ID: 1082055235

View in Genome Browser
Species Human (GRCh38)
Location 11:47809308-47809330
Sequence TCTCATATACTGCTGGTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 2, 2: 1, 3: 21, 4: 162}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082055235 Original CRISPR TCTCATATACTGCTGGTGCT GGG Intronic
902630905 1:17703992-17704014 CCTCCTAAAGTGCTGGTGCTGGG + Intergenic
903999399 1:27330427-27330449 TCTCATTCACTGCTGGTGGGAGG - Intronic
904305860 1:29589536-29589558 TCTCATGAACTGCTGGTGGGAGG + Intergenic
904332585 1:29771913-29771935 TCTCATACACTGCTGGTGGGAGG + Intergenic
905148914 1:35911186-35911208 TCTTATACACTGCTGGTGAAAGG - Intronic
905586457 1:39123155-39123177 TATCAGATGCTGCTGGTCCTTGG - Intronic
906304912 1:44711304-44711326 CCTCATATATTGCTGCTACTGGG - Intronic
908097555 1:60755236-60755258 ACTCATATGCTGCTGGTGGGAGG - Intergenic
909543421 1:76816498-76816520 TCTCTTTTACTGCTGTTTCTAGG + Intergenic
917189787 1:172402958-172402980 TCCCAGATGCTGCTGGTCCTGGG - Intronic
918205611 1:182306393-182306415 TCTCATATTCTGCTGGTAGGTGG - Intergenic
921029646 1:211326426-211326448 TCTCAGAGATTGCTGGTGTTAGG + Intergenic
921382058 1:214534122-214534144 CCTCACATCCTGCTAGTGCTGGG - Intronic
921392522 1:214630889-214630911 TCTCATAATCTGTTGGTTCTTGG + Intronic
921644817 1:217601903-217601925 TATCAGATACTGCTGGGCCTTGG - Intronic
922196807 1:223365474-223365496 TCTCACATACTGATGGTAGTTGG + Intergenic
923873888 1:238026524-238026546 TCTCATACACTACTGGTGTCAGG + Intergenic
924168217 1:241307734-241307756 TGTCAGATACTGCAGGTGCTGGG - Intronic
1064168963 10:13012576-13012598 GCTTATATACTGCTGGTGGGAGG + Intronic
1064706935 10:18082671-18082693 TCTCATATCCTTCTGGTTTTAGG + Intergenic
1066511992 10:36110468-36110490 TATAATATCCTGCTGCTGCTTGG - Intergenic
1067780461 10:49199778-49199800 CCTCATATACTGCTGGTAGGAGG + Intergenic
1067856532 10:49798359-49798381 TCTCATATACTGCTGGCGAAAGG + Intergenic
1070982840 10:80664067-80664089 TCCCATTTACTTCTGGTGCCAGG + Intergenic
1073537209 10:104288476-104288498 TTTCACATACTGCTGGTGAGGGG - Intronic
1082055235 11:47809308-47809330 TCTCATATACTGCTGGTGCTGGG + Intronic
1085021187 11:73209848-73209870 TCCCATACACTGCTGGTGGAAGG + Intergenic
1085703204 11:78763480-78763502 GCTCACATGCTGCTGGTGCATGG + Intronic
1085723010 11:78929663-78929685 TTTAATATCCTGCTGGGGCTGGG + Intronic
1085805364 11:79630946-79630968 TCTCATACACTGCTGGTGGGAGG + Intergenic
1088306132 11:108410156-108410178 ACTCATATATTGCTGGTGGGGGG - Intronic
1096220099 12:49823735-49823757 TCTCAGCAGCTGCTGGTGCTGGG + Intronic
1097573127 12:61357019-61357041 TCTCACATGCTGCTGCTGCGAGG - Intergenic
1098097572 12:66975219-66975241 ACTCATATATTTCTGGTGCCAGG - Intergenic
