ID: 1082054772

View in Genome Browser
Species Human (GRCh38)
Location 11:47804891-47804913
Sequence CTTTGGAAGGGTAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195158
Summary {0: 3, 1: 87, 2: 3746, 3: 56082, 4: 135240}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082054764_1082054772 -8 Left 1082054764 11:47804876-47804898 CCTGCAATCCCTGTACTTTGGAA 0: 1
1: 23
2: 1052
3: 27940
4: 333553
Right 1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG 0: 3
1: 87
2: 3746
3: 56082
4: 135240
1082054762_1082054772 11 Left 1082054762 11:47804857-47804879 CCAGGCACGGTGGCTCACTCCTG 0: 408
1: 18105
2: 82417
3: 133835
4: 157680
Right 1082054772 11:47804891-47804913 CTTTGGAAGGGTAAGGTGGGAGG 0: 3
1: 87
2: 3746
3: 56082
4: 135240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082054772 Original CRISPR CTTTGGAAGGGTAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr