ID: 1082056278

View in Genome Browser
Species Human (GRCh38)
Location 11:47819941-47819963
Sequence CAGGCTGCAGAGTTGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 435
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 398}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082056278_1082056282 15 Left 1082056278 11:47819941-47819963 CCCTGCTCCAACTCTGCAGCCTG 0: 1
1: 0
2: 3
3: 33
4: 398
Right 1082056282 11:47819979-47820001 TTGCTCAAATGCCATCTACAAGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082056278 Original CRISPR CAGGCTGCAGAGTTGGAGCA GGG (reversed) Intronic
900934592 1:5757145-5757167 GAGGCTGCAGAGCCGGAGCCGGG + Intergenic
901156272 1:7141653-7141675 CAGACTCCAGAGTAGGTGCATGG - Intronic
901212554 1:7534726-7534748 CAGGGGGCAGAGTTGGGGCCTGG + Intronic
901565751 1:10113351-10113373 CAGTCCCCAGTGTTGGAGCACGG - Intronic
902752717 1:18528523-18528545 CAGGCTCCAGAGTTGGGGCCTGG - Intergenic
904236848 1:29122136-29122158 CAGGCGGCAGATTTGCAGCCCGG - Intronic
904643990 1:31952234-31952256 CAGGCTGAAAAGCTGGGGCAAGG - Intergenic
904779759 1:32936921-32936943 CAGGCTGCAGTATGGGAGCGGGG + Exonic
904820734 1:33242159-33242181 GAGGCTGCAGGGGTGGATCAGGG + Intergenic
905308673 1:37035049-37035071 CTGGCAGCAGAGTTGGGGCTGGG + Intergenic
906064862 1:42973445-42973467 CAGGCTGTAAAATTGGAGCATGG + Intergenic
906634823 1:47402412-47402434 TAGAATGAAGAGTTGGAGCAGGG + Intergenic
907715631 1:56923484-56923506 TAGGCTACAGGGATGGAGCATGG - Intergenic
908747918 1:67393813-67393835 CAGGCTACAGTGTTGGAGTTGGG + Intronic
910270011 1:85384427-85384449 CAGGCCACAGAGGTGGAGGAGGG - Intronic
911612911 1:99976808-99976830 AAGGGTGCAGGGTTGGAGGAGGG + Intronic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
913563443 1:120046762-120046784 CAGGCTGTAGATTTTCAGCATGG - Intronic
913634680 1:120746815-120746837 CAGGCTGTAGATTTTCAGCATGG + Intergenic
914284037 1:146206126-146206148 CAGGCTGTAGATTTTCAGCATGG - Intronic
914545068 1:148656865-148656887 CAGGCTGTAGATTTTCAGCATGG - Intronic
914621499 1:149413823-149413845 CAGGCTGTAGATTTTCAGCATGG + Intergenic
915515073 1:156407972-156407994 AAGGCTGCAGGGAGGGAGCAGGG + Exonic
916192900 1:162196553-162196575 CAGGCTGCAGTGAAGTAGCAGGG + Intronic
917322530 1:173798350-173798372 CAGGCAGCAAAGTTGGAAGAAGG + Intergenic
918148943 1:181781610-181781632 CAGGCTGGGGAGGTGGAGGAGGG + Intronic
918326342 1:183414215-183414237 CAGGCTGTAGAGCAGCAGCAGGG - Intronic
920306576 1:205022013-205022035 CAGGGTGCAGAGAGGCAGCAGGG + Exonic
920561286 1:206940442-206940464 CAGGCTGAAGGGGTGGAGCTTGG + Intronic
920866319 1:209756829-209756851 CAGGCTGCAGAGAGAGAACAGGG - Intronic
922095614 1:222440604-222440626 CAGGCTACAGTGTAGGAGGATGG - Intergenic
922613466 1:226946420-226946442 CTGGCTGAAGCGTTGGGGCACGG + Intronic
922819279 1:228472837-228472859 GAGGCTGCAGAGGAGGAGGAAGG - Intergenic
922892296 1:229071432-229071454 CGGGGAGCAGAGTTGGAGCCTGG + Intergenic
922982851 1:229842774-229842796 CAGGCTGCAGTGTAGCTGCATGG + Intergenic
923199058 1:231694243-231694265 CAGCCTGCAGCGATGGAGCAAGG + Exonic
924078540 1:240367348-240367370 CAAGCTCCAAAGTGGGAGCAGGG - Intronic
924197610 1:241624327-241624349 CAGTCTGCATGGCTGGAGCATGG - Intronic
1063696772 10:8343419-8343441 GATCCTTCAGAGTTGGAGCAAGG + Intergenic
1065304269 10:24353966-24353988 CATGCTGCAGAGCTGTAGCTGGG + Intronic
1065840999 10:29700984-29701006 CAGGCGGCAGGGCTGGAGCGTGG - Intronic
1067575156 10:47404167-47404189 CAGGCTGGGGAGCTGGAGGAAGG + Intergenic
1068238686 10:54274137-54274159 GAGGGTGGAGAGTTGGAGGAGGG + Intronic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1070897414 10:79996522-79996544 GAGGCTGCAGATGTGGAGCCTGG - Intergenic
1071622547 10:87134877-87134899 CTGGCTGGAGAGGAGGAGCAGGG + Intronic
1072252867 10:93595581-93595603 CAGGCTCAGGTGTTGGAGCAAGG + Intronic
1072280575 10:93862029-93862051 CAGCCTTCCGAGTTGGTGCAGGG - Intergenic
1073176552 10:101560651-101560673 CAGGCTGGAGCTGTGGAGCAAGG + Intergenic
1073329680 10:102661891-102661913 CAGGCTGCAGAGGTGGGGTAGGG - Intergenic
1074197661 10:111203463-111203485 CATTCTGCGGATTTGGAGCAAGG - Intergenic
1074870873 10:117575105-117575127 CAGACTGCAGAGTAGGGGCAGGG - Intergenic
1075038320 10:119087742-119087764 CAGACTACAGAGTGGGAGGAGGG - Intergenic
1076394652 10:130129758-130129780 CAGGCTGCGCAGTGGGAGAAGGG - Intergenic
1076568489 10:131414967-131414989 CAAGCTGCAGAGTTTGAGACTGG + Intergenic
1076760495 10:132603426-132603448 CAGTCTGCAGAGCTCCAGCAAGG + Intronic
1077485906 11:2838359-2838381 CAGGCTGCAGAGTGAGGCCAGGG + Intronic
1078899252 11:15626227-15626249 CTGGCTTCAAAGTTGGAGGAAGG - Intergenic
1079124362 11:17708314-17708336 CAGGGTGCACAGTAGGAGCTTGG - Intergenic
1079151756 11:17906151-17906173 GATGCTACATAGTTGGAGCAGGG + Intronic
1079420573 11:20283421-20283443 CAGGAGGCAAAGTTGGACCAGGG + Intergenic
1079879529 11:25907475-25907497 GAGGCTGGAGGGTTGGAGGAGGG + Intergenic
1081425508 11:42922036-42922058 CAGGGTGGAGGGTTGGAGGAGGG - Intergenic
1082056278 11:47819941-47819963 CAGGCTGCAGAGTTGGAGCAGGG - Intronic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1083364144 11:62131214-62131236 CAGGCTGCAGGGTGGGTGAATGG - Intronic
1084020825 11:66416847-66416869 TAGTCTGGAGATTTGGAGCAAGG - Intergenic
1084589299 11:70080843-70080865 GAGGCTGCAGCCATGGAGCAGGG + Intronic
1085321928 11:75580230-75580252 AAGGCTGCAGGGTTGGAGTGGGG + Intergenic
1087813191 11:102630820-102630842 CAGGGTGCAGAGCTGGAATATGG + Intergenic
1088783764 11:113162360-113162382 CCTGCTGCAGTGTAGGAGCAGGG + Intronic
1089621103 11:119722672-119722694 CAGGCTCCCGAGTGGGGGCAGGG + Intronic
1090836159 11:130455612-130455634 CAGGCTGCAGGGTTGGGAGAGGG + Intronic
1091021327 11:132102818-132102840 CAGCTTGCAGATTGGGAGCAAGG - Intronic
1091121656 11:133062878-133062900 CATGCAGCAGTGCTGGAGCAAGG - Intronic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1091780461 12:3211039-3211061 CAGGCTGTAAAGCTGAAGCAGGG - Intronic
1092625400 12:10321804-10321826 CTGGCTGAAGAGTTGAACCAAGG - Intergenic
1092664843 12:10784401-10784423 GAGGCTGCAGGGTTGGGGAAGGG + Intergenic
1094275031 12:28664747-28664769 CAGGATGAAGAGATGAAGCACGG + Intergenic
1095261757 12:40106002-40106024 GACGCTGCGGAGTTGGAGCCCGG + Intronic
1095952122 12:47787265-47787287 CAGGCCCCAGAGTTGGATCAGGG - Intronic
1096518898 12:52173254-52173276 TGGGCTGCAGAGTTGGAGATGGG - Intronic
1096611609 12:52805692-52805714 CAGACTGCAGAGCAGGAGCTGGG + Intergenic
1098040948 12:66353693-66353715 AAGGCTGCAGGATTGGTGCAGGG - Intronic
1098609823 12:72442680-72442702 CAGGGTGCAAAATAGGAGCAGGG - Intronic
1098786296 12:74760915-74760937 AAGGCTTCTGAGTTTGAGCATGG - Intergenic
1100280720 12:93115791-93115813 CAGCCTTCAGAGATGGTGCAGGG - Intergenic
1100401035 12:94230104-94230126 CAGGCATCAGAGATGGAGAATGG - Intronic
1101681867 12:106976170-106976192 CAGCCAGTACAGTTGGAGCAGGG - Intronic
1101876272 12:108598479-108598501 CAGGGTGCAGCGTGGGAGCTGGG + Intergenic
1102295523 12:111733669-111733691 AAGGCTGCAGAGAAGGAGCTGGG + Intronic
1102405158 12:112667018-112667040 GAGGCTGCAGAGGTGAAGTAAGG - Intronic
1102739598 12:115195453-115195475 CAGCCTGCAGAGTTGTAGTGAGG - Intergenic
1102773565 12:115499508-115499530 CAGGCTGGAGGGTGGGGGCAGGG + Intergenic
1104629736 12:130390521-130390543 CAGGTGGCTGAATTGGAGCAGGG - Intergenic
1104951939 12:132445092-132445114 AAGGCTGCAGAGTAGGAACTAGG - Intergenic
1105212791 13:18267178-18267200 CATGCTGCAGACTTGGGGCATGG - Intergenic
1105469333 13:20678319-20678341 TAGGGTGCAGAGTGGGACCAGGG + Intronic
1106864048 13:33944079-33944101 CAGGCTGCAGTGTATGAGAATGG - Intronic
1111326956 13:86710883-86710905 CAGGCAGCAGTGTTGGAGAGTGG - Intergenic
1111493666 13:89019738-89019760 GAGGGTGGAGGGTTGGAGCAGGG - Intergenic
1112225123 13:97532114-97532136 CAGCCTGCAAAGTTGGTGCCAGG - Intergenic
