ID: 1082054379

View in Genome Browser
Species Human (GRCh38)
Location 11:47801072-47801094
Sequence TGGAGTGACCAGAGGAAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 366}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082054379 Original CRISPR TGGAGTGACCAGAGGAAAGA GGG Intronic
900476321 1:2878033-2878055 TTGAGTGACGAGGGCAAAGATGG - Intergenic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
901943842 1:12684950-12684972 TGGAGTGAGAGGAGGAAAGAGGG + Intergenic
902177376 1:14661004-14661026 TTAAGAGGCCAGAGGAAAGAAGG + Intronic
903224352 1:21886391-21886413 TGGAGTGGGCAGGGGAAGGAAGG + Intronic
903304275 1:22401601-22401623 TGGTAAGACCAGAGGAAAGAAGG - Intergenic
903406336 1:23099927-23099949 GTGAGGGACCAGAGGGAAGAGGG - Intronic
903537795 1:24078531-24078553 GGGAGCACCCAGAGGAAAGAAGG - Intronic
903962688 1:27066738-27066760 TGGAGTGTACAGAGGATGGAGGG + Intergenic
904216829 1:28927653-28927675 GGGAGAGATGAGAGGAAAGAAGG - Intronic
905054819 1:35084226-35084248 TTGAGAAAACAGAGGAAAGATGG - Intronic
905398330 1:37682847-37682869 TAGAGAGACAACAGGAAAGACGG - Exonic
906290758 1:44617896-44617918 AGGAGTCAGCAGGGGAAAGAAGG - Intronic
906728211 1:48059331-48059353 TGGACTGGTCAGAGGACAGAGGG - Intergenic
907536701 1:55168082-55168104 AGGAGTCAACAGAGGAAACATGG + Intronic
908782276 1:67701234-67701256 GTGAGAGCCCAGAGGAAAGAGGG - Intergenic
908937878 1:69397568-69397590 AGGAGTGACCTTATGAAAGATGG + Intergenic
909057504 1:70839136-70839158 AGGAGTAAGCAGAGGAAAGCAGG - Intergenic
909063627 1:70906750-70906772 TGGAAAGACAAAAGGAAAGAAGG + Intronic
911111605 1:94193810-94193832 AAGTGTTACCAGAGGAAAGATGG + Intronic
911154361 1:94624051-94624073 AGGAGAGAGCAGAGGGAAGAAGG + Intergenic
911506950 1:98765028-98765050 TATAGTGATCAGTGGAAAGACGG + Intergenic
912570546 1:110618038-110618060 TGGAGTGAGAAGAGCAGAGAGGG + Intronic
912571185 1:110623693-110623715 TGGAGTGAGAAGAGCAGAGAGGG - Intronic
913106065 1:115615152-115615174 TGGAGTGAGCAGAGAGAGGATGG - Intergenic
913999089 1:143677355-143677377 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914194011 1:145435024-145435046 TGGGATGAACAGAGAAAAGAAGG + Intergenic
914414690 1:147469020-147469042 TGGAGTTTCCAGAGGAAGGGTGG - Intergenic
914475343 1:148017921-148017943 TGGGATGAACAGAGAAAAGAAGG + Intergenic
915320199 1:155052095-155052117 TGGAGTGTCCGGAGGAGAGAGGG + Intronic
915464231 1:156086953-156086975 AGAAGTGCTCAGAGGAAAGAAGG - Intronic
915949192 1:160176601-160176623 TGGTGCGCCCAGAGGAATGAGGG + Exonic
916011236 1:160707798-160707820 GGGAGGGAGCAAAGGAAAGAAGG - Intronic
916881405 1:169022767-169022789 TGGTGTGAGCAAAGCAAAGAGGG - Intergenic
917048525 1:170891245-170891267 TGGAGGGAGCAGAGGCAAAAGGG + Intergenic
917218016 1:172698047-172698069 TGGAGTGACAAGAGCAAAAAAGG + Intergenic
919212692 1:194509329-194509351 TGGAGTGGCCAGATAAAAGCAGG + Intergenic
920884450 1:209913013-209913035 TGAAGTGAGAAGAGGAAGGAAGG - Intergenic
924030347 1:239879703-239879725 TGGAGAGACAAGAAGGAAGAGGG - Intronic
924166624 1:241289844-241289866 CTGAGTGAGAAGAGGAAAGATGG + Intronic
1063004211 10:1952817-1952839 GGGCGTGTTCAGAGGAAAGAAGG + Intergenic
1063115212 10:3067778-3067800 TGGGGTGACCGGAGAGAAGAGGG + Intronic
1063230335 10:4060115-4060137 TGAAGGGACCAGAGTAACGACGG + Intergenic
1064339948 10:14476902-14476924 TGGAGAGCCCAAAGGAAAAAGGG - Intergenic
1065283061 10:24160074-24160096 TGGAATTAACAGAGAAAAGATGG - Intronic
1065283909 10:24168695-24168717 TTCAGTGAACAGAGGAAACAGGG - Intronic
1065825728 10:29568870-29568892 GGGAGGGAGCAGAGGAAGGAAGG + Intronic
