ID: 1082073946

View in Genome Browser
Species Human (GRCh38)
Location 11:47961951-47961973
Sequence CTGTAGGCCTAGAAGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082073946_1082073955 18 Left 1082073946 11:47961951-47961973 CCCAGGTCCTTCTAGGCCTACAG No data
Right 1082073955 11:47961992-47962014 AGGATTAATGTGGAGTGAGCAGG No data
1082073946_1082073956 29 Left 1082073946 11:47961951-47961973 CCCAGGTCCTTCTAGGCCTACAG No data
Right 1082073956 11:47962003-47962025 GGAGTGAGCAGGAATGCATTTGG No data
1082073946_1082073951 -2 Left 1082073946 11:47961951-47961973 CCCAGGTCCTTCTAGGCCTACAG No data
Right 1082073951 11:47961972-47961994 AGGAATATCCCTTGCATCTAAGG No data
1082073946_1082073954 8 Left 1082073946 11:47961951-47961973 CCCAGGTCCTTCTAGGCCTACAG No data
Right 1082073954 11:47961982-47962004 CTTGCATCTAAGGATTAATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082073946 Original CRISPR CTGTAGGCCTAGAAGGACCT GGG (reversed) Intergenic
No off target data available for this crispr