ID: 1082071672

View in Genome Browser
Species Human (GRCh38)
Location 11:47944321-47944343
Sequence GACAGTGGTTCCTCCCTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082071668_1082071672 -2 Left 1082071668 11:47944300-47944322 CCTGGAGGGAGATTCCAACTGGA No data
Right 1082071672 11:47944321-47944343 GACAGTGGTTCCTCCCTAGGAGG No data
1082071662_1082071672 27 Left 1082071662 11:47944271-47944293 CCCTTGGGGAGTCAGGGAGAAAT No data
Right 1082071672 11:47944321-47944343 GACAGTGGTTCCTCCCTAGGAGG No data
1082071663_1082071672 26 Left 1082071663 11:47944272-47944294 CCTTGGGGAGTCAGGGAGAAATA No data
Right 1082071672 11:47944321-47944343 GACAGTGGTTCCTCCCTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082071672 Original CRISPR GACAGTGGTTCCTCCCTAGG AGG Intergenic
No off target data available for this crispr