ID: 1082076180

View in Genome Browser
Species Human (GRCh38)
Location 11:47978008-47978030
Sequence TAGGGTCTGTAGGGTCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082076167_1082076180 23 Left 1082076167 11:47977962-47977984 CCCAAGCCATGAATCTGTGGAGA No data
Right 1082076180 11:47978008-47978030 TAGGGTCTGTAGGGTCTGTGAGG No data
1082076175_1082076180 0 Left 1082076175 11:47977985-47978007 CCTGGGTCGGTCTTCAGGGTTAG No data
Right 1082076180 11:47978008-47978030 TAGGGTCTGTAGGGTCTGTGAGG No data
1082076170_1082076180 17 Left 1082076170 11:47977968-47977990 CCATGAATCTGTGGAGACCTGGG No data
Right 1082076180 11:47978008-47978030 TAGGGTCTGTAGGGTCTGTGAGG No data
1082076168_1082076180 22 Left 1082076168 11:47977963-47977985 CCAAGCCATGAATCTGTGGAGAC No data
Right 1082076180 11:47978008-47978030 TAGGGTCTGTAGGGTCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082076180 Original CRISPR TAGGGTCTGTAGGGTCTGTG AGG Intergenic
No off target data available for this crispr