ID: 1082071671

View in Genome Browser
Species Human (GRCh38)
Location 11:47944318-47944340
Sequence CTGGACAGTGGTTCCTCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082071663_1082071671 23 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data
1082071660_1082071671 30 Left 1082071660 11:47944265-47944287 CCTTCACCCTTGGGGAGTCAGGG No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data
1082071668_1082071671 -5 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data
1082071662_1082071671 24 Left 1082071662 11:47944271-47944293 CCCTTGGGGAGTCAGGGAGAAAT No data
Right 1082071671 11:47944318-47944340 CTGGACAGTGGTTCCTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082071671 Original CRISPR CTGGACAGTGGTTCCTCCCT AGG Intergenic
No off target data available for this crispr