ID: 1082044825

View in Genome Browser
Species Human (GRCh38)
Location 11:47716318-47716340
Sequence TTGATCACACAGCACCATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 180}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082044820_1082044825 16 Left 1082044820 11:47716279-47716301 CCAATCTAGATATTATAGATAAT No data
Right 1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG 0: 1
1: 0
2: 0
3: 12
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082044825 Original CRISPR TTGATCACACAGCACCATCT GGG Intergenic
900361161 1:2289737-2289759 TTGGCCCCACAGCAGCATCTGGG + Intronic
900850556 1:5139316-5139338 TTGATGGCTCAGCACCAGCTGGG + Intergenic
900852770 1:5157102-5157124 TTCATCACAGAGCCCCACCTGGG - Intergenic
901644113 1:10707483-10707505 CTGATCACACAGAACAATCAGGG + Intronic
907637881 1:56154983-56155005 TTCAACAGACAGCATCATCTGGG - Intergenic
912264159 1:108138508-108138530 TTGATTACACTGTACCATCCTGG - Intronic
912572496 1:110634791-110634813 TTCATCACTTAGCACCAGCTGGG + Intergenic
913094920 1:115507360-115507382 CTAATTACACAGCACCATCTAGG + Intergenic
913190606 1:116409835-116409857 TTGATCACCCAGCAGCTCCTGGG - Intronic
917298882 1:173551595-173551617 CTGATCACATATCACCATCATGG - Intronic
918633871 1:186751474-186751496 TGGATCACAGAGAACCATCAAGG - Intergenic
920490855 1:206413843-206413865 TGGTACACACAGGACCATCTGGG + Intronic
922289661 1:224199763-224199785 TTGAACAGACAGCACCGTCTGGG + Intergenic
923937717 1:238781864-238781886 TTGCTCCCACACCACCATTTTGG + Intergenic
924429748 1:243986859-243986881 TTGATCACAGAGAACTATTTAGG + Intergenic
1063193915 10:3722331-3722353 TCGATGACACAGGACCCTCTAGG - Intergenic
1067804314 10:49382562-49382584 TTAAGCACACAGCCCAATCTAGG - Intronic
1069400140 10:68035639-68035661 TAGATCATACAGCACCTTATAGG - Intronic
1070377767 10:75850531-75850553 TTGCTCATATAACACCATCTGGG + Intronic
1071467716 10:85956545-85956567 TTGACCACAAGGGACCATCTTGG + Intronic
1073693315 10:105835707-105835729 TTGAGCACCCAGCAAGATCTGGG - Intergenic
1074838490 10:117324175-117324197 TTGCTCACGCTGGACCATCTTGG - Intronic
1078778745 11:14417438-14417460 CTCATCACACGGCAGCATCTTGG - Intergenic
1080229168 11:29998883-29998905 TTAATCACACAGAACATTCTAGG + Intergenic
1080880502 11:36315797-36315819 ATTATCACACAGCACAATATTGG - Intronic
1081059932 11:38461829-38461851 TTGACCCCACAGCAGCAACTAGG + Intergenic
1082044825 11:47716318-47716340 TTGATCACACAGCACCATCTGGG + Intergenic
1084640555 11:70423512-70423534 CTGACCACACAGCACCATCCAGG + Intronic
1084969327 11:72761692-72761714 TGGAGCACACAGCATGATCTCGG - Intronic
1086452920 11:86934749-86934771 TTGATTACCCACCACTATCTTGG - Intronic
1087474998 11:98623530-98623552 CTGACCCCACAGCAGCATCTAGG + Intergenic
1088162589 11:106890674-106890696 TTGATTACACACAACCACCTCGG + Intronic
1088991411 11:114956750-114956772 TTGCTGACACAGCACCATTTTGG - Intergenic
1089379470 11:118017278-118017300 TGGATCCCACAACTCCATCTGGG - Intergenic
1089637398 11:119824159-119824181 ATGCTCACACTGCAGCATCTAGG + Intergenic
1090510568 11:127370288-127370310 TTAATCACACAGTAGCATCTTGG - Intergenic
1091836577 12:3590392-3590414 GTGTTCACACAGCGCCAACTGGG - Intronic
1091846674 12:3661313-3661335 TTGATCACAGAGCACAGCCTTGG + Intronic
1092037191 12:5346746-5346768 TTCATAGCACAGCACCACCTAGG - Intergenic
1092091109 12:5804320-5804342 ATGACCACACAGCACTAGCTGGG + Intronic
1098173146 12:67766723-67766745 TTGATAAATCAGCTCCATCTAGG + Intergenic
1099480939 12:83165594-83165616 CTGATCACACATCACCATAATGG + Intergenic
1102629919 12:114269149-114269171 TTGCTCACACAGCACTGTGTCGG - Intergenic
1108261157 13:48658195-48658217 TTTAGAACAGAGCACCATCTGGG + Intronic
1108457013 13:50626445-50626467 GGGATCACTCAGTACCATCTTGG + Intronic
1110287982 13:73772378-73772400 TTTATCACATGGCACCATCATGG - Intronic
1111257688 13:85694062-85694084 TTGATAGCACTGTACCATCTTGG + Intergenic
1115637321 14:35302959-35302981 TTGCTAATACAGCAACATCTGGG + Intronic
1117513652 14:56478469-56478491 TTTATCACACAGCAGCTACTTGG - Intergenic
1120855169 14:89205792-89205814 CTGACCTCACAGCAGCATCTAGG - Intronic
1122518612 14:102326724-102326746 TTTCTCAGACAGCACCATCTCGG - Exonic
1123159066 14:106260030-106260052 TTTCCCACACAGAACCATCTCGG - Intergenic
1123207811 14:106730406-106730428 TTTCCCACACAGAACCATCTCGG - Intergenic
1123212835 14:106777412-106777434 TTCCCCACACAGAACCATCTCGG - Intergenic
1124698343 15:31887405-31887427 CTGATCCCACAGCAGCCTCTGGG + Intergenic
1127814157 15:62591909-62591931 TGGACCACTCAGCACCCTCTGGG - Intronic
1130927310 15:88395425-88395447 TTGACCCCATAGCAGCATCTAGG + Intergenic
1131296356 15:91153016-91153038 ATGAGAACCCAGCACCATCTTGG - Intronic
1138051401 16:53782507-53782529 TAGATCAGACATGACCATCTTGG + Intronic
1140486650 16:75298950-75298972 TTGATCAGACAGCAGCAGCTGGG + Intronic
1140867262 16:79074168-79074190 TTCAACACACAGCTCCAACTTGG - Intronic
1140961485 16:79917276-79917298 TTGATCACACAATACCGTCTTGG - Intergenic
1147408454 17:40231008-40231030 TAAATCAAACAGGACCATCTGGG - Intronic
1149820254 17:59769571-59769593 CTGATAACACAGCATCTTCTTGG - Intronic
1158504859 18:58038195-58038217 TTGGCCACACAGCAGCATCAGGG - Intergenic
1159954737 18:74511212-74511234 TTAATCTCACAGCAGCATCAAGG + Intronic
1161948579 19:7454378-7454400 TGGATCAGTGAGCACCATCTTGG + Intronic
1166640805 19:44493631-44493653 TTGGTCACACAGACCCACCTTGG - Intronic
1167160770 19:47765947-47765969 TTGATCACGCAGGACCATGGTGG - Intergenic
1168466761 19:56608621-56608643 TTGATCACACAGAATCACCCTGG + Intronic
925161642 2:1688340-1688362 TCGCTCACTCCGCACCATCTGGG + Intronic
925800718 2:7597815-7597837 TTGATTACCCAGCATCTTCTGGG + Intergenic