1105510257 13:21045832-21045854 TCTCATCTGCTGCTGCTGCCTGG + Exonic
1106732662 13:32557546-32557568 TCTCATATATTGCTGGTAGAAGG - Intergenic
1109997597 13:70149727-70149749 TTTCAGCTACTGCTGGGGCTAGG + Intergenic
1112297822 13:98203883-98203905 ACTCATATACTGCTGGTTGCTGG - Intronic
1114479634 14:23024657-23024679 TCTCCCAAAGTGCTGGTGCTGGG + Intronic
1114774702 14:25468318-25468340 TCTCATACACTGCTAATGCAAGG - Intergenic
1116468898 14:45264884-45264906 ACTCACATACTGCTGCTGGTAGG - Intergenic
1119023836 14:71137117-71137139 GCTCATCTACTCCTGGAGCTGGG + Intergenic
1120681717 14:87488094-87488116 GCTCAGATACTGCTAGTTCTGGG - Intergenic
1121519003 14:94572793-94572815 TCTCATATCCAGCTGGCACTGGG - Intronic
1126448472 15:48778448-48778470 TCTAATAAACTGCTGGTGGGTGG + Intronic
1128508130 15:68293387-68293409 TCTTAAATAGTGCTGGTCCTGGG - Exonic
1132362313 15:101226672-101226694 TCTCATATGCTGGTGGAGCGAGG - Intronic
1132678077 16:1128909-1128931 TCTCATCTGCTGCTGCTGCGTGG - Intergenic
1134621558 16:15693329-15693351 TCTCATGTGCTGCTGGTGCATGG + Intronic
1135126396 16:19813471-19813493 TGGCATATACTGCTGCTGATTGG - Intronic
1137693025 16:50442326-50442348 CAGCTTATACTGCTGGTGCTGGG - Intergenic
1138407698 16:56811217-56811239 TCTCACATACTGCTGGTGGGAGG - Intronic
1140697657 16:77550951-77550973 TCTCATATTCAGCAGGTGCCAGG + Intergenic
1141304163 16:82845357-82845379 TCTCCTACACTGCAGGAGCTTGG - Intronic
1142912399 17:3105804-3105826 TCTCATACACTGCTGGCAGTAGG - Intergenic
1143652998 17:8275856-8275878 TCTTACATACAGCAGGTGCTGGG - Intergenic
1143770726 17:9166850-9166872 ACCCATATGCTGCTGGTGATTGG + Intronic
1147122030 17:38341107-38341129 TCGCACACACTGCAGGTGCTGGG - Intronic
1148600588 17:48891626-48891648 TCTCCTATATTGCTGGTGAGAGG - Intergenic
1148612131 17:48971599-48971621 TCGCATATTCTGCTGCTTCTGGG - Intergenic
1149378112 17:56065721-56065743 TCTCATATAGTGATGGTTCATGG + Intergenic
1151372732 17:73658967-73658989 TTTCATATGCTGCTGATGGTGGG + Intergenic
1153211339 18:2768390-2768412 TCCCATATACTGCTGGTGAGAGG + Intronic
1155302538 18:24443935-24443957 TCTCATTTACTGCAGGTTTTAGG + Intronic
1155560367 18:27069863-27069885 ACTAATTTACTGCTGCTGCTTGG - Intronic
1156487473 18:37475653-37475675 TCTGAAATCCTGCAGGTGCTGGG - Intronic
1157878241 18:51293969-51293991 TCACCTATCCTGCTGCTGCTAGG - Intergenic
1157929669 18:51807887-51807909 TGTCTTATACTGCTGTTGCATGG - Intergenic
1157960606 18:52149709-52149731 TCACATATACTGCTTCTGCCTGG - Intergenic
1163071605 19:14847410-14847432 TTTCATAAACTGCTGTTGCCAGG + Intergenic
1168268615 19:55237359-55237381 TCTCACATTCTGCTTGTGCCTGG - Intronic
928493697 2:31810185-31810207 TCTCAGATAATGCTGATGCTGGG - Intergenic
