ID: 1082050505

View in Genome Browser
Species Human (GRCh38)
Location 11:47767097-47767119
Sequence GGCGGCAGTCACCGCGGTGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 171}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082050490_1082050505 22 Left 1082050490 11:47767052-47767074 CCCCCGCGCACCCTTGCCTTCTG 0: 1
1: 0
2: 0
3: 18
4: 184
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050495_1082050505 12 Left 1082050495 11:47767062-47767084 CCCTTGCCTTCTGAAGGCGAGTC 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050492_1082050505 20 Left 1082050492 11:47767054-47767076 CCCGCGCACCCTTGCCTTCTGAA 0: 1
1: 0
2: 0
3: 12
4: 147
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050489_1082050505 23 Left 1082050489 11:47767051-47767073 CCCCCCGCGCACCCTTGCCTTCT 0: 1
1: 0
2: 2
3: 23
4: 273
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050491_1082050505 21 Left 1082050491 11:47767053-47767075 CCCCGCGCACCCTTGCCTTCTGA 0: 1
1: 0
2: 0
3: 14
4: 156
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050493_1082050505 19 Left 1082050493 11:47767055-47767077 CCGCGCACCCTTGCCTTCTGAAG 0: 1
1: 0
2: 1
3: 48
4: 602
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050496_1082050505 11 Left 1082050496 11:47767063-47767085 CCTTGCCTTCTGAAGGCGAGTCG 0: 1
1: 0
2: 0
3: 3
4: 83
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171
1082050497_1082050505 6 Left 1082050497 11:47767068-47767090 CCTTCTGAAGGCGAGTCGTCCGA 0: 1
1: 0
2: 0
3: 0
4: 13
Right 1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG 0: 1
1: 1
2: 1
3: 14
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082050505 Original CRISPR GGCGGCAGTCACCGCGGTGG TGG Exonic
901086096 1:6613395-6613417 GGCGGGAGTCGCTGCGGCGGTGG - Intronic
901876043 1:12167519-12167541 CGCGGCAGTCGCCGGGGTGAGGG - Intronic
902238703 1:15074215-15074237 GGCTGCAGCCACCGTGTTGGAGG + Intronic
902333963 1:15744330-15744352 GGCGGCAGACGTGGCGGTGGAGG - Exonic
903398295 1:23019614-23019636 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
903750218 1:25616812-25616834 GGCGGCGGGGACGGCGGTGGAGG + Intergenic
905819699 1:40979915-40979937 GACGTCCGTCACCGCGGCGGCGG - Intronic
906348178 1:45034316-45034338 GGCAGCAGTCAGCATGGTGGAGG + Exonic
907297485 1:53464682-53464704 GGCGGCAGTGGCGGCGGCGGCGG - Exonic
907884063 1:58577110-58577132 AGCGGCAGCCGCAGCGGTGGCGG + Exonic
912716920 1:111989718-111989740 GGCGGCAGTGGCGGCGGGGGAGG - Intergenic
913186295 1:116373322-116373344 GGCGGCAGCAACAGCGGCGGCGG + Intronic
915125174 1:153658773-153658795 GGGGGCAGGGACCCCGGTGGCGG + Exonic
917755405 1:178093814-178093836 CCCGGCAGCCACGGCGGTGGCGG - Intergenic
920903017 1:210131207-210131229 GGTGACAGTCACAGCGGTGATGG - Intronic
923506465 1:234609787-234609809 GGCGGCGGGCGCGGCGGTGGGGG + Intergenic
1062858237 10:790212-790234 GGCAGCAGTCACCGATGGGGAGG + Intergenic
1063407883 10:5813731-5813753 GGCGGGAGTCAGAACGGTGGTGG - Intronic
