ID: 1082076170

View in Genome Browser
Species Human (GRCh38)
Location 11:47977968-47977990
Sequence CCCAGGTCTCCACAGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082076170_1082076177 -1 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076177 11:47977990-47978012 GTCGGTCTTCAGGGTTAGTAGGG No data
1082076170_1082076180 17 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076180 11:47978008-47978030 TAGGGTCTGTAGGGTCTGTGAGG No data
1082076170_1082076178 7 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076178 11:47977998-47978020 TCAGGGTTAGTAGGGTCTGTAGG No data
1082076170_1082076181 25 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076181 11:47978016-47978038 GTAGGGTCTGTGAGGATCCGAGG No data
1082076170_1082076174 -10 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076174 11:47977981-47978003 GAGACCTGGGTCGGTCTTCAGGG No data
1082076170_1082076179 8 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076179 11:47977999-47978021 CAGGGTTAGTAGGGTCTGTAGGG No data
1082076170_1082076176 -2 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076176 11:47977989-47978011 GGTCGGTCTTCAGGGTTAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082076170 Original CRISPR CCCAGGTCTCCACAGATTCA TGG (reversed) Intergenic