929723404 2:44396624-44396646 TCTCATACACTGTTGGTGGAGGG + Intronic
934833629 2:97560494-97560516 ACTCTGATACTGCTGGTCCTTGG - Intronic
936587160 2:113768170-113768192 TCTCATGGAATGCTCGTGCTGGG - Intergenic
937026756 2:118705375-118705397 TTTCATTTTCTGCTGCTGCTGGG - Intergenic
937270973 2:120652420-120652442 CCTCATAGACTCATGGTGCTTGG - Intergenic
937400628 2:121580674-121580696 TCTTATATTCTCCTAGTGCTGGG + Intronic
940877682 2:158914377-158914399 TCCCATTTCCTGCTGGTGTTGGG + Intergenic
944446873 2:199801065-199801087 TCTTACATACTTCTGATGCTGGG + Intronic
944605938 2:201351368-201351390 TCTCATCTACTGCACCTGCTGGG - Exonic
946319131 2:218939256-218939278 ACTCAGACACTTCTGGTGCTGGG + Intergenic
946378722 2:219330467-219330489 GCTCATATAGTGCTGGGGTTGGG + Intronic
948005335 2:234603573-234603595 TCTAATGTACAGCAGGTGCTCGG + Intergenic
948480512 2:238247342-238247364 TCTCACACACTGCTGGCTCTTGG - Intronic
1169754367 20:9027502-9027524 TATCTTCTACTGCTGGTGTTCGG - Intergenic
1170548989 20:17459527-17459549 TCTCATATACTGCTCAAGGTAGG - Intronic
1170580956 20:17699227-17699249 TCCCTTTTGCTGCTGGTGCTTGG - Intronic
1171391679 20:24805474-24805496 TCTCAAATACTCCTGTTGATGGG - Intergenic
1174764470 20:53239446-53239468 GCTCAAAAACTCCTGGTGCTGGG + Intronic
1178174639 21:30082410-30082432 TCTCATATATTCTTGGTGTTTGG - Intergenic
1180656966 22:17430003-17430025 TCTCATACACTGTTGGTGGGGGG - Intronic
1181995089 22:26871468-26871490 TCTCATCTACTGTTGGTGGGAGG - Intergenic
1183479935 22:38057868-38057890 GCTCCTATACTGCTGGAACTTGG - Intronic
1184329806 22:43820161-43820183 TCCCATATATTCGTGGTGCTGGG - Intergenic
950178012 3:10889606-10889628 TCCCAAATAAGGCTGGTGCTAGG - Intronic
950925978 3:16742388-16742410 TCTTATACACTGCTGGTGGGGGG - Intergenic
950952331 3:17013657-17013679 TCTCAAATAATGCAGGTTCTTGG - Intronic
951604695 3:24420188-24420210 TCACAAATATTGCTGGTCCTGGG - Intronic
951742792 3:25942797-25942819 TCTCATCTACTGCTGGTGGGAGG - Intergenic
953460471 3:43078029-43078051 TCTCATACACTGCTGGGGCTGGG - Intergenic
953513219 3:43564649-43564671 GCTATTATAATGCTGGTGCTTGG + Intronic
953695231 3:45153080-45153102 TCTCAAATAATAATGGTGCTTGG + Intergenic
953808092 3:46089080-46089102 TCTCCTATCCTGGAGGTGCTTGG + Intergenic
953940734 3:47093781-47093803 TCTCATACACTGTTGGTGAGGGG - Intronic
955223116 3:57039337-57039359 TCTCATATACTGCTGTTGCTGGG + Intronic
956462874 3:69489001-69489023 TCTCTTTTACTGCTTGTGCTGGG - Intronic
958518868 3:95158312-95158334 TCTCATATAATGCTGGTAAGTGG + Intergenic
959413615 3:106057146-106057168 TCTGAAATACTTCTGATGCTTGG - Intergenic
960530571 3:118759472-118759494 TTTCAAATGCTGCAGGTGCTGGG - Intergenic
961756619 3:129131209-129131231 TCTCATCCACTGCTGGCACTTGG + Intronic
962415568 3:135178563-135178585 TCTCCTAAACTGGTGTTGCTTGG - Intronic
963063629 3:141244930-141244952 TTTCATACACTGCTGGTGAGAGG - Intronic
963145175 3:141986753-141986775 GCTCATACACTGCTGGTGGCAGG - Intronic
964354466 3:155837424-155837446 TCTCTTACACTGCTGGTGGTAGG + Intronic
965568262 3:170144590-170144612 TCTCATACATTGCTGGTGAGAGG - Intronic
967432907 3:189408227-189408249 GCTCATATACTGCTAGTGGAAGG + Intergenic
970653470 4:18203447-18203469 CCTCAAATACTGCTGAGGCTAGG - Intergenic
972275462 4:37553216-37553238 TTTGGTATACTGCTGGTGCCTGG - Intronic
974511930 4:62854531-62854553 TATCAGATACTTCAGGTGCTAGG - Intergenic
976177310 4:82367689-82367711 TCCAATTTACTGGTGGTGCTTGG - Intronic
977621726 4:99145444-99145466 TCTCATACACTGCTGCTGGTAGG - Intronic
980087731 4:128409303-128409325 TCTCAAATGCTGGTTGTGCTAGG + Intergenic
981730697 4:147894216-147894238 TCTCATACACTGCTGATGGGAGG - Intronic
984851697 4:184159420-184159442 TTTCATAGTCTGCTGGTGATTGG - Intronic
985848033 5:2368318-2368340 TCTCAATTACTTCTGCTGCTTGG + Intergenic
985972087 5:3386367-3386389 TCTAATATGCAGCTGCTGCTGGG + Intergenic
986426334 5:7635592-7635614 TCTTATTTACAGCTGCTGCTTGG - Intronic
987008154 5:13732337-13732359 TCTCACATAGTGCAGGAGCTGGG + Intronic
987882931 5:23773307-23773329 TGTCATACACTGTTGGTGGTAGG - Intergenic
988579368 5:32455544-32455566 TCTCATATATGACTGGTGCATGG - Intergenic
988734525 5:34007552-34007574 TCTGAGATACTGCTGTTGCCCGG - Intronic
988781692 5:34528358-34528380 CCTCATATTCTGCTGGTGGATGG - Intergenic
991649872 5:68840919-68840941 CCTAACATACTCCTGGTGCTGGG - Intergenic
992970605 5:82053091-82053113 TCTCATACATTGCTGGGGCAGGG - Intronic
994948163 5:106423245-106423267 TCTCACCCTCTGCTGGTGCTGGG + Intergenic
995266651 5:110169939-110169961 TCACATATATTGATGGGGCTTGG - Intergenic
996373552 5:122778430-122778452 TCTTATACACTGCTGCTGATGGG - Intronic
1001193492 5:169651704-169651726 CCTCATAGGCTGCTGTTGCTTGG - Intronic
1002440089 5:179259750-179259772 TGTCAGAAAGTGCTGGTGCTTGG + Intronic
1004032734 6:11887517-11887539 ACTTATATTCTGCTGCTGCTAGG - Intergenic
1005367074 6:25089340-25089362 TCTCATAAACTGGTGAAGCTGGG - Intergenic
1007460247 6:42012874-42012896 TCTTATATACTTCTGGAGATGGG + Intronic
1008176461 6:48273543-48273565 TCCCCTATAATGTTGGTGCTAGG + Intergenic
1009795193 6:68457179-68457201 TCTCATATACTGCTAGGGGGAGG - Intergenic
1013847768 6:114475078-114475100 ACTCATATACTGCTGGTGGCAGG + Intergenic
1014569578 6:122992693-122992715 ACTCATATATTGCTGGGGGTTGG + Intergenic
1016588191 6:145713610-145713632 ACTCATACACTGCTGGTGAGTGG + Intronic
1018422429 6:163651081-163651103 TCTCATTTATGGCTGTTGCTGGG - Intergenic
1020613647 7:10431846-10431868 TCTCATACAATGCTGGTGACAGG - Intergenic
1022951622 7:35344489-35344511 TCTCATATATTGCTGGTGGGAGG + Intergenic
1023138692 7:37079678-37079700 TGTCATATGCTGCAGGTGATGGG - Intronic
1023822106 7:43986184-43986206 GCTCATATACAGCTGGTGAGTGG - Intergenic
1024944697 7:54796998-54797020 TTTCATTTACTCCAGGTGCTGGG + Intergenic
1029938692 7:104456564-104456586 TATCATATACTGAGGTTGCTAGG - Intronic
1031789167 7:126078464-126078486 TCTCATAAACTGCTGGTGGAAGG - Intergenic
1033396673 7:140980840-140980862 TTTCATGTACTGCTGGTGGTAGG - Intergenic
1033474455 7:141677596-141677618 TCCCATTTACTGCGGGTGCAGGG + Intronic
1036618668 8:10407768-10407790 TATCCTATACTTCAGGTGCTGGG - Intronic
1039000115 8:32970626-32970648 TATCTTATTCTGCTGGTCCTGGG - Intergenic
1042047328 8:64668091-64668113 TCTCAAACACTGCTGTTGATAGG - Intronic
1042048214 8:64678650-64678672 GGTCACATACTGCTGCTGCTGGG + Intronic
1043425766 8:80147237-80147259 TTTAAGATACTGCAGGTGCTAGG + Intronic
1044755134 8:95453617-95453639 TCTCATACACTGCTGGTGGAAGG - Intergenic
1046038521 8:108874097-108874119 TTTCATTTACTGCTAATGCTTGG + Intergenic
1050108435 9:2189913-2189935 TCTCATCTCCTTCTGGAGCTAGG + Intronic
1050500270 9:6290689-6290711 TCTTACATTCTGCTGGAGCTAGG - Intergenic
1051501386 9:17781665-17781687 TCTCAAATACTGCTGGTAGGAGG - Intronic
1053154399 9:35765755-35765777 TCTCATATAATGCTGGTAAGTGG - Intergenic
1053507611 9:38657027-38657049 TCTCACACACTGCTGCTGCACGG + Intergenic
1056318338 9:85413553-85413575 TCTTATATACTGCTGGTGAGAGG - Intergenic
1057320011 9:94004069-94004091 ACTCCTATGCTGCAGGTGCTGGG - Intergenic
1058021286 9:100091850-100091872 TCTCATATGATGCTGATGCCTGG + Intronic
1058341963 9:103908528-103908550 TCTAATGTACTTCTGGTGCTGGG - Intergenic
1059476801 9:114553896-114553918 TCTCATCTACTACTTGAGCTGGG + Intergenic
1061572535 9:131486626-131486648 TCCCCTCTAATGCTGGTGCTGGG + Intronic
1186549546 X:10488410-10488432 TCTCACAAACTGCTGGAGGTGGG - Intronic
1186675273 X:11809835-11809857 TCTCATATATTGCTGGTGTGTGG - Intergenic
1187480113 X:19647783-19647805 TCTCAGGTGCTGCTGGTGCAGGG - Intronic
1187508588 X:19897462-19897484 TCCCACATGCTGCTGCTGCTGGG - Intergenic
1188047026 X:25437615-25437637 TCTCATGTAATGCTGATGCTGGG + Intergenic
1188281529 X:28275937-28275959 TCTCATATACTGCTGGTGGTAGG - Intergenic
1188576161 X:31652767-31652789 TTTCATAAAGTGGTGGTGCTGGG + Intronic
1189313596 X:40037533-40037555 CCTCATACATTGCTGGTGGTGGG - Intergenic
1192254693 X:69445908-69445930 TCTTATACACTGCTGGTGGGAGG - Intergenic
1197501637 X:127249685-127249707 TGTCATATACTGCTTGTGAGAGG + Intergenic
1200112718 X:153750265-153750287 TCTCATATGCTGCCCATGCTCGG + Intergenic