ID: 1082066383

View in Genome Browser
Species Human (GRCh38)
Location 11:47904100-47904122
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082066383_1082066390 8 Left 1082066383 11:47904100-47904122 CCCTCCACCTCCACCATGTGAAG No data
Right 1082066390 11:47904131-47904153 AGAAGATGTCATCTTTGAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082066383 Original CRISPR CTTCACATGGTGGAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr