ID: 1082044989

View in Genome Browser
Species Human (GRCh38)
Location 11:47718183-47718205
Sequence CAGTCTACCAACAGGGACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082044982_1082044989 20 Left 1082044982 11:47718140-47718162 CCCACAGGAGTTATGATTCTTCA 0: 1
1: 0
2: 0
3: 9
4: 137
Right 1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112
1082044983_1082044989 19 Left 1082044983 11:47718141-47718163 CCACAGGAGTTATGATTCTTCAG 0: 1
1: 0
2: 0
3: 11
4: 159
Right 1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG 0: 1
1: 0
2: 0
3: 6
4: 112

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082044989 Original CRISPR CAGTCTACCAACAGGGACCC TGG Intronic
903142967 1:21350702-21350724 CAGTCTTTCACCAGGGGCCCAGG - Intergenic
913130075 1:115831003-115831025 CAGTCTGCCAAGAGGGACAGAGG + Intergenic
914388827 1:147199356-147199378 CAGACTTCCAACAGGAACTCTGG - Intronic
919910455 1:202107529-202107551 CAGGATACCAACAGGCAGCCTGG + Intergenic
921887387 1:220320518-220320540 CATTCTACCAACAGGCCTCCGGG + Intergenic
923803095 1:237229507-237229529 CAATGTACCAACAGGAACTCTGG - Intronic
924566873 1:245206097-245206119 GAGTCAACAAAGAGGGACCCTGG - Intronic
1065898723 10:30186643-30186665 CAGTCTCCCAGCAGTGACCAGGG + Intergenic
1079160795 11:17991980-17992002 CAGTCTACCAGCAGGGGTCAGGG + Intronic
1080508228 11:32939908-32939930 CAGACTAGGAAAAGGGACCCTGG - Intronic
1082044989 11:47718183-47718205 CAGTCTACCAACAGGGACCCTGG + Intronic
1084572462 11:69967895-69967917 CTCTCATCCAACAGGGACCCAGG - Intergenic
1085345081 11:75763436-75763458 CAGACAACCCACAGGGACCTGGG - Intronic
1089541712 11:119193256-119193278 CAGTGGGCCACCAGGGACCCAGG + Intronic
1090788168 11:130068730-130068752 CAGTTTACCCACAGGGAACTGGG + Intergenic
1093307213 12:17536230-17536252 CAGTCTATCAAGATGGAACCAGG - Intergenic
1094496890 12:30994300-30994322 CAGCCTCCAAACAGGGGCCCGGG - Exonic
1094805824 12:34090229-34090251 CAGTCTTCCATCAAAGACCCAGG - Intergenic
1098749058 12:74272311-74272333 CATTTTCCCAACAGGGCCCCAGG - Intergenic
1103248932 12:119483235-119483257 CAGTCTACCAAAAGGCACCAGGG + Intronic
1115939526 14:38592640-38592662 AAGTCTGCCAACAGGTACCAGGG - Intergenic
1116715606 14:48421931-48421953 CATTCTACTAACAAGGAACCTGG + Intergenic
1120678778 14:87453849-87453871 CACTCAAGCCACAGGGACCCAGG + Intergenic
1121498295 14:94413081-94413103 TATTCTACCTACAGGGCCCCAGG + Intergenic
1121849117 14:97203137-97203159 CAGTCAACCAACTATGACCCAGG - Intergenic
1122982692 14:105198759-105198781 CAGCCCACCAGCAGGGGCCCAGG - Intergenic
1128133428 15:65245755-65245777 CTGTTTACTTACAGGGACCCTGG + Intronic
1131030697 15:89183983-89184005 CAGACCACCATGAGGGACCCCGG - Intronic
1131230123 15:90653603-90653625 CAGACAATCAACAGGGACACAGG - Intergenic
1132826098 16:1906436-1906458 CCTTCCACCAACAGGCACCCAGG - Intergenic
1132931363 16:2460620-2460642 CAGGGAACCAACTGGGACCCGGG + Exonic
1139648599 16:68349943-68349965 CAGACTATCAACAGGCTCCCAGG - Intronic
1142131114 16:88431884-88431906 CTGTCTGCGAACAGGGACTCCGG + Exonic
