235-47835257 GACCAAATGGAAAATGAGGCTGG - Intronic
973246049 4:48012510-48012532 CAGCAAAAGGAAAAAGAGGAAGG - Intronic
973553912 4:52062752-52062774 CAGCAAAAGTCAAATGAAGCAGG + Intronic
974348443 4:60713329-60713351 CAGTGAAAGGAAAAGGAAACAGG + Intergenic
974505349 4:62762786-62762808 CAGTAAAAAGAAAATGACTGTGG + Intergenic
974506669 4:62783058-62783080 CATTAAAAGGAAGATGAGGCAGG + Intergenic
974957560 4:68661163-68661185 ATGTAAAAGGAAAATAAGCCTGG + Intronic
975472738 4:74789237-74789259 AAGCAAAAGGAAAATAGGGCAGG - Intronic
975556366 4:75669794-75669816 CTACAAAAGGAAAAAGAGGCCGG + Intronic
975699302 4:77047258-77047280 CATTAAAAGAAACATAAGGCTGG + Exonic
976295675 4:83468878-83468900 CAGTAACAGGAGTATGAGGAAGG + Intronic
976721740 4:88175762-88175784 CAGGAAATGAAAAATGAGCCTGG - Intronic
976777779 4:88724782-88724804 CAGTAAAAGGAAATTAATGAAGG + Intergenic
976984095 4:91271147-91271169 CAGTAGAAGGAAAATTATGTGGG + Intronic
977451329 4:97201727-97201749 TAATAAAAGAAAAATGGGGCTGG - Intronic
977529341 4:98181894-98181916 CAGCAAAAGGAAAATGTGCATGG + Intergenic
977795317 4:101157573-101157595 TAGTACAAGGAAAATGAGACTGG + Intronic
977817751 4:101434870-101434892 CAGTGTAAGAAAATTGAGGCTGG - Intronic
978310268 4:107379607-107379629 GAGAAAAAGAAAAATGAGGTGGG - Intergenic
978311403 4:107388126-107388148 GAGAAAAAGGAAAATGGGGTTGG - Intergenic
979137050 4:117123298-117123320 CAGTAAAAAAAAAATAGGGCCGG - Intergenic
979477139 4:121171637-121171659 CAGGAAAATGAAAATGATTCAGG + Intronic
980318684 4:131239581-131239603 CAGTAAAAAAAAAATGAAACTGG - Intergenic
980722151 4:136712301-136712323 CAGGATAAGGGGAATGAGGCAGG - Intergenic
980909243 4:138978800-138978822 GAGGACTAGGAAAATGAGGCTGG + Intergenic
981866486 4:149426360-149426382 CAGTGAAAGTAAAATGACACTGG - Intergenic
981878030 4:149572445-149572467 AACTAAAAGAAAAATGAGCCAGG - Intergenic
981955946 4:150474364-150474386 GAGTACAATGAAAATGAGGAAGG + Intronic
982216735 4:153088756-153088778 CAGTAAAAACAAAATGGAGCTGG - Intergenic
982358866 4:154497251-154497273 CAGAAAAGGGGAAATTAGGCAGG - Intergenic
982615134 4:157632350-157632372 TAGAAAAAGGAAATTTAGGCCGG + Intergenic
982765148 4:159337956-159337978 AAGAAACAGCAAAATGAGGCTGG + Intronic
983307743 4:166014690-166014712 CAGTAATCATAAAATGAGGCAGG + Intronic
984466042 4:180101208-180101230 CTGGAAAAGGAAAACGAGCCAGG - Intergenic
984694074 4:182761658-182761680 AAGGAAAAGGAAAATAAAGCAGG - Intronic
984857272 4:184205887-184205909 AAGTAAAAGGAAACTGAGAGAGG + Intronic
984949400 4:184995572-184995594 TATTAAAAGGAAAAAAAGGCCGG - Intergenic
985135977 4:186786543-186786565 AAGAAAAATGAAAATGATGCTGG + Intergenic
985267762 4:188165864-188165886 CAGAAAAAGAAAATTTAGGCCGG - Intergenic
986135316 5:4971784-4971806 CAGTCAAATGTAAATCAGGCTGG + Intergenic
986698410 5:10379202-10379224 AAATAAAAGGATAAAGAGGCAGG - Intronic
987830931 5:23093849-23093871 TAGTAAAAGGAAGATGGAGCAGG + Intergenic
988116763 5:26903556-26903578 CAGTAAAGGGAAAAAAAGCCTGG - Intronic
988182209 5:27811267-27811289 CAGTAAAAGTAAATAGAGCCAGG + Intergenic
988797148 5:34661944-34661966 AAGTAAAAGAAAAACTAGGCAGG - Intronic
989209962 5:38848408-38848430 CAGTACAACTAAAATGAGGAGGG - Intronic
989253454 5:39342006-39342028 CAGAAAAATGATTATGAGGCAGG - Intronic
989620870 5:43383111-43383133 TAGAAAAATGAAAATGAGCCAGG - Intronic
989647206 5:43648341-43648363 CAGTAAAAAGAAAATGACAGTGG - Intronic
989984685 5:50684801-50684823 CAGGGAAAGGGACATGAGGCAGG - Intronic
990059967 5:51635717-51635739 CAGCAAAAGGAAAAAAAGGCAGG + Intergenic
990198616 5:53346429-53346451 CAGGAAAAGAGAAATGAGGCTGG + Intergenic
991368670 5:65895542-65895564 GAGTTAAAAGTAAATGAGGCCGG + Intergenic
991487527 5:67152978-67153000 CTCTAAAAGGAAAATGAAACAGG - Intronic
991669965 5:69037800-69037822 GAGAAAAAGGAAAATGAGGCTGG + Intergenic
991679269 5:69122355-69122377 TTTTAAAAAGAAAATGAGGCTGG + Intronic
991909052 5:71543294-71543316 AAGAAAAAAGAAAATCAGGCTGG + Intronic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992210051 5:74469882-74469904 CACTACAAAGATAATGAGGCAGG - Intergenic
993205127 5:84868996-84869018 CTCTAAAAGTAAAATGTGGCTGG + Intergenic
993598103 5:89884813-89884835 CAGTACAAGGAAAATGCTCCTGG - Intergenic
993731166 5:91424472-91424494 TACTAAAACAAAAATGAGGCCGG - Intergenic
994671109 5:102762827-102762849 CAGTAATAGCTAAGTGAGGCAGG - Intronic
994723448 5:103407199-103407221 TACTAATAGGAAAATAAGGCAGG - Intergenic
994951073 5:106463773-106463795 CAGTAAGAGAAAAATATGGCTGG - Intergenic
995237663 5:109848660-109848682 CAGTAAAAGGATGCTGAGGTGGG - Intronic
995252793 5:110013724-110013746 CAGTAAATGGCAAATGAGGAAGG - Intergenic
995269096 5:110200706-110200728 CAGGCAAGGGGAAATGAGGCTGG + Intergenic
995304337 5:110626870-110626892 CAGGAAAAGGGAAATAAGGGAGG - Intronic
995611004 5:113910269-113910291 AATTAAAAGGAGATTGAGGCTGG - Intergenic
995756807 5:115514135-115514157 CAGTAACAACAAAATGAGGATGG + Intergenic
996740822 5:126797087-126797109 CATTAAAAAGAAAATTAGCCAGG - Intronic
997639266 5:135437895-135437917 CAGAAAGAAGAAACTGAGGCTGG + Intergenic
998142637 5:139708989-139709011 CAGAAAAAGGAAGCTGAGGCTGG - Intergenic
998598285 5:143557319-143557341 CAGGAAGAGGAAAATGAAGAAGG + Intergenic
999041495 5:148418272-148418294 CAAGCAAAGGAAAATGAGGTAGG - Intronic
999580172 5:153029863-153029885 CAGTAATAGGAAACTGATGTAGG - Intergenic
999592046 5:153158838-153158860 CAGGAAAAGGAAAAGCAGGCGGG - Intergenic
999874013 5:155782319-155782341 AAGAAAAATAAAAATGAGGCCGG - Intergenic
1000630422 5:163584622-163584644 GAGTAAAAGGAAAATTAAGAAGG - Intergenic
1000765530 5:165284753-165284775 AATGAAAAGAAAAATGAGGCTGG + Intergenic
1000835904 5:166153854-166153876 TAGAAAAAGGAAAATGAGGCTGG - Intergenic
1000899069 5:166891220-166891242 AATAAAAAGGAAAACGAGGCCGG + Intergenic
1002255779 5:177957734-177957756 CAGTAAATGGAAAAGGAGCCAGG + Intergenic
1002663347 5:180805453-180805475 CAGTAAAAGTAAAAGCAGGCTGG + Intronic
1003154544 6:3579672-3579694 CAAGAGAAGGAACATGAGGCCGG - Intergenic
1003547112 6:7068651-7068673 CAAGAAAAAGAAAAAGAGGCTGG - Intergenic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004270352 6:14189707-14189729 AAGTAACAGGAAAGAGAGGCAGG + Intergenic
1004843581 6:19614183-19614205 CAGTAAAATGAAATTGAAGATGG + Intergenic
1005492461 6:26359408-26359430 CAATAAAAGAAGAAAGAGGCTGG - Intergenic
1005786399 6:29249641-29249663 AAGTAAAGGCAAAAAGAGGCTGG + Intergenic
1006179149 6:32143559-32143581 AAGAAAAAAGAAAAAGAGGCTGG + Intergenic
1007179506 6:39919067-39919089 TAGATAAAGGAAAATGAAGCAGG + Intronic
1007648327 6:43399807-43399829 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007901329 6:45415912-45415934 CACTAATAGGAATATGAGTCAGG + Intronic
1008402522 6:51080010-51080032 CATTAACAGGAAAATAATGCAGG + Intergenic
1008940091 6:57037616-57037638 CAAGAAAAGGAAAAACAGGCTGG - Intergenic
1009295766 6:61944792-61944814 CAGTAAAAAACATATGAGGCTGG + Intronic
1009374719 6:62953126-62953148 AGGCAAAAGGAAAATGAGGGAGG + Intergenic
1009449780 6:63787652-63787674 CAATAAATAGTAAATGAGGCTGG + Intronic
1009450826 6:63798663-63798685 CAGAAAAAGAAAATTGAAGCAGG - Intronic
1009751912 6:67886207-67886229 AAGTAAAAGTGAAAAGAGGCTGG + Intergenic
1010041671 6:71391907-71391929 GAGGAAGAGGAAAATGAGGCTGG - Intergenic
1010295037 6:74185640-74185662 AAGTAGAAGGAAAAGGAGGCAGG + Intergenic
1011060844 6:83265455-83265477 CATTAAAAGAAAAATTAGCCAGG - Intronic
1011293982 6:85807590-85807612 ATGTAAAAGGAACATGGGGCCGG - Intergenic
1012048786 6:94312622-94312644 TAGTAAAAGAAAAATGAGGCCGG + Intergenic
1012390129 6:98728948-98728970 AAGTAAAAGAAATATGAGGTAGG - Intergenic
1012627295 6:101419757-101419779 AAGTGAAAGGAACATAAGGCAGG - Intronic
1013005940 6:106073409-106073431 AATCAAAAGGAAATTGAGGCCGG - Intergenic
1013668823 6:112376151-112376173 GAGGAGAAGGAAAATGAGGGAGG + Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1014072015 6:117193232-117193254 GAGAAAAAGCAAAATGAGGTGGG - Intergenic
1014465401 6:121750370-121750392 AAGGAAGAGGAAAATGGGGCAGG + Intergenic