1113432097 13:110260244-110260266 CAGGCTAGAGAGCTTGAGCAGGG + Intronic
1113720529 13:112552801-112552823 GTGGCTGCTGAGTAGGAGCATGG - Intronic
1113720548 13:112552890-112552912 GTGGCTGCTGAGTAGGAGCATGG - Intronic
1115643672 14:35352087-35352109 CAGGCTGCAGAGTGAGCTCATGG + Intergenic
1116345587 14:43789060-43789082 GAGGCTGCAGAGTTAGTGCAAGG + Intergenic
1117049622 14:51847175-51847197 CAGGCTGCAGACTGGGAGGGTGG + Intronic
1117981405 14:61345523-61345545 TCTGCTGCAGTGTTGGAGCAGGG + Intronic
1118725834 14:68628530-68628552 CAGGCCGGGGATTTGGAGCAGGG - Intronic
1118851022 14:69583642-69583664 CAGGCAGAAGAGAGGGAGCAGGG - Intergenic
1119575740 14:75720181-75720203 CATGTTGCTGAGTTGGAGAATGG + Intronic
1119706814 14:76788264-76788286 CAGCCTGCAGAACTGGGGCAAGG - Exonic
1119712025 14:76829250-76829272 CAGGCAGCAGAGATGGAGGAAGG + Intronic
1119738578 14:76999508-76999530 CTGGCTGCATAGTTGGGGAATGG + Intergenic
1120782052 14:88494184-88494206 CAGGCTGCAATGAGGGAGCAAGG + Intronic
1120935156 14:89888490-89888512 CAGGAACAAGAGTTGGAGCAGGG + Intronic
1121013888 14:90536738-90536760 CAGGCCGCAGCGTGGGAGCTGGG - Exonic
1121940435 14:98065004-98065026 CAGCCTGCAGAGCTGGAGAAAGG + Intergenic
1122019587 14:98826588-98826610 CAGGCAGCAGAGTTGGCACCTGG + Intergenic
1122111114 14:99503196-99503218 CAGGCAGCAGGGCTGGAGCCGGG - Exonic
1122128018 14:99589720-99589742 CAGGCTGCTGAGAGGAAGCAGGG + Intronic
1122694851 14:103547542-103547564 CAGGCTGGACGGCTGGAGCAAGG - Intergenic
1123045929 14:105514584-105514606 GAGGGTGGAGAGTTGGAGGAGGG + Intergenic
1123119756 14:105911205-105911227 CAGGCTGCAGGGAAGGACCAGGG - Intergenic
1124404189 15:29379533-29379555 CCTGCCGCATAGTTGGAGCAGGG - Intronic
1124560500 15:30769661-30769683 CAGGCTGCACAGTTTTTGCAGGG - Intronic
1125128493 15:36253102-36253124 CAGGCTCCAGATATGGAGGAAGG + Intergenic
1125356960 15:38826447-38826469 CAGGCTCCAATTTTGGAGCATGG - Intergenic
1126332771 15:47551331-47551353 CAGGTTGCAGAGTTGGGGGAAGG + Intronic
1126974373 15:54158431-54158453 CAGGCTACTGAGGTGGAGAATGG - Intronic
1127578394 15:60314480-60314502 TAGGCCCCAGTGTTGGAGCAGGG - Intergenic
1128866596 15:71119300-71119322 CAGGCTCCAGGGTGGAAGCAGGG + Intronic
1129423671 15:75450591-75450613 CAGCCAGGAGAGTGGGAGCATGG - Intronic
1129731693 15:77936037-77936059 CAGGAGGCAGAGGTTGAGCAGGG + Intergenic
1130171828 15:81523011-81523033 CAGGTTCCAGACTTGGAGCTGGG - Intergenic
1130284143 15:82541308-82541330 CAGGGAGCAGAGTTGGAAGAAGG - Intronic
1130433112 15:83868968-83868990 CGGGATGCAGAATTGGGGCAAGG - Intronic
1130603615 15:85295440-85295462 CAGGCTGCTGATCTGCAGCAGGG - Intergenic
1130897298 15:88181450-88181472 CAGGCTCAGGAGTGGGAGCAGGG - Intronic
1131030648 15:89183736-89183758 CAGGCTGCAGAGGTAGGGAAGGG - Intronic
1131266822 15:90920414-90920436 CAGGCTGCAGAATGGCAGGAAGG + Exonic
1131826067 15:96323133-96323155 CAGTCTCCAGAGTAGGAGAAAGG - Intergenic
1132275642 15:100561074-100561096 AAGGCAGTAGAGTTGAAGCATGG - Intronic
1132313027 15:100870912-100870934 CAGGTTGCAGAGGTGAGGCAAGG - Intergenic
1132361588 15:101220588-101220610 GCAGCTGCAGAGTTGCAGCAGGG - Intronic
1132498348 16:274213-274235 CCGGCTGCAGAGCTGGACTATGG - Exonic
1132857403 16:2052854-2052876 CAGGCAGCAGAGGTCGGGCAGGG + Intronic
1133341317 16:5038207-5038229 CAGGCTGTATAGTAGGAGCCAGG + Intronic
1134454839 16:14387417-14387439 CAGGCTGCAGTGTAGTGGCACGG - Intergenic
1135182799 16:20290232-20290254 CAGGCTGCAGTGCAGCAGCAGGG + Intergenic
1135481069 16:22821039-22821061 CTGGCTACAGAGATGAAGCAGGG - Intronic
1135995620 16:27245529-27245551 CAGGCTGCAGACATGAAGAACGG + Intronic
1136065452 16:27755323-27755345 CAGAAGGCAGAGATGGAGCAGGG - Intronic
1136366555 16:29811818-29811840 GAGGCTGCAGAGGAGGAGCAGGG - Intronic
1136410778 16:30075891-30075913 CAGGCTGGAGAAGTGGTGCAGGG + Intergenic
1137554378 16:49461440-49461462 CAGGGTGCAGGGTAGGAGAAGGG + Intergenic
