ID: 1082048575

View in Genome Browser
Species Human (GRCh38)
Location 11:47751470-47751492
Sequence GGAGTGCTACTGTATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082048575 Original CRISPR GGAGTGCTACTGTATCTAGT GGG (reversed) Intronic
900805217 1:4763161-4763183 GGAGTGGTTCTGCATCTAATGGG - Intronic
904278280 1:29398495-29398517 GGGGTGCTACCGTACCTTGTGGG - Intergenic
906102692 1:43273212-43273234 GGCCTGCTGCTGTATCAAGTGGG + Exonic
907596090 1:55721274-55721296 GGAGTGCTATGGCATCTGGTGGG + Intergenic
911113545 1:94218474-94218496 GGAGTGCGCCTGTGTATAGTTGG - Intronic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
916045501 1:160997242-160997264 TAACTGCTACTGTATTTAGTGGG - Exonic
919031927 1:192252556-192252578 CGAATGCCACTGTTTCTAGTTGG + Intergenic
921797111 1:219358917-219358939 GTACTGCTACTGAATCTTGTGGG - Intergenic
921913650 1:220580350-220580372 GGTGTGCAACTGTAGCTACTTGG + Intronic
924124232 1:240833438-240833460 GGGGAGCTACTGTATTTAGATGG + Intronic
924186382 1:241495660-241495682 GGGGTGCTACTGGCTCTAATTGG - Intergenic
1066059787 10:31712586-31712608 GGAATGCTAAAGAATCTAGTAGG + Intergenic
1067373790 10:45709070-45709092 GGAGAGCTACAGGATCTGGTGGG + Intergenic
1067379893 10:45763162-45763184 GGAGAGCTACAGGATCTGGTGGG - Intronic
1070036438 10:72729832-72729854 GAAGTGCTACTGCACCTAGTGGG - Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1075476090 10:122735235-122735257 GGAGTGCTACTGTTATTAGTGGG - Intergenic
1076027711 10:127130013-127130035 GGTGTGGTCCTGTCTCTAGTTGG + Intronic
1078275125 11:9836817-9836839 TTAGTGCTACTGTAAATAGTAGG + Intronic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1090324918 11:125877095-125877117 AGAGTGCTGCTGCATCTAGTGGG + Intergenic
1093522391 12:20066501-20066523 TGAATGCCACTGTTTCTAGTTGG - Intergenic
1096993921 12:55827402-55827424 GGAATGCACCTGTAGCTAGTGGG - Exonic
1099288644 12:80747243-80747265 GAGGTGTTACTGGATCTAGTGGG + Intergenic
1100414403 12:94356709-94356731 GGAATGTTACTGTTTCCAGTCGG + Intronic
1100977094 12:100133789-100133811 GGAGGACTACTGTATATAGCAGG - Intronic
1101163914 12:102008364-102008386 GGATTGCTACTGTGACTAGGTGG - Intronic
1108276447 13:48814910-48814932 GGAGTGTTTCTTTATATAGTAGG - Intergenic
1115298738 14:31859907-31859929 TGAGGGTTACTGTATCTAGCAGG + Exonic
1126730080 15:51673616-51673638 GAAGTCCTACTGTCTCAAGTTGG - Intergenic
1133467013 16:6037054-6037076 GGGGTGCAACTGTATTTGGTGGG + Intronic
1134050713 16:11135406-11135428 CAAGTGCTACTGTGTCTATTGGG - Intronic
1136101464 16:27999672-27999694 GGAGTACTACTGTATTTGTTTGG + Intronic
1139098115 16:63730529-63730551 GCAGTACTACTGTATACAGTTGG + Intergenic
1153263203 18:3244145-3244167 GGACAGATACTGCATCTAGTGGG - Intergenic
1154961140 18:21309825-21309847 GGAGTGCTACTGGAATTAGTGGG + Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
925351596 2:3204841-3204863 GGAGTGCGCCTGCATGTAGTAGG - Intronic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
936735200 2:115432786-115432808 GGAGAGCTACTGCATTGAGTGGG + Intronic
