ID: 1082071668

View in Genome Browser
Species Human (GRCh38)
Location 11:47944300-47944322
Sequence TCCAGTTGGAATCTCCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082071668_1082071677 19 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071677 11:47944342-47944364 GGTTACTGGAGATTAAATAATGG No data
1082071668_1082071672 -2 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071672 11:47944321-47944343 GACAGTGGTTCCTCCCTAGGAGG No data
1082071668_1082071671 -5 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data
1082071668_1082071673 5 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071673 11:47944328-47944350 GTTCCTCCCTAGGAGGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082071668 Original CRISPR TCCAGTTGGAATCTCCCTCC AGG (reversed) Intergenic
No off target data available for this crispr