1138180581 16:54937931-54937953 CGGGGTCCAGAGTTGGAGCGTGG - Intergenic
1139116816 16:63964152-63964174 CAGGCTGCAAAATTTGAGCATGG + Intergenic
1141207307 16:81942787-81942809 CAGCCTGCAGAGGAGGAACACGG - Intronic
1142129274 16:88425379-88425401 CAGGCTGCAGGGTTGGGGGTAGG - Intergenic
1142272969 16:89100651-89100673 CAGGCGGCCGAGCTGGAGAAAGG - Exonic
1142504310 17:353082-353104 CAGGCAGCAGTGGTGGTGCACGG + Intronic
1142696877 17:1638750-1638772 CAGGCCACAGGGTGGGAGCAGGG - Intronic
1142758548 17:2029845-2029867 CGGCCTGCAGAGTTCGTGCAGGG + Intergenic
1143410197 17:6704053-6704075 CAGCCTGCAGAGGAGGGGCAGGG + Exonic
1143568886 17:7741983-7742005 CAGGCTGCAGAGGAGGAATAGGG + Intronic
1143572758 17:7770684-7770706 CAGGCTGCAGAGTGGGACCAAGG + Intronic
1143739553 17:8942336-8942358 GAGGCTGCAGGGTGGGGGCAGGG - Intronic
1144783952 17:17821684-17821706 CAGGCTGCACAGTTGGTCCTTGG - Intronic
1144788396 17:17844348-17844370 CAGCCCGGAGAGTTGGGGCAAGG - Intronic
1144874796 17:18391836-18391858 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1145003378 17:19321125-19321147 GAGGCTGCAGAGTGGGGGCTGGG + Intronic
1145157429 17:20552585-20552607 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145799841 17:27675932-27675954 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1145903070 17:28500365-28500387 GAGGCTGCAGGGTTGGAGACTGG - Intronic
1146159363 17:30551666-30551688 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1146508711 17:33427545-33427567 GAGGATGGAGAGTTGGAGGATGG - Intronic
1146845216 17:36178148-36178170 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146873432 17:36389991-36390013 CAGGGGGCAGAGGAGGAGCATGG + Intronic
1146880791 17:36441079-36441101 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1147065958 17:37922882-37922904 CAGGGGGCAGAGGAGGAGCATGG - Intergenic
1147538138 17:41334188-41334210 CAGGGGGCAGAGGAGGAGCATGG + Intergenic
1148535566 17:48435733-48435755 TAGAATTCAGAGTTGGAGCAGGG + Intergenic
1149490093 17:57078367-57078389 CAGGTTTCAGAGAGGGAGCATGG - Intergenic
1151237812 17:72734321-72734343 CAGGCTGCAGAGAAGGAACGAGG - Intronic
1151537862 17:74748875-74748897 CAGGCAGCAGAGCCGGGGCAGGG - Exonic
1151578382 17:74963989-74964011 CAGGCTGCAGAGGAGGGTCAGGG + Intronic
1151699506 17:75735843-75735865 CAGGCTGCAGAGTGGAAGGTAGG + Intronic
1151764336 17:76124431-76124453 CAGGCTGCAGGGGTGAAGCAGGG + Intergenic
1151935799 17:77260113-77260135 CAGGCTGGAGTGTGGTAGCATGG + Intergenic
1152100562 17:78299425-78299447 CAGCCTGCAGGGTAAGAGCACGG - Intergenic
1152663937 17:81556501-81556523 CAGACTGCACAGGTGCAGCAAGG - Intergenic
1155527893 18:26735833-26735855 CAGGCAAGAGAGTAGGAGCAGGG - Intergenic
1155839448 18:30628606-30628628 CAGGCTGCAGGGCTGGACCTCGG + Intergenic
1155903297 18:31418206-31418228 GAGGGTGCAGAGTGGGAGAAGGG + Intergenic
1157108157 18:44794096-44794118 CAGCCTGCAGAGTATGAACAGGG + Intronic
1157548071 18:48561554-48561576 GGGGCTGCAGAGATGGATCAGGG + Intronic
1159231364 18:65611257-65611279 CAGGCGGTAGTTTTGGAGCAAGG - Intergenic
1161009464 19:1953313-1953335 GAGGCTGCTGAGGTGGCGCAGGG + Intronic
1161063588 19:2227110-2227132 CAGGCGGCACAGTTGGAGGTAGG + Exonic
1161208286 19:3053600-3053622 CAGGCTGCAGGGGAGGAGGAGGG + Exonic
1161452611 19:4354884-4354906 CTGGCTCCAGTGTTGGGGCAGGG + Intronic
1162034505 19:7931867-7931889 CAGGCTGCTGTTTTGGGGCATGG + Intronic
1162530025 19:11230618-11230640 GAGGATGCAGAGGTGGAGGAGGG + Intronic
1162536118 19:11263566-11263588 CATGCTGTAGACTGGGAGCACGG - Intergenic
1162598671 19:11649727-11649749 CAGGCTGGAGTGTAGGGGCATGG + Intergenic
1162902121 19:13801313-13801335 CAGGCTGCTGAGCTGGGGAATGG + Intronic
1163440871 19:17322052-17322074 CAGGGGCCAGAGTGGGAGCAGGG + Exonic
1165092429 19:33394131-33394153 CAGCCTGCAAAGTTGGCACATGG + Intronic
1165093798 19:33399967-33399989 CAGGCGGCAGAGCTGGGGCTGGG + Intronic
1166827909 19:45620983-45621005 GAGGCAGCACAGTTGGAGCAGGG + Intronic
1166932168 19:46308129-46308151 CAGGCTCATGAATTGGAGCAGGG + Intronic
1167060553 19:47142635-47142657 GAGGCTGAAAAGTTGGAACAAGG - Intronic
1168548242 19:57271694-57271716 CAGGCTGCAGTACTGTAGCAGGG - Intergenic
1168604316 19:57746441-57746463 CAGGCCGCTGAGATGGAGCTGGG + Intronic
925358194 2:3257583-3257605 CAGGCAGCAAAGACGGAGCAGGG + Intronic
925827425 2:7863130-7863152 CAGGCTGGAGTGCTGGGGCATGG - Intergenic
926106942 2:10158509-10158531 CAGGCAGCAGAGGTGGCTCAGGG - Intronic
926576658 2:14589906-14589928 CAGACTGAAAAGTTGGAACAGGG + Intergenic
926588747 2:14717730-14717752 CAGGCAGCAGAGGGGGAGAAGGG - Intergenic
926717405 2:15935840-15935862 CAGCCTGGGGAGTGGGAGCAGGG - Intergenic
926853067 2:17222167-17222189 AAGGCTGCAGAGGTTGAGCAAGG - Intergenic
927203916 2:20595082-20595104 TAGCCTGCACAGCTGGAGCAGGG + Intronic
927606156 2:24489314-24489336 CGGGCTGCAGAGTGGGAGATTGG + Intergenic
928320971 2:30282554-30282576 CAGGTGACAGAGATGGAGCAAGG + Intronic
931839352 2:66132167-66132189 CAGGAGGCAGACCTGGAGCATGG + Intergenic
932667766 2:73710723-73710745 CAGGGTGGAGAGTGGGAGGAGGG + Intergenic
933791615 2:85888325-85888347 CTGGCTGCAGAGAGGGTGCAGGG + Intronic
936288766 2:111201480-111201502 CAGGCTGCCAAGTTGGGGCTGGG + Intergenic
936511976 2:113155916-113155938 CAGACTGCTGATTTAGAGCATGG + Intergenic
937201982 2:120209748-120209770 CAGGCTGCAGAGTGGGAGATGGG + Intergenic
937368932 2:121284771-121284793 CAGGCGGCAGAGAGGGTGCAGGG - Intronic
938015856 2:127866680-127866702 CTGGGGGCACAGTTGGAGCAGGG - Intronic
940294061 2:152104283-152104305 CAGGTTGAATAGGTGGAGCATGG + Intergenic
941352245 2:164451077-164451099 CAGGCTGCAGTGCAGTAGCATGG - Intergenic
942930463 2:181486432-181486454 CTGGCTGCAGAGCTGGAGCAGGG + Intronic
944356544 2:198796025-198796047 CAGGCTTCAGATTAGGAACAAGG - Intergenic
944447378 2:199805196-199805218 GAGGCTGCAGGGGTGGAGGATGG - Intronic
944447765 2:199808575-199808597 CAGGCTGCTGGCTTTGAGCAAGG - Intronic
944912875 2:204327463-204327485 CTGGCTGCAGACCTGGAGAAAGG + Intergenic
946059061 2:216926210-216926232 CAGTGTGCAGAGTTGGAGGAAGG + Intergenic
947855576 2:233321594-233321616 CAGGCTGGGGGGTTGGAGGATGG + Intronic
947912675 2:233811699-233811721 GAGGCAGCAGAGTGGGAGCAGGG - Intronic
948830083 2:240594402-240594424 GGGGCTGCAGAGCTGGGGCACGG + Intronic
948949624 2:241240541-241240563 CAGGTAGAAGAGTGGGAGCATGG - Intronic
1168827516 20:823546-823568 CAGGCTGCAGTGTTGGGGAGGGG + Intergenic
1168831641 20:848352-848374 AAGGCTGCAGGGTTGGGGGAGGG - Intronic
1168887136 20:1267368-1267390 CAGTCTGCAGGGTTGGGGAAGGG - Intronic
1169454367 20:5739122-5739144 CAGGCTGGAGTGTTGTGGCATGG + Intergenic
1169464800 20:5827589-5827611 CAGGCTGCAGACTGGCAGAATGG - Intronic
1170358308 20:15517184-15517206 GAGGCTGGAGGGTAGGAGCAAGG - Intronic
1170979220 20:21195554-21195576 CAGGATGCAAACCTGGAGCAAGG - Intronic
1171131071 20:22653233-22653255 CACCCTGCAGGGGTGGAGCAGGG + Intergenic
1171213507 20:23335045-23335067 AAACCTGCAGAGTTGAAGCAAGG - Intergenic
1171316360 20:24199242-24199264 CAGGCTCCAGTGTTGCAGCACGG - Intergenic
1171943465 20:31353562-31353584 CAGGCAGGAGAGTTGGGGAAAGG - Intergenic
1172409542 20:34711105-34711127 CAGGCTTCAGCCTGGGAGCAGGG - Exonic
1172414371 20:34752217-34752239 CTGCCTTCATAGTTGGAGCATGG - Intronic
1172557149 20:35852213-35852235 CAGGCTGCCTCTTTGGAGCAGGG + Intronic
1172690218 20:36784740-36784762 CGGGCAGCAGAGCTGGGGCAGGG + Exonic
1172776160 20:37408295-37408317 CAGGCGGGAGGGGTGGAGCAGGG - Intergenic
1173191897 20:40883233-40883255 CAGGCTGCAGTCTTGGGGGAAGG - Intergenic
1173465225 20:43275560-43275582 CAGGTTTCAGGGTTGGAACATGG + Intergenic
1174157746 20:48527772-48527794 AAGGCTGCAGAGGTGGACCCAGG + Intergenic
1174255192 20:49249229-49249251 CTGGCAGCAGAGCCGGAGCATGG + Exonic
1174400636 20:50273975-50273997 CAGCCAGCAGGGCTGGAGCAGGG - Intergenic
1175593741 20:60213823-60213845 CAGGCTGCAGAGTTAGGATAAGG - Intergenic
1175949964 20:62578165-62578187 CAGGCTGTGGAGTTGGGGCCGGG - Intergenic
1177462329 21:21429286-21429308 CAGGGTGCACAGTTGGTGAATGG + Intronic
1179231101 21:39504484-39504506 CAGACTGCAGAGGTGGTGCGTGG - Intronic
1180017611 21:45097562-45097584 CAGGCAGGAGTGATGGAGCATGG + Intronic
1180577313 22:16790551-16790573 GAGGCTACAGAGTGGGAGGAAGG + Intronic
1181036905 22:20174149-20174171 CAGGCTGCAGGGCTTAAGCAGGG - Intergenic
1181201797 22:21221837-21221859 CATGCTGCAGACTTGGGGCATGG - Intronic
1181438412 22:22923385-22923407 GAGGCTCCAGGCTTGGAGCAGGG - Intergenic
1182159170 22:28104627-28104649 AAGGCTGCACAGTTGGACCTTGG - Intronic
1182519393 22:30876763-30876785 AAGCCTGCAGAGTAGGGGCAGGG - Intronic
1183279149 22:36922904-36922926 CAGGCTGCACAGTCGGTCCAGGG + Intronic
1184335660 22:43851680-43851702 CAGGCTGCACACTTGGAGGGTGG - Intronic
1184726164 22:46347871-46347893 AAGGCTGCAGTGATGGGGCAGGG + Intronic
1184860938 22:47173066-47173088 GAGGCTGCAAAGCTGCAGCAGGG + Intronic
1184891259 22:47380889-47380911 CAGGATGCTGACCTGGAGCAAGG - Intergenic
1203225115 22_KI270731v1_random:73591-73613 CATGCTGCAGACTTGGGGCATGG + Intergenic
1203265713 22_KI270734v1_random:13193-13215 CATGCTGCAGACTTGGGGCATGG - Intergenic
951464875 3:22990680-22990702 CCGGCTGCAGAGTGGGATGAGGG - Intergenic
952279298 3:31907936-31907958 CAGGCTACAGTGTTGGAGGCTGG + Intronic
952686598 3:36156945-36156967 AAGGCTGAAGAGTTGAAGCATGG + Intergenic
953382855 3:42487110-42487132 CAGGCTGCAGGAAGGGAGCAGGG - Intergenic
954213687 3:49112359-49112381 CAGGCTGCACACTTGGAGATGGG + Exonic
954445227 3:50542751-50542773 CAGGATGCTGACCTGGAGCAAGG - Intergenic
955977752 3:64494385-64494407 CAGGCTGTAGAGATGGACCAGGG - Intergenic
957280278 3:78142726-78142748 CTGGCAGCAGAGTTGGCCCAGGG - Intergenic
958908368 3:99966222-99966244 CAGGCTGCAGAGGCTGGGCATGG + Intronic
959246323 3:103874113-103874135 CAGGCTGCAGTATTGGTGCCTGG + Intergenic
959246349 3:103874347-103874369 CAGGCTGCAGTATTGGTGCCTGG + Intergenic
959734043 3:109637363-109637385 GAGGCTGAAGAGTGGGAGGAGGG - Intergenic
960361998 3:116724092-116724114 CAGGCTGCAAAGGCAGAGCAGGG - Intronic
960955254 3:123026954-123026976 CAGGCGGCGGCGGTGGAGCAGGG + Intronic
963162138 3:142161730-142161752 AAGGCTGCAGAGGTGGGGCTGGG + Intergenic
963228705 3:142888752-142888774 GAGGCTGCAGGGGTGGAGGAAGG + Intronic
964597206 3:158447042-158447064 CAGACTGAAGAGTTGTATCATGG - Intronic
967087451 3:186108347-186108369 CAGCCTGCTGGGTGGGAGCAGGG + Intronic
967873166 3:194249052-194249074 CAGGCGGAAGGGTTGGAGCTTGG + Intergenic
969277192 4:6143925-6143947 CAGTCTCCAGGGCTGGAGCAGGG + Intronic
969349956 4:6592685-6592707 GAGGCTGCACAGTGTGAGCAAGG + Intronic
969440276 4:7212862-7212884 CAGGGTGAGGAGTTGGAGGAGGG + Intronic
969507810 4:7598981-7599003 CAGGCGGCAGGGTTGAAGCAAGG + Intronic
969883316 4:10193911-10193933 CATCTTGCAGAGTTGGAGAAAGG + Intergenic
970402571 4:15731867-15731889 GAGGCTGCAGGGCTGGAGGAGGG - Exonic
975204063 4:71624170-71624192 CAGGCTGTGGCGTTGGAGGATGG - Intergenic
975699368 4:77048233-77048255 CAGGCTGCAAAGGTGGACAAGGG + Exonic
976496895 4:85740262-85740284 CAGGCTGCAGTGCTGGAGTGCGG + Intronic
976668179 4:87622722-87622744 CATGCTGCAGGGTTTAAGCAAGG - Intergenic
976947945 4:90793325-90793347 GAGGCTGCAGGGTGGGAGGAGGG - Intronic
977651562 4:99475820-99475842 CAGGGTGGAGAGTGGGAGGAAGG - Intergenic
978333846 4:107644872-107644894 CATGCTGCAGTGTTGGAGGAAGG - Exonic
979480157 4:121207584-121207606 AAGCCTGCAGATTTGGGGCATGG + Intronic
980583949 4:134789002-134789024 CTGGCAGCAGTGTTGGTGCAGGG + Intergenic
981538601 4:145825267-145825289 AAGCCTGCAGAGCTGGAGGAAGG + Intronic
981878291 4:149576294-149576316 CAGGGTGGAGAGTGGGAGGAGGG - Intergenic
983709147 4:170693123-170693145 CAGGCTCCAGAGATGGAAGAGGG - Intergenic
984868849 4:184309703-184309725 CTGGCCGCAGAGGTGGAGGACGG + Intergenic
985795911 5:1962015-1962037 CAGGACGCAGAGGTGCAGCAGGG - Intergenic
986016928 5:3765734-3765756 CAGGCTCCATAGTTAGAGCTGGG - Intergenic
987089587 5:14498949-14498971 CCAGCTTCTGAGTTGGAGCAGGG + Intronic
987394007 5:17403897-17403919 CAGACTGCACAGATGGAACATGG + Intergenic
988711095 5:33775718-33775740 CAGGCTGCAGGCTTGGGGAAGGG - Intronic
988968268 5:36441380-36441402 CAGACTGCAGACTGGAAGCAGGG - Intergenic
990295825 5:54400478-54400500 CAGGCTGTGGAGTTGGACCTGGG + Intergenic
990316173 5:54585245-54585267 CAGGCTGGAGTGCAGGAGCATGG - Intergenic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
994993451 5:107028899-107028921 CAGGAGGGAGAGGTGGAGCAGGG - Intergenic
997368723 5:133342321-133342343 CAGGTTGCAGAGAAGGGGCAGGG + Intronic
997406561 5:133653473-133653495 CAGGGGCCTGAGTTGGAGCAGGG - Intergenic
997420592 5:133763830-133763852 CAGTCAGCAGAGGTGGAGAAGGG - Intergenic
997670815 5:135670438-135670460 CAGAGTGGAGGGTTGGAGCATGG + Intergenic
1000251381 5:159498855-159498877 CAGGCTGCAGAGCTGGACATTGG + Intergenic
1001329255 5:170750850-170750872 CAGGAGGCAGAGTAGTAGCATGG - Intergenic
1001955419 5:175845368-175845390 GTGGCTGCAGTGTGGGAGCAGGG - Intronic
1002527606 5:179823631-179823653 CAGGCAGCAGAGCAGCAGCAAGG - Intronic
1002880827 6:1250996-1251018 CAGGCTGCAGGGTGGGTGCTTGG - Intergenic
1005160506 6:22856259-22856281 GTGGCTGCAGAGGTGGAACATGG + Intergenic
1005704314 6:28436223-28436245 CAGACTGCAGAGATGCAGGAAGG - Exonic
1006083087 6:31578737-31578759 CAGGTTGCAGAGTTAGGACAGGG - Intergenic
1006670262 6:35725969-35725991 CAGGGTACAGAGTGTGAGCAGGG - Intronic
1006673161 6:35742706-35742728 CAGGCTGCAGAGATCCAGAAGGG - Intronic
1007445491 6:41902331-41902353 CAGGAGGCAGTGTGGGAGCAGGG + Intergenic
1009940504 6:70283074-70283096 CAGGCTGCAGAGCCGGGCCAAGG - Intronic
1011632479 6:89340475-89340497 CTGGCAGTAGAGTTGGAGCAGGG - Intronic
1011807171 6:91085216-91085238 AAGACTTCAGAGTTGAAGCATGG - Intergenic
1013311898 6:108902371-108902393 CAGGCTGAAGAGTTTGTGGAAGG + Intronic
1013974719 6:116064164-116064186 GAGGATGCAGAGGTGCAGCAGGG - Intergenic
1018718544 6:166554647-166554669 CAGGCTGCAGTGGAGGAGGATGG - Intronic
1018798877 6:167207596-167207618 AGGGCTGCAGAGTTGGGGGAGGG + Intergenic
1019462080 7:1165409-1165431 CTGACTGCAGGGTTGGAGCAGGG - Intergenic
1019509926 7:1412684-1412706 GGGGCTGCAGGGTTGGAGAAGGG + Intergenic
1021164923 7:17325793-17325815 GAGGCTGCAGGGTGGGAGGAGGG + Intronic
1021383243 7:19994654-19994676 GAGGATGAAGAGTTGGAGGAGGG - Intergenic
1021773086 7:24024757-24024779 CAGGCTGAACAGATGGAACACGG - Intergenic
1022502202 7:30888845-30888867 CAGGCTGTTGAGTTTGAGCTTGG - Intronic
1023527106 7:41116330-41116352 GAGACTGTAGAGCTGGAGCAGGG + Intergenic
1024007065 7:45232358-45232380 CATGCTGCAGATTTTGAACAAGG + Intergenic
1027231935 7:76277787-76277809 CAAACTCCAGAGTTGGAGCCAGG + Intronic
1028249357 7:88522781-88522803 CAGGCTGTGGAGAAGGAGCAGGG + Intergenic
1029647919 7:101869733-101869755 CAGGCTGCAGAGGAAGCGCAGGG + Intronic
1029750082 7:102538349-102538371 CAGGCTGCAGAGCCTGAGCTGGG - Intronic
1029768033 7:102637457-102637479 CAGGCTGCAGAGCCTGAGCTGGG - Exonic
1032201320 7:129825153-129825175 CGGGCTGCAGGGCTGGAGCCTGG - Intergenic
1032550420 7:132779461-132779483 CAGGCTGCAGAGCAGGGGCTGGG - Intergenic
1033274198 7:139958853-139958875 TAGGCTTCAGAGCTGGGGCAGGG - Intronic
1034007974 7:147495645-147495667 CAGGGTGCAGATTTGAATCATGG + Intronic
1034356788 7:150457022-150457044 CAGAGTGCAGAGTGGGATCAGGG + Intronic
1034590107 7:152131488-152131510 CAGGCTGCAGAGCGTGAGGATGG + Intergenic
1035754501 8:2021736-2021758 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754507 8:2021776-2021798 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1035754513 8:2021816-2021838 CCGGCTGCACAGCTGGAGCTGGG - Intergenic
1037498445 8:19462966-19462988 CAGGGTGGAGAGTAGGAGGAGGG - Intronic
1037608879 8:20459659-20459681 CAACCTGCAGAGTTGGGGCCTGG - Intergenic
1041136986 8:54769363-54769385 CAGGTTTCAGATTTTGAGCATGG - Intergenic
1041209856 8:55538211-55538233 GAGGCTGGAGAGATGGACCAGGG - Exonic
1042524157 8:69747104-69747126 CAGGAGGCAGAATCGGAGCAAGG - Intronic
1043820306 8:84855137-84855159 GAGACTGCAAGGTTGGAGCAAGG - Intronic
1044564953 8:93652809-93652831 CAGGCAGGAGAGTTTGTGCAGGG - Intergenic
1046779094 8:118196047-118196069 CAGGCTGCAGAGCCAGAGAAGGG - Intronic
1047433284 8:124812028-124812050 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1048008525 8:130438439-130438461 CTGGCTGCAGCTTTGGAACAAGG + Intronic
1048054254 8:130848350-130848372 CAGGCTGCAGAGAAGCAGCCAGG - Intronic
1048445427 8:134489452-134489474 GAGGCTGCAGAGGCCGAGCAAGG - Intronic
1048848817 8:138624758-138624780 CAGGCTGCAGAGTTACAGACAGG + Intronic
1048944736 8:139433965-139433987 CTGGCTGGTGAGTTGGAACACGG + Intergenic
1049020234 8:139951632-139951654 CAAGCTGCAGAGTTAGAGGCTGG + Intronic
1049166596 8:141129432-141129454 GAGGGTGCAGAGATGGAGGAAGG - Intronic
1049437754 8:142595543-142595565 CAGGCTGCAGCCTTTGACCAGGG - Intergenic
1050681052 9:8111927-8111949 CAGCCTACAGAGTTGTAACATGG - Intergenic
1050795955 9:9541790-9541812 CTGGCTGAAGAGTGGCAGCAGGG + Intronic
1051622966 9:19070886-19070908 CAGACTGCAGAGTGGGAAGAAGG + Intronic
1052218919 9:25997017-25997039 CAGCCTGCACAGGTGGGGCATGG - Intergenic
1052934886 9:34084812-34084834 CTGGCTGGAAAGTGGGAGCAAGG + Intergenic
1055131875 9:72784939-72784961 GAGGGTGGAGAGTGGGAGCAAGG + Intronic
1055238134 9:74149163-74149185 CAGGCAGCAGCGGAGGAGCAAGG - Intergenic
1056421701 9:86434550-86434572 GTGGCTGCAGAGTGGGAGCTGGG + Intergenic
1056648631 9:88437451-88437473 CAGGCTGGAGTGTGGTAGCATGG - Intronic
1056778733 9:89533508-89533530 CAGGCTGAGGACTTGGTGCAGGG - Intergenic
1056863863 9:90212376-90212398 CAGGCTGGAGTGTTGTGGCATGG - Intergenic
1057212950 9:93210404-93210426 CAGGCTGTGGAGTTGGGTCAGGG + Intronic
1057758771 9:97856144-97856166 GAGGCTGCTGAGGTGTAGCAGGG - Exonic
1059422830 9:114203368-114203390 GGGGCTACAAAGTTGGAGCAGGG - Intronic
1060803980 9:126563523-126563545 CAGGATGCAGAAGTGGAGGACGG + Intergenic
1061400454 9:130365504-130365526 CAAGCTGCCCACTTGGAGCACGG - Intronic
1061549586 9:131325657-131325679 TTGGCTGCAGAGTTGGAGCTGGG + Intergenic
1061791812 9:133063101-133063123 CAGGCAGCAGAGGTGGAGACAGG - Intronic
1061795487 9:133083667-133083689 CAGGCAGCAGAGGTGGAGACAGG - Intronic
1062065209 9:134523077-134523099 CACGCTGCAGAGAGGGAGCCGGG - Intergenic
1062343547 9:136104338-136104360 CAGGCTGCAGGGGTGGAGGGGGG - Intergenic
1062512937 9:136917407-136917429 GAGTCTGCAGGGGTGGAGCAGGG - Intronic
1062548923 9:137077236-137077258 CAGGCTGGAGAGATGGGGCTGGG + Intergenic
1062630653 9:137461706-137461728 GAGGCTGCAGAGAGGGCGCAGGG - Intronic
1185797606 X:2980384-2980406 CAGGCAGCAGAGCTTGTGCAGGG - Intergenic
1186300289 X:8193372-8193394 CAGGGTGCAGGGTGGGAGTAGGG - Intergenic
1186522067 X:10214720-10214742 CAGGCTGTTGAGTTGGGGGAGGG + Intronic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1187539882 X:20182415-20182437 CAGGCTGAAGCCTTGGCGCATGG - Intronic
1192251283 X:69416258-69416280 GAGGGTGCAGAGTGGGAGGAGGG - Intergenic
1192366816 X:70480606-70480628 CAGGCTGCAGACTGGGAGCAAGG - Intronic
1192448086 X:71225092-71225114 CAGGCAGATAAGTTGGAGCAGGG + Exonic
1194014726 X:88605112-88605134 CAGCCTGCACACTTGGAGGAAGG + Intergenic
1195037960 X:100987348-100987370 AAGGCTGCAGACCTGGAGCCTGG - Intronic
1195721671 X:107874494-107874516 CAGGCTGCTGGGCTGGACCAGGG + Intronic
1197461032 X:126741233-126741255 CAGGCTGCAGGGATGGGGGACGG + Intergenic
1198782684 X:140254893-140254915 CAGGGTGGATAGTTTGAGCAGGG + Intergenic
1199964000 X:152803285-152803307 GAGGCTGGAGAGTGGGAGGAGGG - Intergenic
1200316026 X:155134181-155134203 AAAGCTGCAGAGTTTGGGCAGGG + Intronic
1201866022 Y:18655952-18655974 AAGTCTGCAGACTTGGAGCATGG + Intergenic