940480468 2:154223328-154223350 GGATAGATACTGTATCTATTTGG + Intronic
946044334 2:216809129-216809151 TGAGTGCGAGTGTGTCTAGTGGG - Intergenic
946121417 2:217518355-217518377 GGAGTGATACTGTATCTAGTGGG + Intronic
1172608890 20:36234674-36234696 GGGGTGCTACTAGCTCTAGTGGG + Intergenic
1173967823 20:47126813-47126835 GGCGTGCTACTGAATTTAGTGGG + Intronic
1176725630 21:10430197-10430219 GGTGTGCTACTATATCTAGTGGG - Intergenic
1181170176 22:21003898-21003920 GGAGTGTGTCTGTATCTAGTTGG - Intergenic
1182782252 22:32877537-32877559 GGAGTGCTGCTGCGTCTAGTGGG - Intronic
1182863532 22:33582135-33582157 GGGGTGCTACTGGATCCAGGGGG + Intronic
955661227 3:61301497-61301519 AGAGTGCTGCTGAATTTAGTGGG - Intergenic
956118397 3:65941520-65941542 AGAGTGCTACTGCATCTACAGGG - Intronic
956432528 3:69201602-69201624 GTAGTGGTACTTTATCTAGCTGG + Intronic
967207159 3:187134348-187134370 GGAGTGCTGCTAGATCTAGAGGG + Intronic
972323454 4:37993531-37993553 GGAGTGCTACTGTATGTTGAGGG - Intronic
973870232 4:55158758-55158780 TGAGTAAGACTGTATCTAGTAGG - Intergenic
975566885 4:75766478-75766500 AGAGTGCTACTGCGTCTAGTGGG + Intronic
975964262 4:79950966-79950988 GGAGTGCTACTGTCTCATGGGGG + Intronic
984189144 4:176583833-176583855 GGGGTGCTACTGAGTCCAGTGGG - Intergenic
987031583 5:13981015-13981037 GGCTTGCTACTTTATATAGTGGG - Intergenic
989246354 5:39259212-39259234 GAAGTCCAACTGTATCTAGCTGG + Intronic
989635055 5:43523193-43523215 TGAGGGCCACTGTATATAGTGGG + Intergenic
992728239 5:79631129-79631151 GGAATGCTACTAAATGTAGTAGG - Intronic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1012833565 6:104237020-104237042 GGAGTGCTACTGGTGGTAGTTGG - Intergenic
1020712768 7:11629530-11629552 GGAGTGTTACTTTAAATAGTGGG + Intronic
1023767020 7:43521279-43521301 GTGGTGCTACTGTACCTAGTGGG - Intronic
1025102343 7:56146008-56146030 GGAATGTTGCTGTTTCTAGTCGG + Intergenic
1025248226 7:57334039-57334061 GGCATGCTACTGCATCTAGATGG + Intergenic
1031529851 7:122863430-122863452 GCATTGCTACGGTATTTAGTGGG - Intronic
1032060043 7:128716619-128716641 GTAGTGCTACTAGAACTAGTAGG + Intronic
1034612242 7:152381375-152381397 GGTGTGCTACTATATCTAGCGGG + Intronic
1042235664 8:66611516-66611538 GGAGTGTTACTATCTCTACTGGG + Intronic
1049120834 8:140735728-140735750 GAAGTACCACTGTAGCTAGTGGG - Intronic
1050170946 9:2815965-2815987 GGAGTGCCAAGGTATCTAGCTGG - Intronic
1050456515 9:5839921-5839943 GGATTGCTAATGTACCAAGTAGG - Intergenic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1187042866 X:15615491-15615513 AGAGTACTACTGCATCTAGTTGG + Intergenic
1194078279 X:89425193-89425215 GGAGGACTACTGTATCTTCTTGG + Intergenic
1194445777 X:93986131-93986153 TGATTGCTGCTGTTTCTAGTTGG - Intergenic
1195713714 X:107797359-107797381 TGCGTGCTACTGTATTTAATGGG - Intergenic
1196109384 X:111929962-111929984 GGAGTGTTACTGTATCTGTTAGG - Intronic
1196740672 X:119022972-119022994 GAAGTGATACTGAAGCTAGTTGG - Intergenic
1200430924 Y:3080726-3080748 GGAGGACTACTGTATCTTCTTGG + Intergenic