1014904706 6:127012023-127012045 AAGAAAAAGGGAAATGAGGCAGG - Intergenic
1014911245 6:127096155-127096177 GAGAAATAGGAAACTGAGGCAGG + Intergenic
1015844983 6:137510937-137510959 CAATAAAACAAAAATGAGGCTGG - Intergenic
1015845208 6:137513237-137513259 CAGTTCAAGGAAAAAGAGGGGGG + Intergenic
1015969194 6:138727497-138727519 TGGAAAAAGAAAAATGAGGCAGG + Intergenic
1016022959 6:139255116-139255138 TCATAAAAAGAAAATGAGGCCGG - Intronic
1016050436 6:139524772-139524794 CAACACAAGGAAAATGAGGAAGG - Intergenic
1016359527 6:143252476-143252498 GAATAAATGGAAAATGAGGATGG + Intronic
1016497855 6:144684344-144684366 GAATAAAAGGTAAATGGGGCTGG - Intronic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1018255746 6:161917096-161917118 AAGAAAAAGAAAAATTAGGCTGG - Intronic
1019328057 7:448841-448863 CAGTAAAAGTAAAAAGAAACAGG - Intergenic
1020140534 7:5609142-5609164 AAAAAAAAGGAAAAAGAGGCCGG + Intergenic
1020493042 7:8812814-8812836 AAGTAAAAGGAAGATGAGAGAGG + Intergenic
1020906690 7:14072031-14072053 CATTGAAAGAATAATGAGGCCGG - Intergenic
1020976381 7:15012349-15012371 CAGAAATAGGAACATGATGCGGG + Intergenic
1021852967 7:24826537-24826559 GAGTAAGGGGAAAAGGAGGCAGG + Intronic
1022730998 7:33025886-33025908 CATTAAAAATAAAATAAGGCTGG + Intronic
1022879791 7:34574574-34574596 TAATTAAAGGAGAATGAGGCAGG - Intergenic
1023163275 7:37318827-37318849 CAGGAAAAGGAAAGTAAGACCGG - Intronic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1023808663 7:43893572-43893594 AAGTAAAAGGACAAAAAGGCTGG + Intronic
1024593865 7:50915946-50915968 CAGGAAAAGGGAACTGGGGCTGG - Intergenic
1026211906 7:68313312-68313334 CATAAAATGGAAACTGAGGCAGG - Intergenic
1026763134 7:73141589-73141611 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027039599 7:74951371-74951393 CAGAAAAAGGAAATTGGGCCAGG + Intergenic
1027084043 7:75251013-75251035 CAGAAAAAGGAAATTGGGCCAGG - Intergenic
1027512549 7:79101426-79101448 TAGAAAAAGGAAAATGGGGCCGG + Intronic
1027550936 7:79594287-79594309 CAGTAACAGGCAAAAGATGCTGG - Intergenic
1027651738 7:80876847-80876869 CAGTAAATTGAAAATGCTGCTGG + Intronic
1028008045 7:85603459-85603481 GAGTAAAAGGAAAAAAATGCAGG - Intergenic
1028088800 7:86671851-86671873 CAGTAAATGGATAAGGAGACTGG - Intronic
1029306475 7:99623583-99623605 CAGGAAAAGGGAAATGATGCTGG - Intronic
1029391616 7:100278779-100278801 CAGAAAAAGGAAATTGGGCCGGG - Intergenic
1029656014 7:101925035-101925057 TGATGAAAGGAAAATGAGGCTGG - Intronic
1030660758 7:112216714-112216736 CAGTAAAAGAAAGAGGAGGTAGG + Intronic
1030829229 7:114200388-114200410 CAGTAAAGTGAATATGATGCAGG - Intronic
1031744197 7:125472743-125472765 GAGGAAAGGGAAAATGAGGTGGG + Intergenic
1031941836 7:127797600-127797622 CAGGGAAAGGAAGATGGGGCAGG + Intronic
1032635215 7:133699470-133699492 CTGTAAAGGCAAAATGAGGGAGG + Intronic
1034063415 7:148113865-148113887 CAGTAACAGAATAATGAGGCAGG - Intronic
1035116141 7:156525855-156525877 CAGAAAAAGAATTATGAGGCTGG + Intergenic
1035209148 7:157314916-157314938 CAAGAAAAAGAAAATCAGGCCGG - Intergenic
1035761091 8:2069399-2069421 CAGAAAAGAGAAAAGGAGGCGGG - Intronic
1037189886 8:16111499-16111521 CAGGAAAAGGAAACTGAGAGTGG + Intronic
1037440356 8:18909947-18909969 CAGCGAAAGGAAAAAGTGGCAGG + Intronic
1038367541 8:26951692-26951714 CAGTAAGAAGAAAATGAGGCTGG - Intergenic
1038786942 8:30626188-30626210 CAATAAAAGTAAAATGTAGCTGG + Intronic
1038792273 8:30678686-30678708 AAGAAAAAAGAAAATAAGGCAGG + Exonic
1038799176 8:30733693-30733715 CTTTAAAAGAAAAATAAGGCTGG - Intronic
1039052147 8:33504924-33504946 CTGTAAAAAGAAAAAGAGGCTGG + Intronic
1039591611 8:38754719-38754741 TAGTAAAAGTATACTGAGGCTGG - Intronic
1039863964 8:41484673-41484695 AAGTAAAAAGAAAAACAGGCTGG - Intergenic
1039865289 8:41495577-41495599 CAGAAAAAAAAAAATCAGGCTGG - Intronic
1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG + Intronic
1041311173 8:56518108-56518130 CAGAAAAAGAAAATGGAGGCCGG - Intergenic
1041967608 8:63698209-63698231 CTGTAAAATGGAGATGAGGCTGG + Intergenic
1042249085 8:66738078-66738100 CAGTAAAAGGAAAATGAAATTGG - Intronic
1042398779 8:68321558-68321580 CAGTAAAAGAAGAATGAGTGTGG + Intronic
1042672896 8:71283786-71283808 CAGCAAAAGAAACTTGAGGCTGG + Intronic
1042929081 8:73995919-73995941 CTGTGAAAGAAAAATAAGGCTGG + Intronic
1043325604 8:79047235-79047257 GAGTAAAAAGAAAATGAGATGGG - Intergenic
1043811537 8:84748479-84748501 CAGAATTAGGAAAATGGGGCAGG - Intronic
1044553799 8:93540395-93540417 CAGTAAAAGAAAAAGAAGACAGG + Intergenic
1044877761 8:96688386-96688408 CATTAAAAGAAAAATGAGGTGGG - Intronic
1045097757 8:98816164-98816186 CAGGAAAAGGAAAAGGATGGAGG + Intronic
1045527577 8:102954395-102954417 AATTAAAACCAAAATGAGGCCGG - Intronic
1046168256 8:110469128-110469150 GATTAAAAGGAAAATGAGACAGG - Intergenic
1046945308 8:119968860-119968882 GAGAAAAAGTAAGATGAGGCTGG + Intronic
1046952663 8:120032991-120033013 CAGTAAAAGAGAAGTGAGGATGG + Intronic
1047372491 8:124267520-124267542 TAGAAAAAGGAAAATGAAGGTGG - Intergenic
1047455617 8:125007455-125007477 CAGTACAAGGATAAAGAGACTGG + Exonic
1047561815 8:125994187-125994209 GAGTAAAAAGAAAAAGAGGAGGG + Intergenic
1047964277 8:130034171-130034193 CATGAAAAGGAAAAACAGGCCGG + Intergenic
1049116858 8:140696263-140696285 CATTAGAAGAAAAATGAAGCAGG + Intronic
1050083785 9:1942671-1942693 GATTGAAAGAAAAATGAGGCTGG + Intergenic
