ID: 1082071666

View in Genome Browser
Species Human (GRCh38)
Location 11:47944286-47944308
Sequence GGAGAAATAGTATTCCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082071662_1082071666 -8 Left 1082071662 11:47944271-47944293 CCCTTGGGGAGTCAGGGAGAAAT No data
Right 1082071666 11:47944286-47944308 GGAGAAATAGTATTCCTGGAGGG No data
1082071663_1082071666 -9 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071666 11:47944286-47944308 GGAGAAATAGTATTCCTGGAGGG No data
1082071660_1082071666 -2 Left 1082071660 11:47944265-47944287 CCTTCACCCTTGGGGAGTCAGGG No data
Right 1082071666 11:47944286-47944308 GGAGAAATAGTATTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082071666 Original CRISPR GGAGAAATAGTATTCCTGGA GGG Intergenic
No off target data available for this crispr