ID: 1082075229

View in Genome Browser
Species Human (GRCh38)
Location 11:47971069-47971091
Sequence GGGCGTGCACTGCCATGCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082075220_1082075229 28 Left 1082075220 11:47971018-47971040 CCTGGGTTCAAGCCATTCTTGTG 0: 55
1: 2607
2: 18990
3: 159499
4: 217899
Right 1082075229 11:47971069-47971091 GGGCGTGCACTGCCATGCATGGG No data
1082075225_1082075229 -1 Left 1082075225 11:47971047-47971069 CCTCTTGAGAAGCTGGGATTACG No data
Right 1082075229 11:47971069-47971091 GGGCGTGCACTGCCATGCATGGG No data
1082075223_1082075229 5 Left 1082075223 11:47971041-47971063 CCTTAGCCTCTTGAGAAGCTGGG No data
Right 1082075229 11:47971069-47971091 GGGCGTGCACTGCCATGCATGGG No data
1082075221_1082075229 16 Left 1082075221 11:47971030-47971052 CCATTCTTGTGCCTTAGCCTCTT No data
Right 1082075229 11:47971069-47971091 GGGCGTGCACTGCCATGCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082075229 Original CRISPR GGGCGTGCACTGCCATGCAT GGG Intergenic
No off target data available for this crispr