1142284267 16:89165372-89165394 CAGGCTACCTTCAGGGACACTGG + Intergenic
1142299106 16:89246427-89246449 CAGTCTATCATGATGGACCCTGG - Intergenic
1142522444 17:514632-514654 CATTCTTTCAACAGGGAACCAGG + Exonic
1143282199 17:5763299-5763321 CAGGCTACCAACAGGGCTCTTGG - Intergenic
1148956131 17:51355111-51355133 GAGTCCAGCAACAGGGATCCTGG + Intergenic
1149434986 17:56626063-56626085 CAATCTACCAATAGGGACCAAGG + Intergenic
1151194216 17:72420424-72420446 CAGTGTCCAAAAAGGGACCCAGG - Intergenic
1151352933 17:73542404-73542426 CCCTCCACCAACAGGCACCCAGG - Intronic
1155228365 18:23750075-23750097 CATTCTACCAAAAGGGATCAGGG - Intronic
1156193483 18:34746628-34746650 TAGTCTCCCCACAGGGACTCTGG + Intronic
1157293365 18:46425313-46425335 CAGGCCTGCAACAGGGACCCTGG + Intronic
1157404170 18:47409720-47409742 CAGCCAGCCAACAGGGGCCCTGG + Intergenic
1157605348 18:48922868-48922890 CAGTCTTCCCACAGGCAGCCTGG + Intronic
1160379422 18:78440109-78440131 CAGTCTTCCGGCAGGAACCCTGG - Intergenic
1163021373 19:14482644-14482666 TGGTCCACCATCAGGGACCCTGG + Intronic
1166316990 19:41994615-41994637 CAGTGTGGCACCAGGGACCCTGG + Intronic
1167756724 19:51417457-51417479 CTGTCTCCCCACAGGGTCCCAGG - Exonic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
926642620 2:15253534-15253556 AAGCCTTCCAACAGGGACGCAGG + Intronic
926988250 2:18647851-18647873 GAGTCTACAAACAGGGACCAGGG - Intergenic
932210730 2:69927560-69927582 CAGTCTCCTACCTGGGACCCTGG + Intronic
932272937 2:70426553-70426575 CACTCTACCACCATGGACCTTGG - Intergenic
932342132 2:70970820-70970842 CAGCCTACCAAAATGGACTCAGG - Intronic
934616440 2:95774266-95774288 CAGGAAGCCAACAGGGACCCAGG - Intergenic
934644453 2:96050294-96050316 CAGGAAGCCAACAGGGACCCAGG + Intergenic
934837869 2:97606384-97606406 CAGGAAGCCAACAGGGACCCAGG + Intergenic
936783076 2:116057516-116057538 AAGTTAACCAACAGGGACTCTGG + Intergenic
936907457 2:117553611-117553633 CATCCTCCCAACATGGACCCAGG - Intergenic
937306998 2:120878087-120878109 CAGTTTCTCATCAGGGACCCAGG - Intronic
938900412 2:135794616-135794638 AAGTCCACCAACAGGGAGCCCGG - Intronic
940512615 2:154637829-154637851 CAGTCACCCAAAAGGGAGCCTGG - Intergenic
940719077 2:157261599-157261621 GGGTCTACCACCAGGGATCCTGG + Intronic
941968229 2:171321986-171322008 CAGTCTAACAACTGTCACCCAGG + Exonic
948642667 2:239385450-239385472 CTGGCCACCAACAGGGAGCCGGG - Intronic
948966600 2:241386435-241386457 CAGTCAACCAACAAGGAGACAGG + Intronic
1172897033 20:38307467-38307489 CATGCTACGAACAGGGGCCCAGG + Intronic
1173133028 20:40412187-40412209 CACTCTGCCAAGAAGGACCCAGG + Intergenic
1173615444 20:44400488-44400510 CCGTCTACTAACTGGGACCTTGG - Intronic
1174829804 20:53802306-53802328 CAGACAACCAACAGGGTCCACGG + Intergenic
1179414343 21:41186190-41186212 CAGTCTTCCACGTGGGACCCGGG + Intronic
1203224135 22_KI270731v1_random:67882-67904 CAGACTCCCAGCTGGGACCCAGG + Intergenic
949852948 3:8437160-8437182 CAGTCTACCAACAGGAAAGCAGG + Intergenic
954918638 3:54170240-54170262 CATTCCAGCAACAGGTACCCAGG + Intronic
957288735 3:78249594-78249616 AAGCTTACCAGCAGGGACCCTGG + Intergenic