1066055962 10:31680271-31680293 TGGGGTGGCCATAGGAAAAAGGG + Intergenic
1066094884 10:32062627-32062649 AGGTGGGACCTGAGGAAAGACGG - Intergenic
1066365382 10:34771042-34771064 CGGAGAGACAAGAGGAAGGAGGG + Intronic
1068121497 10:52785832-52785854 GGGAGTGATCTGAGGAAAGCTGG - Intergenic
1068840593 10:61609474-61609496 TGGAGTAGCCAGAGGGAAGCGGG + Intergenic
1072543320 10:96414749-96414771 TGGAGTGAGCAGGAGAAGGATGG - Intronic
1073418116 10:103401800-103401822 TGCAGTGAGCAGAGCAGAGATGG - Intronic
1073563860 10:104519085-104519107 TGGAAGGAGCAGAGGGAAGAGGG - Intergenic
1075571349 10:123548621-123548643 TGGTGTGGCCAGAAGAAACAAGG - Intergenic
1076275964 10:129198949-129198971 TGGAGGGAACAGAAGAAAGAGGG + Intergenic
1076276706 10:129205648-129205670 TGTACTGACCACAGGAAAGGCGG - Intergenic
1077026682 11:442760-442782 TGGAGTGCCCTGAGGAGGGAAGG + Intergenic
1077921240 11:6643249-6643271 TGTAGTCACCAGAGGAAAGAGGG + Intronic
1078797257 11:14604716-14604738 GGGAATTACCAGAGGAAGGAGGG - Intronic
1079995487 11:27291132-27291154 TCGGGTGATCAGAGAAAAGAAGG + Intergenic
1080348638 11:31356063-31356085 TGGAATGACCTAAGGTAAGAGGG - Intronic
1081915599 11:46728353-46728375 TGGAGGGACCAGGAGACAGACGG - Intronic
1082054379 11:47801072-47801094 TGGAGTGACCAGAGGAAAGAGGG + Intronic
1084579088 11:70011260-70011282 TGGAGTGAGCAGGGGAGGGAAGG + Intergenic
1084935256 11:72583508-72583530 AGGAGAGACTAGGGGAAAGAGGG + Exonic
1085174999 11:74478219-74478241 TGGTGTGACCAGAGACAAGCAGG - Intergenic
1086435783 11:86779932-86779954 AGGAATGACCAAAGGAAAGGAGG - Intergenic
1086745790 11:90425188-90425210 GGGAGTCCCCAGAGGCAAGATGG + Intergenic
1088538125 11:110883937-110883959 TGGAGGGAGCATAGGAAAGGTGG + Intergenic
1089302049 11:117504686-117504708 TGGGGGGACAAGAGGAAATACGG + Intronic
1089744918 11:120609895-120609917 TGGAGAGAGCCGAGGAAAGGAGG - Intronic
1089752360 11:120660755-120660777 TGGACTGATCACAGGAAAGAAGG - Intronic
1089982073 11:122780756-122780778 TGGTGTGAGCAGAGGACAGTGGG + Intronic
1090204083 11:124875359-124875381 TGGATGGACAAGAGGGAAGAAGG + Intronic
1090717363 11:129442297-129442319 TGGAGTGATCAGAGAACAGCAGG + Intronic
1090986898 11:131775551-131775573 TGGTGTCAACAGAGGGAAGAGGG - Intronic
1091046481 11:132330261-132330283 TGGAGTTAGCTCAGGAAAGAAGG - Intronic
1091300631 11:134505015-134505037 TGGAGTGACTTTGGGAAAGATGG - Intergenic
1091824119 12:3497252-3497274 TAGAGTGAGCACAGGCAAGAAGG + Intronic
1092041253 12:5386672-5386694 TGGAGAGAAAAGAGGGAAGATGG - Intergenic
1094224122 12:28026622-28026644 TGGATTGACCCCAGGAAAGATGG + Intergenic
1094322409 12:29199847-29199869 TAGAGTGACCAGGAGTAAGATGG + Intronic
1094524043 12:31219981-31220003 TGGATTCCCCAGAGGAAACAGGG - Intergenic
1094737133 12:33247415-33247437 TGGAGTTACCTGAGAAAAAAAGG - Intergenic
1095749829 12:45697529-45697551 TGGAGTGGCCACTGCAAAGACGG - Intergenic
1096019197 12:48308004-48308026 TAAAGTGAACAGAAGAAAGATGG + Intergenic
1096673743 12:53215213-53215235 GGGAGTGGCCAGAGGAAAGAGGG + Intronic
1096749411 12:53749116-53749138 GGGAGAGAACAGAAGAAAGATGG + Intergenic
1096769247 12:53923618-53923640 TTGAGTGACAAGAGAAATGAGGG - Intergenic
1098202402 12:68069506-68069528 TGGATTCACCAGAGAAGAGATGG - Intergenic
1098869210 12:75797989-75798011 TGTAGAGCCCAGAGGAAACATGG + Intergenic
1099876263 12:88409685-88409707 TGGATTGAAGAGAGTAAAGAAGG + Intergenic
1099907035 12:88783646-88783668 TTAAGTGACCAAAGGAAAAATGG + Intergenic
1100790950 12:98129131-98129153 TGCAGTGACCAAAGGAAATTTGG - Intergenic
1101096746 12:101349788-101349810 TGGAGTCTCCAAAGGCAAGAAGG - Intronic