1065993078 10:31031758-31031780 GCTGGCAGTCCCGGCGGTGGTGG - Intronic
1068792309 10:61040896-61040918 GGCGCCAGAGACCACGGTGGGGG - Intergenic
1069829985 10:71277186-71277208 GGCGGCTGTCACCCCGGGGCTGG + Intronic
1072827815 10:98626194-98626216 GGCGGTAGTCATGGAGGTGGGGG + Intronic
1073266367 10:102230673-102230695 GGCGGCAGCCGCGGCGGCGGCGG + Exonic
1075714082 10:124545898-124545920 GGCGACAGTCACGGCGCTGGTGG + Intronic
1077306994 11:1872954-1872976 GACAGCAGTCCCAGCGGTGGGGG + Intronic
1077886283 11:6390376-6390398 GGCGGCTGTCAACGCTGCGGAGG - Intergenic
1077976386 11:7252321-7252343 GGCGGCACTCACCTGGGTCGCGG - Exonic
1079217487 11:18526804-18526826 GGCGGCCGTCATGGCGGTGTCGG - Exonic
1082050505 11:47767097-47767119 GGCGGCAGTCACCGCGGTGGTGG + Exonic
1083267052 11:61551594-61551616 CGAGGCTGTCACCGCGGTGGGGG + Intronic
1084500760 11:69533872-69533894 GGCAGCAGTCAGGGCGGTGGTGG + Intergenic
1084516069 11:69638546-69638568 GGCCGCGGTCACCGGGGCGGGGG + Intergenic
1085199011 11:74690315-74690337 GGTGGCAGTAACGGTGGTGGTGG + Intergenic
1089216620 11:116837986-116838008 GGAGGCAGTCTCCTTGGTGGAGG - Intergenic
1089253117 11:117179230-117179252 GGCGGCAGTGGCAGCGGTGGTGG - Exonic
1092742007 12:11639117-11639139 GGGGGCAGTCACTGAAGTGGAGG + Intergenic
1093157067 12:15699047-15699069 AGGGGCAGTCACATCGGTGGAGG - Intronic
1094564805 12:31590337-31590359 GGAGGCAGGCACGGCGGTCGGGG + Intronic
1096241395 12:49961978-49962000 GGCGGCAGCTGCCGCGGCGGGGG - Exonic
1096843138 12:54391132-54391154 GGCCGCAGTCACCGCGGTGCCGG + Intronic
1100385217 12:94099731-94099753 GGAGGCAGGCAGGGCGGTGGGGG + Intergenic
1101914407 12:108885134-108885156 GCCGGCAGCCACGTCGGTGGTGG - Exonic
1103856001 12:123972217-123972239 GCCGGCAGACCCCGCGGGGGCGG + Intronic
1104822704 12:131687446-131687468 GGCAGCAGTCACAGCGCAGGAGG - Intergenic
1104957786 12:132474765-132474787 GGCGGGGGTCACCGCGGAGGAGG - Intergenic
1104957816 12:132474835-132474857 GGCGGGGGTCACCGCGGAGGAGG - Intergenic
1104973393 12:132541436-132541458 GGCAGCTGTCCCCGGGGTGGGGG - Intronic
1105964606 13:25372630-25372652 GGCGGCAGTCACCGCGATGGTGG + Intronic
1106517017 13:30464938-30464960 GGCGGCCCCCACCGCGGCGGGGG - Intronic
1106925354 13:34607657-34607679 GGCGGGGGTCACCGGGGTGCAGG - Intergenic
1108227455 13:48303941-48303963 GGCGGCAGCGGCGGCGGTGGCGG - Exonic
1108728009 13:53202059-53202081 GACGGCGGTCATCGCGGTGCGGG + Intergenic
1108944160 13:56000538-56000560 GGCGCCAGATACCGCGGTTGAGG - Intergenic
1111676815 13:91398672-91398694 GGCGGCAGTGGCGGCAGTGGCGG + Exonic
1111676817 13:91398681-91398703 GGCGGCAGTGGCGGCAGTGGCGG + Exonic
1115490181 14:33951050-33951072 GGCCGCAGTCGCGGCAGTGGTGG - Exonic
1115853074 14:37602731-37602753 TGCCCCAGTCACCGCGGTGGGGG + Intronic
1117546462 14:56797983-56798005 GGCGGGAGCCCCCGCTGTGGCGG + Intergenic
1121283869 14:92719297-92719319 GGCGGCGGTGGCGGCGGTGGCGG - Intronic
1121762267 14:96455842-96455864 TGTGGCAGTCACCCTGGTGGTGG + Intronic