1050102305 9:2131682-2131704 TAGAAAAAACAAAATGAGGCCGG + Intronic
1050636923 9:7622197-7622219 GTATAAAGGGAAAATGAGGCTGG - Intergenic
1050702242 9:8353591-8353613 AAATATAAGGAAAATGAGCCGGG - Intronic
1051133093 9:13884510-13884532 GAGAAAAAGAAAAATGAAGCAGG - Intergenic
1051171030 9:14317505-14317527 CAGAAAAAGGAAAATGAGATAGG + Intronic
1052036826 9:23692144-23692166 CAGAAAAAGGAAAAAAAGGGGGG + Exonic
1052311202 9:27071408-27071430 AAAGAAAAGTAAAATGAGGCTGG + Intergenic
1052515964 9:29480156-29480178 AAGGAAAAGGAAAATAAGGAGGG - Intergenic
1052540493 9:29805025-29805047 TAGTAATAGGAACAGGAGGCAGG - Intergenic
1052838820 9:33273454-33273476 CAGGAAAAGGATAATTAGGCAGG - Intronic
1053247939 9:36550519-36550541 CAGAAAAATGAAAATTAGCCAGG + Intergenic
1055444673 9:76370787-76370809 CAAGAAAAGGAAAATTAGGTGGG - Intergenic
1055916387 9:81405237-81405259 CAGAAAAAAGAAAATTTGGCTGG - Intergenic
1056143667 9:83708123-83708145 GACTAAAAGCAAAATGGGGCGGG + Exonic
1056447819 9:86683360-86683382 TAGTAAATAGAAAATGAGGCCGG + Intergenic
1056697695 9:88873921-88873943 CAGGACAAGGAGAATGAAGCAGG - Intergenic
1056739976 9:89246082-89246104 CATAAGAAGGCAAATGAGGCTGG + Intergenic
1056842205 9:90007423-90007445 AAGCAGAAGGAAAATCAGGCAGG - Intergenic
1057012308 9:91615588-91615610 CAGAAAAAAGAAGATGAAGCTGG + Intronic
1057096690 9:92317112-92317134 TAATAAAAGAAAAATCAGGCTGG - Intronic
1058465594 9:105223899-105223921 CAGCAAGAGAAAAATGAGCCAGG - Intergenic
1058609230 9:106756888-106756910 CATTAAAAGATAAATGGGGCTGG - Intergenic
1058850502 9:109007376-109007398 GAGTAATGGGAAAATGAGGTAGG + Intronic
1059412626 9:114142477-114142499 CAATGAAGGGAAAATGAGTCTGG - Intergenic
1060180840 9:121532638-121532660 AAGTAAAAGAAAAAAGAGGCCGG - Intergenic
1060311151 9:122463960-122463982 CAGTATAGGGAAGATTAGGCAGG + Intergenic
1060495218 9:124113411-124113433 GGATAAAAGGAACATGAGGCAGG + Intergenic
1060621539 9:125071719-125071741 CAGTGAAAGGGAAAAAAGGCAGG + Intronic
1060724214 9:125996609-125996631 CAAAAAAAGTAAAAAGAGGCTGG - Intergenic
1062036956 9:134386658-134386680 CAGCAACAGCAAACTGAGGCTGG + Intronic
1062338871 9:136084703-136084725 CAGTCAAAGGAAATGGCGGCGGG + Intronic
1062377897 9:136272178-136272200 CAGCAGAAGGAAAAGGATGCGGG + Intergenic
1185476134 X:416674-416696 CAGAAAATACAAAATGAGGCTGG - Intergenic
1185476195 X:417004-417026 CAGAAAATACAAAATGAGGCTGG - Intergenic
1185596672 X:1311261-1311283 AGGTAAAAAGAAAAAGAGGCTGG + Intergenic
1185611093 X:1394136-1394158 AAGAAAAAAGAAAAGGAGGCGGG - Intergenic
1185611105 X:1394206-1394228 AAGAAAAAGGAAAAGGAGGGAGG - Intergenic
1185834947 X:3336806-3336828 AATCAAAAGGAAAATAAGGCAGG + Intronic