926222836 2:10947583-10947605 TTGTTCTCACAACACCCTCTAGG + Intergenic
926812388 2:16767054-16767076 TTGATGAAACACCACCATATTGG + Intergenic
928446075 2:31334464-31334486 TTGTCCACCCAGCACCATGTAGG + Exonic
928684748 2:33737062-33737084 TTGATGAAACATCACCATTTTGG - Intergenic
928716270 2:34064254-34064276 TTGATCACAGAGCACCATAAAGG + Intergenic
928936624 2:36685788-36685810 TTGGTCACAGAGCACCCTGTTGG - Intergenic
929887436 2:45891541-45891563 TTGATCACACAGTCCTACCTGGG - Intronic
930919399 2:56733879-56733901 CTGATCACAAATCACCATCGTGG - Intergenic
931519743 2:63082609-63082631 TTCATCACAAAACACAATCTGGG - Intergenic
936882419 2:117269962-117269984 TTGAACACAAATCCCCATCTTGG + Intergenic
937042301 2:118832227-118832249 TTGAACACACAGCACTAAGTTGG - Intergenic
939969875 2:148645983-148646005 TTGATAATACAGCACCTTTTGGG + Intronic
943778006 2:191788479-191788501 GTGATAACACAGCTCCAACTTGG - Intergenic
1170275362 20:14580587-14580609 TTGTTTACACAGCACAATCCTGG - Intronic
1170471934 20:16676320-16676342 TTGATAACAAGGCCCCATCTTGG + Intergenic
1170530817 20:17289092-17289114 TTGCTTATTCAGCACCATCTGGG - Intronic
1173421657 20:42906623-42906645 CTGGTCTCACAGCAGCATCTAGG - Intronic
1174046807 20:47739531-47739553 TTGATCAGACACCACCTTCTTGG + Intronic
1177361076 21:20072169-20072191 TTGAACACACAGTAACATATAGG - Intergenic
1178137727 21:29646718-29646740 TTGATCACACAGGGTCATATAGG + Intronic
1178823962 21:35999771-35999793 TTGTTAAAACTGCACCATCTAGG + Intronic
1180020577 21:45122983-45123005 TTGATCATACAGCAGCTACTTGG + Intronic
1182371279 22:29812790-29812812 GTGATCTCACAGCTCCATGTTGG + Intronic
1183762092 22:39830833-39830855 ATGAACATACAGAACCATCTTGG - Intronic
1184715524 22:46279781-46279803 GTGACCAGACAGCACCATCCAGG + Intronic
949867409 3:8557786-8557808 TTGCTCACAAATCACCATTTTGG + Intronic
951144478 3:19210813-19210835 TTCCTCTGACAGCACCATCTGGG + Intronic
952002943 3:28808344-28808366 CTGACCCCACAGCAGCATCTAGG + Intergenic
953430305 3:42834275-42834297 TTGATCACAGATCACCATAGCGG - Intronic
953629656 3:44602535-44602557 TTCATCACACAGCTACACCTGGG - Intronic
957591209 3:82200921-82200943 ATGCTCACACAGTACCTTCTGGG - Intergenic
960657352 3:120020513-120020535 TTGATCACAGATCACCATAATGG - Intronic
961493201 3:127270796-127270818 CTGCTCACACAGCACCAGCCAGG - Intergenic
963285069 3:143426668-143426690 TTGATCACCCAGTGCCATGTTGG + Intronic
965324499 3:167286298-167286320 TGTATCACACAGCAACACCTTGG - Intronic
968005522 3:195240150-195240172 TATATCACACAGCACTTTCTCGG - Intronic
968716343 4:2162505-2162527 TTCCGGACACAGCACCATCTTGG + Intronic
969964054 4:10976041-10976063 TTGAGGAGACAGCACCATGTTGG - Intergenic
972205840 4:36771669-36771691 TTGATCACACAAGACCACATGGG - Intergenic
972583015 4:40411896-40411918 CTGCAAACACAGCACCATCTTGG - Intergenic