1122444994 14:101761704-101761726 TGCGGCAGCCACGGCGGCGGCGG - Intergenic
1124971166 15:34490633-34490655 GGCGGCAGAGGCGGCGGTGGCGG - Intergenic
1128830401 15:70763318-70763340 CGCGGGACTCACCGCGCTGGCGG + Exonic
1129827280 15:78641929-78641951 GGCTGCAGTTCCCGAGGTGGGGG - Intronic
1130115632 15:81002202-81002224 GGCGGCAGTGGCCGCGGCAGCGG + Exonic
1130319710 15:82830896-82830918 GGCGGCGGTGGCGGCGGTGGTGG - Exonic
1131053459 15:89362548-89362570 GGAGGCAGGCACGGCAGTGGCGG - Intergenic
1132663799 16:1072812-1072834 GGCGGCACTCACCTGGGCGGCGG - Intergenic
1133029608 16:3004207-3004229 GGCGGCCGCAACCGGGGTGGCGG + Intergenic
1133421425 16:5650312-5650334 AGAGGCAGCCACGGCGGTGGTGG + Intergenic
1135979797 16:27138914-27138936 GGCGGCAGTGGCGGCAGTGGCGG + Intergenic
1136534684 16:30892866-30892888 GGCGCCAGTCCCCGAGGGGGTGG - Exonic
1137730798 16:50688152-50688174 GGCTGCAGTCTCCACGCTGGTGG - Intergenic
1142319584 16:89372331-89372353 GGCGGCAGGCCCTGCAGTGGTGG - Intronic
1142413079 16:89926029-89926051 GCCTGCAGTCACCCCGGGGGGGG + Intronic
1144021185 17:11241128-11241150 GGCCGCAGTCACCGCCGGCGGGG + Intergenic
1144499189 17:15770563-15770585 GGCAGCAGTCAGCATGGTGGAGG + Intergenic
1145162577 17:20585596-20585618 GGCAGCAGTCAGCATGGTGGAGG + Intergenic
1145884410 17:28372197-28372219 GGGGGCAGGCACCGAGGTGCAGG + Exonic
1149669272 17:58391512-58391534 GGCTCCAGTCACCACAGTGGGGG + Intronic
1151755328 17:76072430-76072452 GGCGGCAGTGGCGGCGGCGGTGG - Exonic
1155054459 18:22171669-22171691 GGCGGCAGCAGCCGCGGCGGCGG + Exonic
1156464174 18:37338224-37338246 GGTGGCAGTGACAGTGGTGGTGG - Intronic
1157867196 18:51197220-51197242 GGCGGCAGAGGCGGCGGTGGCGG + Exonic
1158964492 18:62611245-62611267 GGCTGCAGGGACGGCGGTGGAGG - Intergenic
1161079338 19:2302790-2302812 GGCGGCAGGGACGGCGTTGGCGG + Intronic
1161165589 19:2785545-2785567 GGCGGCCGTGGCGGCGGTGGCGG + Exonic
1161400438 19:4064771-4064793 GGCGGAAGTCACAGAGGTGCTGG - Intronic
1161545680 19:4878604-4878626 CGGGGCAGGCACCGTGGTGGTGG + Intergenic
1161646649 19:5456993-5457015 GGCGGCTGTGACCGTGGTGCCGG + Intergenic
1161802638 19:6424556-6424578 GGCGGCGGTCCCGGCGGCGGCGG - Exonic
1162547318 19:11338737-11338759 GGCGGCAGTGGTCGTGGTGGTGG - Intronic
1162954392 19:14090355-14090377 GGCGGCGGCCGCCGTGGTGGCGG + Exonic
1163827644 19:19532628-19532650 GGCGGCTGCCTCCGCGGTGCTGG - Exonic
1165058794 19:33194956-33194978 CGCGGGAGCCACCGCGGTGGGGG - Intronic
1165079764 19:33300661-33300683 GGCGGAACTCACTGCGATGGGGG - Exonic
1165355087 19:35299585-35299607 GGTGGCAGGCACGGAGGTGGAGG + Exonic
1165892959 19:39125813-39125835 GGCGGGAGTGTCCGCGGTGGTGG + Exonic
1167466499 19:49653245-49653267 GGCGGCAGGCACCAAGGGGGCGG + Exonic
1168230507 19:55027669-55027691 GGCGGCGGTCACCGTGATGATGG + Exonic
1168252752 19:55149720-55149742 GGCGGCAGACAAAGGGGTGGGGG - Intergenic
1168701204 19:58440624-58440646 GGCGATATTCGCCGCGGTGGGGG - Intergenic
926134224 2:10325444-10325466 GGCGGCAGTGCCAGCGTTGGTGG + Intronic
928421114 2:31138380-31138402 GGCGGCGGCAGCCGCGGTGGCGG - Intronic
936038322 2:109129642-109129664 GGCGGCGGCCACCGCCGCGGGGG + Exonic
937044982 2:118846528-118846550 GGCGGCAGTGGCGGCGGCGGCGG - Exonic
937905365 2:127050346-127050368 TGCGGCTGGCACCGCCGTGGCGG - Intronic
944273085 2:197804953-197804975 GGCGGCAGTGGCGGCGGCGGCGG - Exonic
944547540 2:200812354-200812376 GGCGGCGGCCGCAGCGGTGGTGG - Exonic
945803413 2:214461788-214461810 GGCGGCAGTGGCAGCAGTGGCGG + Intronic
947741685 2:232487665-232487687 GACGGAAGTGGCCGCGGTGGTGG + Intronic
948805971 2:240453546-240453568 TGCGGCAGGCACGGGGGTGGGGG - Intronic
1171724438 20:28603060-28603082 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1171753624 20:29079985-29080007 GGCGACGGTCCCCGCGGAGGCGG - Intergenic
1171858905 20:30376938-30376960 GGCGACGGTCCCCGCGGGGGCGG - Intergenic
1172064174 20:32207629-32207651 GCCGGCACTCACCGCGCTCGGGG + Exonic
1173166905 20:40691962-40691984 CGCAGCAGTAACCGGGGTGGGGG - Intergenic
1175770541 20:61620883-61620905 GGGGGCACTCACCAGGGTGGTGG - Intronic
1178992418 21:37366876-37366898 GGCGGCGGCAACCGCGGCGGGGG + Intronic
1180297984 22:10961734-10961756 GGCGACGGTCCCCGCGGGGGCGG + Intergenic
1180614966 22:17120934-17120956 GGCGGCAGACGCGGCGGGGGCGG - Exonic
1180997604 22:19973222-19973244 GGAGGAAGACACCGTGGTGGCGG - Exonic
1183438036 22:37806645-37806667 GGTGGAAGTCAGCCCGGTGGCGG - Exonic
1183540667 22:38427670-38427692 GCTGGCAGTCATCGCTGTGGTGG - Exonic
1184759434 22:46536544-46536566 GGAGGGCGTCCCCGCGGTGGCGG + Exonic
1184808560 22:46812553-46812575 GGCGGCAGTCCCCACAGGGGTGG - Intronic
1185248675 22:49787633-49787655 GGCGGCGGCCTCCGCGGTGGCGG - Intronic
954909117 3:54088100-54088122 GGCGGAAGCCACCGACGTGGGGG - Intergenic
958641977 3:96815457-96815479 GGCGGCAGTCACCGGAGGGGTGG - Intronic
961214284 3:125147588-125147610 GGCTGCAGTCACTGGGGTGCTGG + Intronic
966802346 3:183775983-183776005 GGCGGCAGTGGCAGCGGTGGAGG + Exonic
969313750 4:6369536-6369558 GGAGGCAGGCACAGCTGTGGGGG + Intronic
970101262 4:12524850-12524872 GGGGGCATTCACCATGGTGGTGG - Intergenic
975973770 4:80072759-80072781 GGCGGCAGCTGCGGCGGTGGCGG - Intronic
975973988 4:80073840-80073862 GGCGGAAGTCACGGAGGTGGGGG - Intronic
977694302 4:99949811-99949833 GGCGGGACGCGCCGCGGTGGGGG - Intronic
985995811 5:3596267-3596289 GGCTGCAGTCACCTCGGTGCTGG + Exonic
992808170 5:80359333-80359355 GGTGGCAGTCATGGTGGTGGTGG - Intergenic
998200485 5:140114302-140114324 GGCGGCAGTGGCGGCGGCGGCGG + Exonic
998236493 5:140402399-140402421 GGCGGCGGTGGCCGCGGTGAGGG + Intronic
1002054706 5:176592068-176592090 GGTGGCAGTTATCGTGGTGGTGG + Intronic
1002209850 5:177592142-177592164 CCCGGCAGGCACCGCGGCGGCGG + Exonic
1002521747 5:179796225-179796247 GGCGGCGGTCAGCGGGGAGGTGG - Intronic
1002559385 5:180071444-180071466 GCCGGCACTCACCTCCGTGGAGG + Exonic
1004561869 6:16760229-16760251 GGCGGCGGCCGCCGCGGAGGAGG - Intronic
1006309559 6:33248347-33248369 GGCGGCGGGGACCGGGGTGGTGG + Intergenic
