ID: 1082056410

View in Genome Browser
Species Human (GRCh38)
Location 11:47821068-47821090
Sequence TAGTATCCTAAGGAAGTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 96}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082056407_1082056410 26 Left 1082056407 11:47821019-47821041 CCAATCTATTTCTCATCTCATGA 0: 1
1: 0
2: 0
3: 26
4: 276
Right 1082056410 11:47821068-47821090 TAGTATCCTAAGGAAGTTGCAGG 0: 1
1: 0
2: 1
3: 4
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082056410 Original CRISPR TAGTATCCTAAGGAAGTTGC AGG Intronic
900810143 1:4795710-4795732 TTGTTCCCTAAGGAAGCTGCTGG - Intergenic
901518582 1:9766112-9766134 TAGAATCCAAAAGAAGTTTCAGG - Intronic
905726770 1:40258654-40258676 AAGGATCCCAAGGAAGCTGCAGG - Intronic
907998548 1:59657393-59657415 AGGTCTCCTAGGGAAGTTGCTGG - Intronic
909701988 1:78535263-78535285 TTGTATCATACGGAATTTGCAGG + Intronic
910050753 1:82971338-82971360 TAGAATCTTAATAAAGTTGCTGG - Intergenic
911371493 1:96999830-96999852 TAGTATTCTAATGAAGATGGTGG + Intergenic
916200949 1:162271239-162271261 TAGTATTCTAAGGATCATGCTGG - Intronic
916200967 1:162271294-162271316 TAGTATCCCAAGGATCATGCTGG - Intronic
916889055 1:169098668-169098690 TAGCATCCTAAGCAAATTTCAGG + Intergenic
918312203 1:183292900-183292922 TGGTATCCCAAGGATGTTGTGGG - Intronic
918558978 1:185841682-185841704 TAGTATCATATGGTAGATGCTGG + Intronic
920303895 1:205006652-205006674 TTGTATCCACAGGAAGTGGCAGG + Intronic
920725286 1:208429139-208429161 TAGTATACTTAGGAGGTTGTGGG - Intergenic
921579939 1:216884482-216884504 GAGAAGCCTAAGGAAGTTTCGGG - Intronic
921911827 1:220557707-220557729 TAATATGCAAAAGAAGTTGCAGG + Intronic
1066284566 10:33952039-33952061 GAGTATACTAAGGAAGATCCTGG + Intergenic
1081300695 11:41447479-41447501 TAGAATCCCATGGAAGTTGGTGG + Intronic
1082056410 11:47821068-47821090 TAGTATCCTAAGGAAGTTGCAGG + Intronic
1084794195 11:71493656-71493678 TTGTGACCTAAGGAAGTTGGAGG - Intronic
1088190572 11:107223657-107223679 CAGAATCCTCAGGAAGTAGCTGG + Intergenic
1088732054 11:112692289-112692311 TACTATCCTAAGAAAGAAGCTGG + Intergenic
1088732060 11:112692364-112692386 TAGTATCCTAAGAAGGAAGCTGG - Intergenic
1098875442 12:75861717-75861739 TAGTACCCTAAGCAGGTAGCTGG - Intergenic
1099420139 12:82447615-82447637 TAGTTTCCTGTGGGAGTTGCGGG + Intronic
1101623856 12:106419108-106419130 CAGTTTCCACAGGAAGTTGCTGG + Intronic
1104522505 12:129488312-129488334 AAGCATCCAAAGGAAGCTGCAGG - Intronic
1105575576 13:21648315-21648337 TAGCATCCAAAGGAAATTCCAGG - Intergenic
1109595159 13:64543264-64543286 TAGTCTCTTAAGAAAGCTGCAGG + Intergenic
1109935857 13:69283284-69283306 TTATATTCTAAGGAAGATGCAGG - Intergenic
1116162087 14:41280953-41280975 TATTATCCTAAGGAAACTGTAGG + Intergenic
1117974655 14:61285398-61285420 TTATATCCTAAGGAACTTTCAGG - Intronic
1119762606 14:77162354-77162376 TAGGCTAGTAAGGAAGTTGCTGG + Intronic
1125476010 15:40048522-40048544 TGGTATCCGTGGGAAGTTGCTGG + Intergenic
1126501188 15:49347134-49347156 TAGTATACTCAGGAAATTGAGGG + Intronic
1129240973 15:74252072-74252094 TAGTACCCAAAGGAGGATGCAGG + Intronic
1135475311 16:22769315-22769337 TAGTACCCTAACACAGTTGCTGG - Intergenic
1140557434 16:75937862-75937884 TAGTATCCAAATGTAGTTGTAGG + Intergenic
1141259842 16:82442689-82442711 TAGTCTCCAAAGGAATTTGCAGG - Intergenic
1148655185 17:49277905-49277927 CTGTATCCTGAAGAAGTTGCAGG - Intergenic
1149416688 17:56467323-56467345 GAGTATCGTAAGGAACATGCAGG - Intronic
1153985400 18:10346455-10346477 TGATAGCCTAAGAAAGTTGCTGG + Intergenic
1155816889 18:30323425-30323447 TAGTCTCCTTAGGAAGTGACTGG - Intergenic
1162235148 19:9303209-9303231 TAGTATCAGAAGCAAGTTGTAGG - Intronic
1163798990 19:19353802-19353824 TAGCATCCTCAGGATGTGGCAGG - Intronic
926683230 2:15679841-15679863 AAGTGTCCTGAGGAAGCTGCAGG - Intergenic
934516321 2:94989878-94989900 AAGTAACCTTAGCAAGTTGCAGG + Intergenic
937027673 2:118712692-118712714 TAATATCCTCAGGGAGTTGGGGG + Intergenic
939618775 2:144392193-144392215 TAGTATCCAAAAGAGGTTGTAGG - Intronic
951612406 3:24505357-24505379 TAGTTTCCTAAGGATGTTTAAGG - Intergenic
952194613 3:31061653-31061675 TAGTATCCTCAAGAGATTGCAGG + Intergenic
954198793 3:49012099-49012121 TTGTCTGCTAAGGCAGTTGCTGG - Exonic
955189053 3:56743390-56743412 TAGAATCATAAAGAAGTTGAAGG + Intronic
956463355 3:69494390-69494412 TAGTAATCTAAGCAAGTTGCTGG + Intronic
956684311 3:71810134-71810156 AAGTGTCCTAAGGCAGTTGGTGG + Intergenic
965473432 3:169123886-169123908 TGGTCTCCCAAGGAAGATGCAGG + Intronic
965613907 3:170573596-170573618 TAATACCCTAAGGAAGATGGGGG + Intronic
970675449 4:18443476-18443498 TAGTAACCTAATGAATTTGGTGG - Intergenic
973263048 4:48183878-48183900 CAGTAACCCTAGGAAGTTGCAGG + Intronic
977836809 4:101654966-101654988 CAGTGTCTTAAGGAAGTTGCAGG - Intronic
980994861 4:139770495-139770517 CAGGATCCTAAGGGAGTTGGTGG + Intronic
981840698 4:149108070-149108092 TTGGATCCTAAGGAAATTGGTGG + Intergenic
983955738 4:173697067-173697089 TAGTATCCATAGGAAGCAGCAGG + Intergenic
987312067 5:16690598-16690620 AAGGGTCCAAAGGAAGTTGCAGG - Intronic
988619743 5:32810970-32810992 TAGTTTCCTAAGTAGGCTGCAGG - Intergenic
989354519 5:40528464-40528486 TGGTTTCTTAAGGAAGTTACAGG - Intergenic
989915746 5:49725233-49725255 AAATATCCTAAAGAAGTTTCTGG - Intergenic
989929454 5:49928289-49928311 AAACATCCTAAGGAAGTTTCTGG - Intergenic
989932728 5:49977003-49977025 AAGCATCCTAAAGAAGTTTCTGG - Intergenic
989936624 5:50034594-50034616 AAACATCCTAAGGAAGTTTCTGG - Intergenic
990451578 5:55936182-55936204 TAGTAACCTCAAGAAGTAGCAGG + Exonic
1000924202 5:167173777-167173799 TAGTGCCCTAGGTAAGTTGCAGG + Intergenic
1000962603 5:167618164-167618186 TAGTATTCTAAGCACTTTGCAGG + Intronic
1008948167 6:57122876-57122898 TATTATCCAAAGGAAAATGCTGG + Intronic
1013054785 6:106573142-106573164 TAGTTTCAGAAGGAGGTTGCTGG - Intronic
1013159886 6:107532792-107532814 TGGTGTCCTAAGGGAGATGCAGG - Intronic
1014653980 6:124076053-124076075 TAGCTGCCTAATGAAGTTGCAGG + Intronic
1016556238 6:145341497-145341519 CAGTATGCTAAGGAAATTACTGG - Intergenic
1018684976 6:166297379-166297401 TAGTTTCTTCTGGAAGTTGCTGG + Intergenic
1018887619 6:167953808-167953830 TAGGATCCTAAGGACGTTCATGG + Intronic
1022250154 7:28599442-28599464 TAGTTTCATAAGATAGTTGCAGG + Intronic
1023806954 7:43879093-43879115 GAATTTCCTCAGGAAGTTGCAGG - Exonic
1026321114 7:69268346-69268368 TTGTGTCCTAAGGATGTTGGGGG - Intergenic
1028059059 7:86286859-86286881 TTGTATCCTAAAAATGTTGCTGG + Intergenic
1028445436 7:90916619-90916641 TAGTAACCAAAGGCAGTTTCAGG - Intronic
1031018102 7:116597351-116597373 CAGTTTCCTATGGAAGTTGGAGG + Intergenic
1031888687 7:127268472-127268494 TAGTGTCCTAAGCAATTTACAGG - Intergenic
1035963583 8:4165343-4165365 TAGAGTCCTAAGGAATTTGTGGG - Intronic
1041700797 8:60787067-60787089 TAGTATTCTATGGAAGTTTAAGG - Intronic
1047117535 8:121861177-121861199 AAGTTTCCTAAGAAAGTTGAAGG - Intergenic
1047810844 8:128407182-128407204 TATTATCATAATGAAATTGCTGG + Intergenic
1048240654 8:132738469-132738491 CAGTATCCTAAGGAAGTGGCAGG - Intronic
1050964815 9:11785762-11785784 CAATATCATAAGGAAGATGCAGG - Intergenic
1052309716 9:27052614-27052636 TAGTATGATAAGGATTTTGCTGG + Intronic
1056040350 9:82659227-82659249 TAATATGCTAAGAAAGTTGGAGG + Intergenic
1060436923 9:123601548-123601570 TAGCATGCTAAGGAAATTCCAGG + Intronic
1062080238 9:134619907-134619929 TATTATCCTCAGGAAGTTGATGG - Intergenic
1185642184 X:1594430-1594452 TGGTATCTTAAGGAAGATGTGGG + Intronic
1188722235 X:33536959-33536981 CATTATTCTAAGGAAGTTACAGG - Intergenic
1188971282 X:36618563-36618585 TATTTTCCTAAGAAAGTTGGAGG - Intergenic
1189401783 X:40676494-40676516 TTGTATCCTAAGTAAGCTGTGGG + Intronic
1193651484 X:84139859-84139881 TAGTAAGCTAAGGCAGTTGTGGG - Intronic