969071300 4:4541734-4541756 CAGTCCTGCGACAGGGACCCCGG - Intronic
970635501 4:18005473-18005495 CAGTGTCCCAGCAGGGACTCTGG + Intronic
976002071 4:80386105-80386127 CAGTCTGCCCCCAGGGAGCCTGG + Intronic
977422664 4:96822592-96822614 TAGTGTACCAACAGGTAACCAGG + Intergenic
978661657 4:111134398-111134420 CAGCCTACCAAAAGTGAACCAGG - Intergenic
985754902 5:1707742-1707764 CAGTCTGCACACAGGGGCCCAGG + Intergenic
986738079 5:10682312-10682334 CATGCTTCCTACAGGGACCCTGG - Intronic
997440577 5:133906061-133906083 CAGTCTAGTAAGAGTGACCCTGG - Intergenic
999206486 5:149851926-149851948 CAGTGTAGAAACACGGACCCAGG - Exonic
1001654758 5:173340879-173340901 CACCCTACCCACAGGGTCCCAGG - Intergenic
1006294814 6:33165606-33165628 GAGGCGGCCAACAGGGACCCAGG - Exonic
1018733947 6:166673414-166673436 CAGTCAGTCAACAAGGACCCTGG + Intronic
1024060026 7:45690556-45690578 GACTCTACCAACAGGGTCCTGGG - Intronic
1029151846 7:98485829-98485851 CAGCCTAGCATTAGGGACCCAGG - Intergenic
1030407959 7:109138691-109138713 CAGCCTACCAAGATGGAACCAGG - Intergenic
1035904940 8:3499572-3499594 CACACTACCAACAAGCACCCTGG - Intronic
1036418981 8:8578521-8578543 TAGTTTGCCAACTGGGACCCAGG - Intergenic
1040588406 8:48765725-48765747 CAGTCTGCTGACAGGGGCCCAGG + Intergenic
1042323662 8:67505034-67505056 CAGTGTACCCACAGGTACTCAGG - Intronic
1043542439 8:81279652-81279674 CTGACTTCCAACAGGCACCCGGG + Intergenic
1051103883 9:13555146-13555168 CAGATTACAAACAGGGACTCAGG + Intergenic
1051617186 9:19017435-19017457 CATTCTACAGACAGGGACACTGG + Intronic
1052383741 9:27801017-27801039 CAGTCTCCCAAAAGGAACACAGG - Intergenic
1056877251 9:90345669-90345691 CAGTCACCCAACAGAGACCTGGG - Intergenic
1059932486 9:119274612-119274634 CATTCTACAAATAAGGACCCTGG - Intronic
1062638785 9:137506165-137506187 CAGTCTAACCACACAGACCCCGG + Intronic
1203760864 EBV:12591-12613 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203761793 EBV:15663-15685 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203762722 EBV:18735-18757 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203763651 EBV:21807-21829 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203764580 EBV:24879-24901 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203765509 EBV:27951-27973 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203766438 EBV:31023-31045 GACTCTGCCAACAGAGACCCGGG - Intergenic
1203767367 EBV:34095-34117 GACTCTGCCAACAGAGACCCGGG - Intergenic
1187176712 X:16902624-16902646 GAGTCTACCAAAAGGGAGACGGG - Intergenic
1192358611 X:70424940-70424962 CACTCGACCATCAGGGACCCTGG - Intronic
1193481248 X:82032056-82032078 AAGTGCACCAGCAGGGACCCTGG + Intergenic
1195196767 X:102504723-102504745 CAGACTACTTACAGGGGCCCTGG + Intergenic
1202106921 Y:21380557-21380579 CAGGCTACCAACAGGGGACAAGG + Intergenic
1202233049 Y:22675725-22675747 CAGGCTGCCAACAGGGATCAAGG - Intergenic
1202310107 Y:23520433-23520455 CAGGCTGCCAACAGGGATCAAGG + Intergenic
1202560694 Y:26150160-26150182 CAGGCTGCCAACAGGGATCAAGG - Intergenic