1007328478 6:41082923-41082945 GGTGGCAGTGGCGGCGGTGGTGG + Intronic
1008369188 6:50714147-50714169 GGCGGCGGTGGCGGCGGTGGCGG + Intronic
1008922325 6:56855456-56855478 GACAGCAGTCATCGGGGTGGGGG + Intronic
1015149268 6:130019983-130020005 GGCGGCGGTCGCGGCGGCGGCGG + Intronic
1015943364 6:138474420-138474442 GACGGCAGTCACTTCAGTGGAGG + Intronic
1018612558 6:165660352-165660374 GGAGGCAGACACCGGGGGGGAGG + Intronic
1018613078 6:165662258-165662280 AGCAGTAGTCACCGCGGCGGCGG - Intronic
1019999182 7:4745194-4745216 GAAGGCAGGCACCGCGGGGGCGG - Intronic
1023287025 7:38631114-38631136 TGCGGCAGTCACCGAGCTGAGGG + Intronic
1023638421 7:42236486-42236508 GGCGGCGGCCCCCGCGGCGGAGG + Intronic
1024982149 7:55166628-55166650 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982294 7:55167388-55167410 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982323 7:55167529-55167551 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1024982334 7:55167579-55167601 GGTGGGAGTCACAGTGGTGGTGG + Intronic
1025320228 7:58087426-58087448 GGAGGCAAAAACCGCGGTGGCGG - Intergenic
1025842390 7:65163013-65163035 GGCGGTAGTTACTGCTGTGGTGG + Intergenic
1025880655 7:65532956-65532978 GGCGGTAGTTACTGCTGTGGTGG - Intergenic
1025892782 7:65669648-65669670 GGCGGTAGTTACTGCTGTGGTGG + Intergenic
1025916901 7:65873276-65873298 GGCGGCGGTGGCGGCGGTGGCGG + Intronic
1026045105 7:66901761-66901783 GGAGGCAGCAACTGCGGTGGGGG - Intergenic
1026685122 7:72503375-72503397 AGGGGCAGTCACTGAGGTGGTGG + Intergenic
1027198025 7:76044636-76044658 GGCGGAAGTCACCTCTGTAGAGG - Intronic
1031088433 7:117324697-117324719 GGCGGCAGGCAGCGGGGCGGGGG + Intergenic
1032345834 7:131115685-131115707 GGCTGGTGTCACTGCGGTGGTGG - Intronic
1033656923 7:143381103-143381125 GGCGGCAGTGAGTGGGGTGGGGG + Exonic
1034455321 7:151167150-151167172 GGCGGCAGTGGCGGCGGCGGCGG + Exonic
1035021379 7:155803063-155803085 GGCGGCGGGGACCGCGGGGGCGG - Exonic
1035380927 7:158440544-158440566 GGTGGCAGTGGCGGCGGTGGTGG + Intronic
1035480221 7:159175992-159176014 GGCGGCAGACACGCAGGTGGAGG - Intergenic
1037815465 8:22109511-22109533 CGCGGCATTCACCGAGGGGGCGG + Intergenic
1037901768 8:22692969-22692991 GGCGGCGGTGGCGGCGGTGGCGG - Exonic
1045575394 8:103415000-103415022 GGCGACCGTCGCCACGGTGGCGG - Exonic
1049303689 8:141885564-141885586 GGTGGCAGTGACAGCCGTGGTGG - Intergenic
1049585400 8:143430495-143430517 GGCGGCGGTCCCGGCGGGGGCGG + Intergenic
1054782620 9:69179458-69179480 GGGTGCAGTAACAGCGGTGGTGG + Intronic
1059637860 9:116188040-116188062 GGCGGCAATCCCCGCCGTCGTGG - Exonic
1203449645 Un_GL000219v1:99869-99891 GGCGACGGTCTCCGCGGGGGCGG + Intergenic
1190474409 X:50813152-50813174 GGCGGCAGTGGCGGCGGCGGCGG + Intronic
1191717905 X:64205656-64205678 GGCGGCAGCAGCTGCGGTGGCGG - Exonic
1192801848 X:74473263-74473285 GGTGGCAGTCATGGTGGTGGTGG - Intronic
1198872873 X:141194173-141194195 GACAGCAGCCACCGGGGTGGAGG + Intergenic
1199711165 X:150470615-150470637 GGTGGCAGTGGCAGCGGTGGTGG - Exonic