ID: 1082066328

View in Genome Browser
Species Human (GRCh38)
Location 11:47903659-47903681
Sequence ATCTCTTAAGACTGTAGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082066328_1082066335 9 Left 1082066328 11:47903659-47903681 CCAATGCTACAGTCTTAAGAGAT No data
Right 1082066335 11:47903691-47903713 GGGGAAGTGATTAAGTCATGTGG No data
1082066328_1082066336 10 Left 1082066328 11:47903659-47903681 CCAATGCTACAGTCTTAAGAGAT No data
Right 1082066336 11:47903692-47903714 GGGAAGTGATTAAGTCATGTGGG No data
1082066328_1082066334 -10 Left 1082066328 11:47903659-47903681 CCAATGCTACAGTCTTAAGAGAT No data
Right 1082066334 11:47903672-47903694 CTTAAGAGATGGGGTCTTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082066328 Original CRISPR ATCTCTTAAGACTGTAGCAT TGG (reversed) Intergenic
No off target data available for this crispr