976084349 4:81392275-81392297 CTGATCACACAGTGCCATCATGG + Intergenic
976325801 4:83770334-83770356 TTGATCTCACAACTCCATGTTGG + Intergenic
979416065 4:120440453-120440475 TTGATCACAGAGGACAAGCTGGG + Intergenic
980159808 4:129146831-129146853 ATGATCCCCCAGCACCATCAGGG + Intergenic
981682380 4:147414508-147414530 TGGATCACACAGAACCTTATAGG - Intergenic
982944271 4:161599507-161599529 TTAATCACACAACACAATCATGG + Intronic
985075068 4:186206023-186206045 TTGAGCCCACATCACCATGTGGG + Intronic
986632297 5:9785348-9785370 TTTATCACACAATAACATCTGGG + Intergenic
987821271 5:22970039-22970061 TTGGTCACAGATCCCCATCTTGG + Intergenic
987911300 5:24149697-24149719 TTGGTCACCCAGCACTATCATGG - Intronic
989719165 5:44504253-44504275 TTGGCCACACAGCAGCATCCAGG - Intergenic
990698130 5:58445692-58445714 CTGAACTCACAGCAGCATCTAGG + Intergenic
990792305 5:59495840-59495862 TCGATCCCACGGCAGCATCTAGG + Intronic
992754771 5:79893941-79893963 TTTAGCACACAGCTCCATCCAGG - Intergenic
992851919 5:80819019-80819041 TGGAACACAAAGCACTATCTAGG - Intronic
994531834 5:100982239-100982261 TCGATCCCACGACACCATCTAGG - Intergenic
1000089780 5:157920440-157920462 TTGATAAATCAGCTCCATCTGGG - Intergenic
1000299132 5:159939528-159939550 TTGAGCACAAAGCCCTATCTTGG - Intronic
1005706075 6:28454838-28454860 TTGGAGACACAGCACCATTTAGG + Intergenic
1006392375 6:33766075-33766097 TTGATCACACGGTACCTTATGGG + Intergenic
1008755053 6:54785227-54785249 TTGAACCCACAGAACTATCTGGG - Intergenic
1011846692 6:91572921-91572943 TTCCTCACACAGCAAAATCTTGG - Intergenic
1016128900 6:140441465-140441487 ATGAGCATACAGCTCCATCTGGG + Intergenic
1016531209 6:145059648-145059670 CTGACCACTGAGCACCATCTTGG - Intergenic
1021179984 7:17494891-17494913 TTGGCCCCACAGCAGCATCTAGG - Intergenic
1023471541 7:40527174-40527196 ATGATCACACAGAACCTTTTTGG - Intronic
1024213494 7:47227397-47227419 GGGGTCCCACAGCACCATCTTGG - Intergenic
1026272495 7:68848788-68848810 GTGATCACACAGCACCGTCCAGG - Intergenic
1028559483 7:92158125-92158147 TTGATCACACAGACCAACCTTGG - Intronic
1029064827 7:97839007-97839029 TTGATCTCACTACACCTTCTGGG + Intergenic
1030389438 7:108907602-108907624 TGGCTCACAAAACACCATCTAGG - Intergenic
1031958025 7:127962248-127962270 TTGCTTACACAGCACTATTTGGG - Intronic
1032404682 7:131647486-131647508 TTGATCAAAATGCATCATCTGGG + Intergenic
1032727795 7:134607190-134607212 ATGAGCACACAGCAACATCCAGG - Intergenic
1032859685 7:135865327-135865349 GTGATCACCAAGCACCCTCTGGG + Intergenic
1034395025 7:150815865-150815887 TTTTTCACACATCAACATCTAGG - Intergenic
1034984428 7:155498940-155498962 TTGTTAACACACCAGCATCTAGG - Intronic
1035825026 8:2635496-2635518 TTGATAACACAGCAAAATTTCGG + Intergenic
1037878824 8:22562733-22562755 ATGATCACACTGAACCCTCTGGG - Intronic
1043372066 8:79606417-79606439 TTGATAACACAGCAGGATGTGGG + Intergenic
1045822377 8:106354747-106354769 TTAATGATACAGCAGCATCTAGG + Intronic
1047080994 8:121460245-121460267 TTCTTCACACAGGAACATCTTGG - Intergenic
1048998877 8:139811763-139811785 TTGATCACTCAGCAGAATTTAGG - Intronic
1049043067 8:140126950-140126972 TCTATCACCCAGCCCCATCTGGG - Intronic
1049165587 8:141123640-141123662 TTGTTCAAACAGCACCTTCAGGG - Intronic
1053092595 9:35292893-35292915 TCTATCCCACAGCACCATGTCGG - Intronic
1185619200 X:1442998-1443020 TTGGACACACACCGCCATCTTGG + Intronic
1185619244 X:1443302-1443324 TTGGACACACACCGCCATCTTGG + Intronic
1185619247 X:1443321-1443343 TTGGACACACACCGCCATCTTGG + Intronic
1185619253 X:1443359-1443381 TTGGACACACACCACCATCATGG + Intronic
1185619262 X:1443416-1443438 TTGGACACACACCGCCATCTTGG + Intronic
1185619268 X:1443454-1443476 TTGGACACACACCACCATCGTGG + Intronic
1185619876 X:1447308-1447330 TTGGACACACACCGCCATCTTGG + Intronic
1185619903 X:1447492-1447514 TTGGACACACACCGCCATCTGGG + Intronic
1185619919 X:1447600-1447622 TTGGACACACACCGCCATCTTGG + Intronic
1185619927 X:1447654-1447676 TTGGACACACACCGCCATCTTGG + Intronic
1185619939 X:1447746-1447768 TTTGACACACACCACCATCTTGG + Intronic
1185619942 X:1447765-1447787 TTGGACACACACCGCCATCTTGG + Intronic
1185619966 X:1447931-1447953 TTGGATACACAACACCATCTTGG + Intronic
1185619971 X:1447969-1447991 TTGGACACACACCGCCATCTTGG + Intronic
1185619979 X:1448023-1448045 TTGGACACACACCGCCATCTTGG + Intronic
1185619994 X:1448131-1448153 TTGGACACACACCGCCATCTTGG + Intronic
1185620000 X:1448169-1448191 TTGGACACACACCGCCATCTTGG + Intronic
1185620014 X:1448277-1448299 TTGGACACACACCGCCATCTTGG + Intronic
1185620038 X:1448422-1448444 TTGGATACACACCACCATCTTGG + Intronic
1185620066 X:1448625-1448647 TTGGACACACACCGCCATCTTGG + Intronic
1185620082 X:1448733-1448755 TGGGACACACACCACCATCTTGG + Intronic
1185620088 X:1448771-1448793 TTGGACACACACCGCCATCTTGG + Intronic
1185620097 X:1448847-1448869 TTTGACACACACCACCATCTTGG + Intronic
1185620100 X:1448866-1448888 TTGGACACACACCGCCATCTTGG + Intronic
1186206563 X:7206650-7206672 TGGATCACACAGCTCTATGTTGG - Intergenic
1186608593 X:11116327-11116349 TTCATCCCACATCACCAGCTAGG + Intronic
1186644368 X:11490635-11490657 TTGAAATCACAGCACCATCTGGG - Intronic
1187138563 X:16571400-16571422 CTGACCCCACAGCAGCATCTAGG - Intergenic
1187206082 X:17182825-17182847 ATCATCACACACCACCATATGGG + Intergenic
1187524390 X:20040767-20040789 TTGATCACAGATCACCATAATGG + Intronic
1192794501 X:74415311-74415333 CTGATGACACAGCATCACCTTGG - Intergenic
1193183588 X:78486637-78486659 CTGACCCCACAGCAGCATCTAGG + Intergenic
1198199670 X:134402841-134402863 TTGATCACAGATCACCATAACGG - Intronic
1201955058 Y:19614175-19614197 TAGATCAGTCAGTACCATCTTGG + Intergenic
1202084138 Y:21118108-21118130 CTGACCCCACAGCAGCATCTAGG + Intergenic