1101541072 12:105665917-105665939 TGGAGTAACCAGAAGAGAGGAGG + Intergenic
1101614667 12:106324831-106324853 TGGTGAGACCAGGAGAAAGAAGG + Intronic
1101737391 12:107473284-107473306 GGTAGTGACCAGAGGGAGGATGG - Intronic
1103282544 12:119771885-119771907 TGGAATGACGAGATGAATGATGG + Intronic
1103845378 12:123898639-123898661 TGCACTGAGCTGAGGAAAGAGGG - Exonic
1104007606 12:124904975-124904997 GGGAGTGACCGTAGGCAAGAGGG - Intergenic
1104622949 12:130331926-130331948 TGGAGGGAAAAGAGGAAAGGAGG + Intergenic
1107975432 13:45683861-45683883 TGGGAGGACCAGAGGACAGAAGG - Intergenic
1108199322 13:48027231-48027253 GGGATAGACCAGAGGAAAGAGGG + Intergenic
1108529117 13:51312374-51312396 TGGGATGAACAAAGGAAAGAAGG - Intergenic
1108862876 13:54883824-54883846 TGAAGTGGACAGTGGAAAGAAGG - Intergenic
1109368942 13:61396500-61396522 TGGGGTGCCCAAAGGGAAGAAGG + Intergenic
1109769414 13:66951572-66951594 TGGAGAGAAGAGAGCAAAGATGG + Intronic
1109972683 13:69789801-69789823 TGGAGTGACCAAAGCAAAGAAGG + Intronic
1110267875 13:73558887-73558909 TGGTGTGTGCTGAGGAAAGAGGG - Intergenic
1111987637 13:95080909-95080931 TGGAGTCACCAGCTGAAAGCAGG - Intronic
1112102111 13:96200534-96200556 TGGGGAGAGAAGAGGAAAGATGG - Intronic
1112502674 13:99955098-99955120 TGGTGAGACCTGAGGAAAGGTGG + Intergenic
1113414417 13:110117132-110117154 TGGGGTGACCGAAGGAAAAAGGG - Intergenic
1117799282 14:59426880-59426902 TGGATTGAAATGAGGAAAGAGGG - Intergenic
1118333528 14:64832754-64832776 TGGTGTGATGAGAGGGAAGAAGG - Intronic
1118860928 14:69662513-69662535 AGGAATGACCAAAGGAAAGCTGG - Intronic
1119474774 14:74920718-74920740 GGAAGTGAAGAGAGGAAAGAGGG - Intronic
1119613838 14:76085362-76085384 TGGAGTGACCACAGAGCAGAGGG + Intergenic
1120312626 14:82850235-82850257 TGGGGTGAGTAGAGGAAAGAGGG + Intergenic
1120861548 14:89259385-89259407 CCTAGTGACCAGAGCAAAGAGGG - Intronic
1121512862 14:94525643-94525665 TGGAGAGATCACAGGAAACAGGG - Intergenic
1121940726 14:98068123-98068145 AGGAATGAGCAGAGGAAAGGAGG + Intergenic
1122383163 14:101324620-101324642 TGGAGGGAAAAGAAGAAAGATGG + Intergenic
1123510417 15:20993024-20993046 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123567632 15:21566773-21566795 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1123603891 15:22004066-22004088 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1126261366 15:46696639-46696661 TAGAGTGACCAGAGAGAAGAGGG - Intergenic
1126752466 15:51891115-51891137 TGGAGAGAACAGAGGAAATCTGG - Intronic
1127769782 15:62221868-62221890 TGGAGTGACGTGCTGAAAGATGG - Intergenic
1128065625 15:64762877-64762899 TGGTGTGAACAGAGAAGAGAAGG + Intronic
1128679196 15:69635505-69635527 TGGATTGACCAGTGGAAGGATGG + Intergenic
1129202668 15:74014152-74014174 TGGAGAGACCAGAGGCAGGGAGG + Intronic
1129910534 15:79222578-79222600 TAGAGAGAGCTGAGGAAAGAGGG - Intergenic
1131174075 15:90199268-90199290 TGCAGTAACCAGGAGAAAGAGGG + Intronic
1202975995 15_KI270727v1_random:293868-293890 TAGAGGGAGAAGAGGAAAGATGG + Intergenic
1133262637 16:4561344-4561366 AGCAGTGACCAGAGGAGAGTGGG + Intronic
1133401504 16:5490620-5490642 AGGAGTGCCCAGAGGAACCAAGG - Intergenic
1133832130 16:9333022-9333044 TGGAGTGATGAGCGGAGAGAAGG - Intergenic
1134655271 16:15943456-15943478 AGGAGTGACCAAAACAAAGAAGG - Intergenic
1134688522 16:16175430-16175452 TGGAGGGAGCTGAGAAAAGAGGG + Intronic
1135209913 16:20516342-20516364 TGCAGTGACTATAGGACAGAGGG + Intergenic
1135602949 16:23798714-23798736 TGGAAGAACTAGAGGAAAGAAGG + Intergenic
1136083686 16:27869231-27869253 TGGAGAGAACAGAAGAAGGAGGG + Intronic
1136171284 16:28491414-28491436 GGAAGTGACCGGAGGAAAGGGGG - Intronic
1137248930 16:46729136-46729158 TGGGGGAACCAGAGGACAGAAGG + Intronic
1137920705 16:52485777-52485799 TGGAGAGAAGAGAGCAAAGATGG + Intronic
1138360374 16:56423267-56423289 TGGAGACCCCAGAGGAAAGATGG + Intronic
1140498557 16:75411732-75411754 TGGATTGAAAAGAGGATAGATGG + Intronic
1140992920 16:80231740-80231762 TGGTTCGACCAGAGGAAAAAAGG + Intergenic
1143456993 17:7074690-7074712 TGGACTGCCCAGAGGCATGAGGG + Exonic
1143857001 17:9859484-9859506 GGGAGAGAACAGAGTAAAGAGGG + Intronic
1144478417 17:15609289-15609311 GAGAGGGAGCAGAGGAAAGAGGG - Intronic
1144795386 17:17887900-17887922 TTCAGAGAACAGAGGAAAGATGG + Intronic
1144919873 17:18754422-18754444 GAGAGGGAGCAGAGGAAAGAGGG + Intronic
1145015726 17:19396632-19396654 TGGAGTCCTTAGAGGAAAGAAGG - Intergenic
1146618452 17:34375861-34375883 GTGAGGGACCAGGGGAAAGAAGG + Intergenic
1147766683 17:42841484-42841506 TAGAGTGACCTGAGAGAAGAGGG - Exonic
1148781395 17:50123989-50124011 TGGCATGACCAGGGGAGAGAGGG + Intronic
1148828384 17:50411977-50411999 TGGAATGAACAGAGGGGAGAAGG - Intergenic
1149304630 17:55335827-55335849 GGGAGGGAGCAGAGGGAAGAGGG - Intergenic
1149331793 17:55590281-55590303 TAGAGGGACAAGAGGAGAGAAGG + Intergenic
1149537272 17:57442688-57442710 TGGAATGCCCAGAGAACAGAGGG + Intronic
1150173840 17:63028767-63028789 TGGAGTTACCATATGAAAGATGG - Intronic
1151519181 17:74616187-74616209 TGGAGGGATCAGAAGACAGAAGG + Intronic
1151991708 17:77579276-77579298 AGGAGTGACCAGAAGAAGCATGG - Intergenic
1152807603 17:82363879-82363901 TGGTGGGAACAGAGGATAGAAGG + Intergenic
1152818155 17:82421025-82421047 AGGAGGTAACAGAGGAAAGAGGG + Intronic
1152888837 17:82868285-82868307 TGGGGTGTCCTGAGGAAAGGTGG + Intronic
1154290489 18:13102153-13102175 AGGAGCTCCCAGAGGAAAGAAGG - Intronic
1155346321 18:24860865-24860887 TCAAGTGACCAAATGAAAGATGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156433454 18:37100562-37100584 TGGAGTCTACAGAGGCAAGAGGG - Intronic
1156494697 18:37518089-37518111 TGGCCTGGACAGAGGAAAGAGGG - Intronic
1156745265 18:40383298-40383320 TGATGTCACCAGAGAAAAGATGG - Intergenic
1157392089 18:47311383-47311405 TGGAGCCTCCAGAGGAAACATGG - Intergenic
1157478069 18:48036038-48036060 TGGGGTGACCAGAGCTAGGAAGG + Intronic
1158219423 18:55134928-55134950 AGGAGAGAACAGAGGAGAGAAGG - Intergenic
1159216735 18:65401765-65401787 TGGAGTGACAAGAAGCAATATGG + Intergenic
1159907900 18:74114626-74114648 TGGATTTATGAGAGGAAAGAGGG - Intronic
1165189815 19:34053310-34053332 TAGGGTTACCAAAGGAAAGAAGG + Intergenic
1165530946 19:36400877-36400899 TGGAGTGACTTGATGAGAGAAGG - Intronic
1166140924 19:40804762-40804784 GGGAGTGAGCAGTGCAAAGAAGG + Intronic
1167305755 19:48708435-48708457 TGTTGAGATCAGAGGAAAGAAGG + Intergenic
1167368278 19:49065822-49065844 GGGAGAGACCAAAAGAAAGAGGG + Intergenic
1168503745 19:56915615-56915637 TGGAGTGAACAAAGGGGAGATGG + Intergenic
925328192 2:3038900-3038922 TGGGGTGACCAGGGCACAGAGGG + Intergenic
926648093 2:15311962-15311984 TGGAGGGACTTGAGGAAAGAGGG - Intronic
928050310 2:27986915-27986937 TGGGATGAGCAGAGGAAAAAAGG + Intronic
928433398 2:31238698-31238720 AGGAGTGACCAGGGGCCAGATGG - Intronic
928588374 2:32786581-32786603 TGGAGGGACCAGAGGCAAGGAGG - Intronic
929243508 2:39676769-39676791 TGGAATGACCATAGGCAGGATGG - Intronic
929471297 2:42196649-42196671 TGGAGTGAGAAAGGGAAAGATGG + Intronic
930748118 2:54905459-54905481 TGAAGAGTCCAGAGAAAAGAGGG + Intronic
932547810 2:72733400-72733422 TGGGGAGACAAGAGGAAAAAGGG + Intronic
932631163 2:73344644-73344666 TGGTGGGACAAGAGGCAAGAGGG - Intergenic
933286627 2:80391239-80391261 TGGTGTGAACAGAGTGAAGAGGG - Intronic
934534083 2:95118467-95118489 TGGCATGGCCAGAGGGAAGATGG - Intronic
935156935 2:100491709-100491731 TGGTCTGACCAGAGGGCAGAGGG + Intergenic
936049931 2:109214938-109214960 TGTAGTGAGCTGAGGAGAGAAGG + Intronic
936284967 2:111174772-111174794 TGGTGGGACCAGAGAAAGGAAGG + Intergenic
936786117 2:116095583-116095605 TGGAGTGAATAGGGTAAAGATGG - Intergenic
936941473 2:117888742-117888764 AGGAGAGACAAGAGGAAAGAGGG + Intergenic
937072212 2:119073133-119073155 TGGAGGGAGCAGAGGAGGGATGG + Intergenic
938736650 2:134191893-134191915 TGGCGTGAGCAGGAGAAAGAGGG - Intronic
938841419 2:135168585-135168607 TGGGCTCCCCAGAGGAAAGAAGG + Exonic
939682623 2:145157538-145157560 TGCAGGGAACAGAGGGAAGAGGG - Intergenic
940781279 2:157936775-157936797 TGGCATGACCTAAGGAAAGAAGG - Intronic
941520155 2:166532170-166532192 TGGAGTGACCAGAGACTAGAAGG - Intergenic
942777277 2:179597572-179597594 TGGAGTGACTACAAGAAAGGTGG - Intronic
943169573 2:184380186-184380208 TTGAGTTACCAGAGGAAGCATGG + Intergenic
944540815 2:200751898-200751920 TGGAGTGACTAGATATAAGAAGG - Intergenic
945062675 2:205923009-205923031 TGGACAGAGCTGAGGAAAGATGG + Intergenic
947742567 2:232491287-232491309 CAGAGTAACCAGAGGAAAGAGGG - Intergenic
948488407 2:238295849-238295871 TGGGGTGCACAGAGGAAAAACGG + Intergenic
948614065 2:239187089-239187111 TGCAGTGACAACAGGAAAAATGG + Intronic
1170299476 20:14867160-14867182 TGGAGAAACCTGATGAAAGAAGG + Intronic
1172872264 20:38143139-38143161 AGGAGAGAGGAGAGGAAAGAGGG + Intronic
1172927471 20:38551904-38551926 TGGAGAGACCAGGGAGAAGAAGG + Intronic
1172989508 20:39022785-39022807 TTGAGTGAACACTGGAAAGACGG + Intronic
1174131787 20:48349940-48349962 GGGAGTGACAAGAAGAGAGAAGG + Intergenic
1175728774 20:61337857-61337879 CAGAATTACCAGAGGAAAGAAGG - Intronic
1176272588 20:64243995-64244017 AGGAGTGAGGAGATGAAAGAGGG - Intergenic
1177152911 21:17472576-17472598 CGGAGTTCCCAGAGGATAGAAGG - Intergenic
1177652914 21:23981278-23981300 TGGAGTTACCAGAAAATAGATGG + Intergenic
1178357525 21:31921232-31921254 TGGAATCACCAAAGCAAAGATGG - Intronic
1179989015 21:44936429-44936451 TGGAGTGCCAGGAGGAATGAGGG + Intronic
1181879093 22:25963391-25963413 TGGAGCCACCAGGGGAAGGAAGG - Intronic
1182375664 22:29845843-29845865 TGGAGAGACCAGATTATAGAGGG + Intergenic
1182416522 22:30224814-30224836 CTGAGTGACCAGAGCAAAGCTGG + Intergenic
1182486938 22:30645042-30645064 TGGAGTGACAAGGGGACAAAAGG - Intronic
1182754725 22:32669543-32669565 TGGAGTAACCACTAGAAAGATGG + Intronic
1182944909 22:34312745-34312767 TGGAGAGACAAGAGAAAAGCTGG + Intergenic
1182970349 22:34567937-34567959 TGGACTGAGCAGATGAAATATGG + Intergenic
1184564926 22:45286105-45286127 TGGAGTAGCCAGAGGGAAGCAGG - Intronic
1184972180 22:48031829-48031851 TGGAATGGCCAGAGGAAAGTGGG - Intergenic
1184995471 22:48203570-48203592 TGGAGTTACCAATGGCAAGATGG + Intergenic
1185397993 22:50602170-50602192 GGGAGTGATCTGAGGACAGAGGG - Intronic
949981109 3:9502140-9502162 TGGAGTGACGAGAGGGCAGAAGG + Exonic
951785370 3:26412882-26412904 TGCAGTGACCTGAGAAAATATGG - Intergenic
952329655 3:32352518-32352540 TTGAGAAATCAGAGGAAAGAAGG + Intronic
953412072 3:42696303-42696325 TGGTGTGAGAAGAGGAGAGACGG - Intronic
954098058 3:48346868-48346890 TGTGGGGACCAGAGGATAGATGG - Intergenic
954110827 3:48431829-48431851 AGGAGTGATCAGAGGAGAGCAGG - Intergenic
954697437 3:52435282-52435304 GGGTGTGCCCAGAGGCAAGAGGG - Exonic
954783357 3:53075950-53075972 TGGGGTGATCAGAGAAAAGTGGG + Intronic
954876380 3:53805640-53805662 TGGAGGGGCCTGAGGACAGATGG - Intronic
956712639 3:72051760-72051782 TGGAGCCACCAGAGGGATGATGG - Intergenic
956778713 3:72587711-72587733 TGGAGGGAGCAGAGGGAAGCAGG + Intergenic
956825154 3:72991241-72991263 TGGAGTCACCACAGGCATGATGG - Intronic
959854601 3:111136080-111136102 TGAGGTGGCCAGAAGAAAGATGG + Intronic
960570664 3:119182252-119182274 TGCAGTGAACAGAGGGAAGGTGG + Intronic
961507819 3:127382938-127382960 TGGTGTGGCCAGTGGAAGGAGGG + Intergenic
962405295 3:135095074-135095096 TGAAGTGTCCAGAGCAGAGAAGG - Intronic
963358186 3:144236888-144236910 TGTAATGTCCAGATGAAAGATGG - Intergenic
963785770 3:149533007-149533029 TAGAGGGAGCAGAGGAAGGAAGG - Intronic
964733621 3:159893693-159893715 TGGTGTGACCATCGGAAACAGGG + Intronic
965508788 3:169545407-169545429 TGGAATGAACAAAGGTAAGAGGG + Intronic
967249570 3:187523028-187523050 GGGAGAGAGGAGAGGAAAGAAGG - Intergenic
967451262 3:189625950-189625972 GGGAGTGTCCGAAGGAAAGAGGG - Intergenic
968486609 4:866002-866024 TGTAGGGACCAGAGGTCAGAGGG - Intronic
969203644 4:5625213-5625235 TGGAGTGTGCAGAGGGACGAGGG - Intronic
970563616 4:17308945-17308967 TGGAGTGTGCAGAGCAAAGCAGG - Intergenic
972154536 4:36142834-36142856 TGGAGTTGCCAGCGTAAAGAAGG - Intronic
973876992 4:55229972-55229994 GGGAGTGATCTGAGGAAAGTTGG + Intergenic
975139581 4:70905661-70905683 TGGATGGAGCAGAGGAAATAAGG + Intronic
975947825 4:79729158-79729180 TGCAGAGAGCAGAGGAAATATGG - Intergenic
976753249 4:88471853-88471875 AGGACTGACCACAGGAAGGAAGG - Intronic
976856399 4:89609830-89609852 GTGAGTGACCAGAGGAGAAAGGG + Intergenic
977146791 4:93452411-93452433 TGGAGTAACCAGAGAGTAGAGGG + Intronic
978665210 4:111173914-111173936 TGGCCTGAACAGAAGAAAGATGG + Intergenic
978801717 4:112761812-112761834 TAGAGTGACATGAGGAAAAAAGG - Intergenic
980219076 4:129892207-129892229 TGTAGTTACCAGAGGCAAGGAGG + Intergenic
980253808 4:130350339-130350361 AGGAGAAAACAGAGGAAAGAGGG - Intergenic
980945544 4:139316881-139316903 GGAAGTGACCAGAGCATAGATGG - Intronic
981820849 4:148886023-148886045 TGGAATGAAAATAGGAAAGAAGG + Intergenic
981836973 4:149065412-149065434 TGGAGAGACCTTAGGAAACAAGG - Intergenic
982000164 4:151015137-151015159 AGGAGGGATCGGAGGAAAGAAGG + Intronic
982628816 4:157805156-157805178 AAGAGGGAGCAGAGGAAAGAGGG - Intergenic
982991858 4:162286424-162286446 TGGAGGAAGCAGAGGAATGAAGG - Intergenic
983507788 4:168573720-168573742 TGAACAGACCATAGGAAAGAGGG - Intronic
983696357 4:170537284-170537306 AGGAGTGACTAGGGGAAATAGGG - Intergenic
985993669 5:3584497-3584519 AGGGGGGACAAGAGGAAAGAAGG + Intergenic
985993815 5:3585080-3585102 AGGAGGGACAAGAGGAAGGAAGG + Intergenic
986135306 5:4971564-4971586 TGGTGTGACCTGTGGAAAGTTGG + Intergenic
986768533 5:10950127-10950149 TGGAATGGACAGAGGAAGGAGGG + Intergenic
987024539 5:13910885-13910907 TGCAGTGAGCAGGTGAAAGAAGG + Intronic
987834802 5:23146716-23146738 TGGCGTGACCCGCGGAGAGAAGG - Intergenic
989597163 5:43167044-43167066 TAGAGAGACTAGAGGAGAGAGGG + Intronic
993490127 5:88536830-88536852 TGGAGTTACTAGAGCAAAGAGGG + Intergenic
994988846 5:106972510-106972532 TGAAGAAACCATAGGAAAGAGGG - Intergenic
995050356 5:107696488-107696510 TGGAGAGAGAAGAGGGAAGAAGG + Intergenic
995602513 5:113813270-113813292 TGGACAGAGGAGAGGAAAGAAGG - Intergenic
997098740 5:130944039-130944061 GAGAGGTACCAGAGGAAAGAGGG + Intergenic
997167038 5:131672326-131672348 TAGAGTCAACAGAGGAAACATGG - Exonic
997228442 5:132226965-132226987 TGGAGTGGTCAGAGGAAGGCTGG - Exonic
997248478 5:132370845-132370867 AGGAGTAACTAGAGGAAAAAGGG - Intronic
997982416 5:138476751-138476773 TGGAGCCACCAGAGGAGAGAAGG + Intergenic
998171990 5:139877907-139877929 TGGAGGGTCAAGAGGCAAGAAGG + Intronic
998216749 5:140243281-140243303 TGGAGGGAGAAGAGGGAAGAGGG - Intronic
998401673 5:141851781-141851803 TGGAGAAGCCAGAAGAAAGAGGG - Intergenic
999153437 5:149441849-149441871 TGGAGTGACCAGAAGAGATGAGG + Intergenic
1000923452 5:167165490-167165512 TGGGGTGACCAGAAAGAAGAGGG + Intergenic
1001193108 5:169648630-169648652 TGGGGTGAACACAGCAAAGAAGG - Intronic
1001548887 5:172587673-172587695 GGGAGGGACCAGAGGAGACAGGG - Intergenic
1001778127 5:174344474-174344496 TGGAATGACCAGAAGGCAGATGG - Intergenic
1001943108 5:175754507-175754529 TGGAGTGGCCTGAGCAAAGATGG - Intergenic
1002254832 5:177951241-177951263 TTGAGTGACCCCAGGACAGAGGG - Intergenic
1002669239 5:180852198-180852220 TGAAATTACCAGAGAAAAGATGG + Intronic
1003569987 6:7249453-7249475 GTAAATGACCAGAGGAAAGATGG + Exonic
1004581484 6:16958432-16958454 TTGAGTGAGCAGTGGCAAGACGG + Intergenic
1005421375 6:25654878-25654900 TGGTCTGACCAGAGGAAAGAAGG - Intronic
1007681304 6:43635594-43635616 TGGAGTGAATAGATGCAAGAGGG + Intronic
1011175043 6:84550991-84551013 TGGAGTGAGCTAAGGCAAGAAGG + Intergenic
1011528453 6:88292991-88293013 TGATGTCACCAGAGGAAGGAAGG + Intergenic
1012408878 6:98933239-98933261 AGAAGTTACCAGAGGCAAGAGGG - Intronic
1012436059 6:99216166-99216188 AGGACTGGCCAGAGGCAAGAGGG - Intergenic
1013133860 6:107261167-107261189 TGGAGTGAAGAAAGGATAGATGG - Intronic
1015292016 6:131548003-131548025 TGGAGTCACCAGAGGGATGCAGG - Intergenic
1015349206 6:132196672-132196694 TTGAGGGACCAGATGAATGATGG - Intergenic
1015856257 6:137628190-137628212 TGGGGTGACAATATGAAAGAAGG - Intergenic
1016555933 6:145338359-145338381 TGCAGTGACCAGTGGACAGCAGG + Intergenic
1017467440 6:154707531-154707553 TGGAGGCTGCAGAGGAAAGAAGG + Intergenic
1019887814 7:3920488-3920510 TGGAGTGACTAGAGGAGTGAGGG + Intronic
1020954873 7:14728530-14728552 TGGAGTGGAATGAGGAAAGAGGG - Intronic
1021290898 7:18844185-18844207 TGCAGTGCCCACAAGAAAGATGG - Intronic
1022054545 7:26717000-26717022 AGGAGTGAACACAGGAAAGATGG - Intronic
1022826521 7:34020003-34020025 TGGATACACCAGAGGAAAGAAGG + Intronic
1022847615 7:34226809-34226831 TGGACTGCTCAGAAGAAAGATGG - Intergenic
1023485940 7:40686956-40686978 TGGAGTAACCTGAGGAAGGTGGG - Intronic
1023878820 7:44307236-44307258 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1023878830 7:44307276-44307298 GGGTGTGAGCAGAGGGAAGAGGG + Intronic
1024038932 7:45534300-45534322 TTGACTGTCCAGTGGAAAGATGG + Intergenic
1024727995 7:52221262-52221284 TGGAGTGCCCAATAGAAAGATGG + Intergenic
1025155048 7:56597503-56597525 TGGACTGCCCAGAGGAGAGCTGG + Intergenic
1028387038 7:90267263-90267285 TGGGGTGGCAAGTGGAAAGAAGG - Intronic
1029504067 7:100951512-100951534 GGGTGTGACCAGAGGAGGGAAGG + Intronic
1030849145 7:114461014-114461036 TTGAGTGTGCAGAGGAAAAACGG + Intronic
1031030829 7:116733024-116733046 TGGAATGGACAGAGGAAAGGGGG - Intronic
1031038983 7:116818882-116818904 TGGAGTGAATCCAGGAAAGAAGG - Intronic
1031940645 7:127785220-127785242 TAGATTGACCAGTGGAAGGAAGG + Intronic
1032380961 7:131480179-131480201 TTCACTGACCAGAGGAAAGCTGG - Intronic
1032429285 7:131847855-131847877 TGGAGTAGTCAGAGGAAAGAGGG + Intergenic
1032441258 7:131944735-131944757 GGGATTGTCCAGAGGTAAGAGGG + Intergenic
1032728137 7:134611288-134611310 TGGATTTAACAGAGGGAAGAAGG - Intergenic
1033003725 7:137537075-137537097 TGGCATAACAAGAGGAAAGAAGG + Intronic
1033149193 7:138898439-138898461 TGGAGTGACGTGAGGATAGGTGG + Intronic
1033220992 7:139526020-139526042 TGGGGAGACCAGGGGAAGGAAGG - Intronic
1034318887 7:150161042-150161064 AGGAGTGACCAGAGGCAGGGAGG + Intergenic
1034499581 7:151440831-151440853 TGGAGTGAGCAGAGCGAACATGG + Intergenic
1034773872 7:153806163-153806185 AGGAGTGACCAGAGGCAGGGAGG - Intergenic
1037831358 8:22191646-22191668 AGGAGAGGCAAGAGGAAAGAAGG - Intronic
1038406286 8:27325265-27325287 TGGAGTGGACAGAGGATGGAGGG + Intronic
1039805026 8:40990354-40990376 TGGAGTGAGCAGGGGAGGGAAGG + Intergenic
1040054928 8:43049262-43049284 TGGAGTGACCAGATGGGAGTGGG - Intronic
1043423312 8:80122811-80122833 TGGAGTACACAGAGGGAAGAAGG + Intronic
1043486297 8:80702170-80702192 TGGAGTGAGGAGAACAAAGATGG + Intronic
1044418806 8:91967432-91967454 TGGGGAGACCAGCAGAAAGAAGG - Intronic
1045803346 8:106127581-106127603 TGGAGGGGCCAGAGTAAATAAGG - Intergenic
1046491911 8:114964659-114964681 GGGAGAGACCAGAGGAGAGTAGG + Intergenic
1047648157 8:126890654-126890676 TTGTGTGACCACAGGAAAGCTGG - Intergenic
1047675911 8:127201417-127201439 TGGAGTTAGAAGAAGAAAGAAGG + Intergenic
1048861410 8:138726938-138726960 TGGGGTGACCAGAGGGAGGAAGG + Intronic
1049223557 8:141438894-141438916 TGGAGGGATCAGTGGATAGATGG + Intergenic
1049486737 8:142868818-142868840 TGGACTGAGCAGAAGATAGATGG - Intronic
1049712061 8:144069391-144069413 TGGAGGTTCCAGAGGAAAGCAGG + Intergenic
1050261666 9:3847254-3847276 GGAAGTGCCCAGAGAAAAGAGGG + Intronic
1050879071 9:10676228-10676250 TGGAATTACAAGAAGAAAGAAGG + Intergenic
1051381441 9:16463016-16463038 TGGAGTAATGTGAGGAAAGAAGG - Intronic
1053236806 9:36462524-36462546 AGGAGTGTTCAGAGGTAAGATGG - Intronic
1055591320 9:77817395-77817417 TGGAAGGAACAAAGGAAAGAAGG + Intronic
1057577313 9:96253575-96253597 TGGAGTGACCAGAGAGTGGATGG - Intronic
1058072009 9:100610704-100610726 TGGTGTGACCATAGGAGTGATGG + Intergenic
1058311943 9:103514898-103514920 TGGAGTGGTCAGAGGAGAGTTGG - Intergenic
1058834924 9:108852493-108852515 TGGAGTGAGGAGAGGAGATAAGG + Intergenic
1059457597 9:114409427-114409449 ATGAGTGAGCAGAGCAAAGAAGG + Intronic
1060116675 9:120946946-120946968 AGGTGTGACGGGAGGAAAGAAGG - Intergenic
1061006646 9:127931822-127931844 TGGAGTGAAGAGGGGAAAGCAGG + Intergenic
1186627731 X:11312864-11312886 TGGAGTGATGAAAGTAAAGATGG - Intronic
1187328932 X:18317889-18317911 TGGAGGGAAGAGAGGAATGAAGG + Intronic
1187612463 X:20957222-20957244 AGTAGTGACCAGAGGTAGGAAGG - Intergenic
1188091177 X:25967682-25967704 TGGATTCACCAGAGAAGAGATGG + Intergenic
1188113985 X:26222235-26222257 TGGAGTGGGCAGGGGACAGAGGG + Intergenic
1189124741 X:38434395-38434417 TTGAAAGACCAGGGGAAAGATGG + Intronic
1190288273 X:48974728-48974750 TGAATTGTCCAGAGGACAGATGG + Intronic
1190920125 X:54842831-54842853 TTGAGCAACCTGAGGAAAGAAGG + Intergenic
1192265937 X:69538310-69538332 TGGAGGGCCTAGAGGAAAGTGGG - Intergenic
1192433295 X:71126840-71126862 TGGAGCCACCACAGGATAGAAGG - Intronic
1194651601 X:96521750-96521772 AGGAGTGAAGGGAGGAAAGAAGG + Intergenic
1195351005 X:103997050-103997072 TGGACTGAACAGGGCAAAGATGG + Intergenic
1195644444 X:107212769-107212791 TGGAGTGATCCAGGGAAAGAAGG + Intronic
1195655462 X:107327733-107327755 TGCAGTGTTCAGAGGGAAGAAGG + Intergenic
1195798151 X:108676263-108676285 TGAAATGACCAGAGGAGAGAAGG + Intronic
1196650333 X:118161847-118161869 GGGAGTGACCAGAGGAGAGGTGG + Intergenic
1197039205 X:121915259-121915281 AGGAGTGACTGGAGGATAGAAGG - Intergenic
1197654720 X:129104619-129104641 GGGAGTGAGCAGCAGAAAGAAGG - Intergenic
1199283776 X:146033827-146033849 TTTAGTGACAAGAGGTAAGATGG + Intergenic
1200831212 Y:7689956-7689978 GGGAGTGGCCGGAGGAAAGTGGG + Intergenic
1201057025 Y:10004222-10004244 TAAAATGAGCAGAGGAAAGATGG - Intergenic