1185954192 X:4471207-4471229 AAGCAAAAAGAAAATGAGCCAGG + Intergenic
1186621064 X:11240746-11240768 TAATTAAAGCAAAATGAGGCCGG + Intronic
1186772521 X:12831742-12831764 CATCAAAAGGATAATGTGGCTGG - Intergenic
1187063622 X:15811720-15811742 CAACAAAAGGAGAATTAGGCCGG - Intronic
1187072746 X:15904352-15904374 AAATAAAATGAAAATTAGGCAGG - Intergenic
1187501591 X:19843499-19843521 CACCAAAAGGAAAACGTGGCTGG - Intronic
1187649060 X:21380047-21380069 CAGTAGAGGGAAAGTGAGGGAGG + Intronic
1187666208 X:21612976-21612998 CAGTCAAAGGAAAACAAGACAGG - Intronic
1187888721 X:23913595-23913617 CAGTAAAAGCAGAATACGGCTGG + Intronic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188514621 X:30972003-30972025 CAGTACGAGGAAAATGATCCTGG + Intronic
1188559173 X:31448273-31448295 GATAAAAAGGAAAAGGAGGCAGG + Intronic
1188955095 X:36424831-36424853 CATAAGAAGGAAAATGAGGTTGG + Intergenic
1189239562 X:39515205-39515227 CAATGAATGAAAAATGAGGCTGG + Intergenic
1189345086 X:40234740-40234762 AAAAAAAAGAAAAATGAGGCAGG - Intergenic
1189351437 X:40278716-40278738 CACAAGAAGGAAAATGGGGCTGG + Intergenic
1189629999 X:42942808-42942830 AAGTGAAAGGAAAATGAAGTTGG - Intergenic
1190120321 X:47653823-47653845 CATTAAAAGGAACCTGAGGTTGG + Intronic
1190172628 X:48123698-48123720 AAGGAAAAAGAAAATCAGGCAGG - Intergenic
1190632652 X:52402754-52402776 CAGTAAAAGGGATATCAGGCTGG + Intergenic
1190884927 X:54522979-54523001 GATTAAAAAGAAAATAAGGCTGG - Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1194388809 X:93290838-93290860 CAGTAAAAGTAAATTAAGTCAGG + Intergenic
1194681609 X:96860955-96860977 GGGTAAAAGGAAAATGAGAATGG + Intronic
1194700985 X:97113074-97113096 CACTAAAAGGAAAAAGTGGCCGG - Intronic
1194810624 X:98383077-98383099 TAGTTAAAGAAAAATGAAGCTGG - Intergenic
1195059742 X:101182533-101182555 GAATAAAAGGAAACTGGGGCCGG - Intergenic
1195756093 X:108200002-108200024 CAGTACAAGGAAGATAAGCCTGG + Intronic
1196703380 X:118695882-118695904 AAGGAAAATGAAAATGAAGCCGG + Intergenic
1196829789 X:119766979-119767001 CTGTAAAATCAAAATCAGGCTGG - Intergenic
1197961827 X:132015410-132015432 CACTCAAAAGAAAATGAGGTGGG - Intergenic
1198021150 X:132659273-132659295 CGAAAAAAGAAAAATGAGGCTGG - Intronic
1198444826 X:136702001-136702023 AAGAATAAGAAAAATGAGGCCGG - Intronic
1198460861 X:136861758-136861780 AAGTAAAAACAAAATGAGGAGGG + Intronic
1198504741 X:137290336-137290358 CTGTAAAAGGAAATGGAGGAGGG + Intergenic
1198538409 X:137610075-137610097 CAATAAAAAGAAAATTAGCCAGG - Intergenic
1199745891 X:150771768-150771790 AAGCAAAAGGAAAGTGAGGAAGG + Intronic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1202451755 Y:25016114-25016136 CAATAAAAGGAAAAAAATGCAGG + Intergenic