ID: 1082071663

View in Genome Browser
Species Human (GRCh38)
Location 11:47944272-47944294
Sequence TATTTCTCCCTGACTCCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082071663_1082071672 26 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071672 11:47944321-47944343 GACAGTGGTTCCTCCCTAGGAGG No data
1082071663_1082071665 -10 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071665 11:47944285-47944307 GGGAGAAATAGTATTCCTGGAGG No data
1082071663_1082071671 23 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data
1082071663_1082071667 4 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071667 11:47944299-47944321 TCCTGGAGGGAGATTCCAACTGG No data
1082071663_1082071666 -9 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071666 11:47944286-47944308 GGAGAAATAGTATTCCTGGAGGG No data
1082071663_1082071669 11 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071669 11:47944306-47944328 GGGAGATTCCAACTGGACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082071663 Original CRISPR TATTTCTCCCTGACTCCCCA AGG (reversed) Intergenic