ID: 1082076799

View in Genome Browser
Species Human (GRCh38)
Location 11:47981085-47981107
Sequence TTCCCCGGAACCCCCCGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082076799_1082076814 -7 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076814 11:47981101-47981123 CGGGGAAGGGGGCGGGGGTCCGG 0: 1
1: 0
2: 19
3: 203
4: 1709
1082076799_1082076824 25 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076824 11:47981133-47981155 TCCCCGGAAGGCGACTTGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 16
1082076799_1082076816 9 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076816 11:47981117-47981139 GGTCCGGATCCCCGGATCCCCGG 0: 1
1: 0
2: 0
3: 6
4: 95
1082076799_1082076823 24 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076823 11:47981132-47981154 ATCCCCGGAAGGCGACTTGCGGG 0: 1
1: 0
2: 0
3: 2
4: 59
1082076799_1082076822 23 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076822 11:47981131-47981153 GATCCCCGGAAGGCGACTTGCGG 0: 1
1: 0
2: 0
3: 1
4: 40
1082076799_1082076815 1 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076815 11:47981109-47981131 GGGGCGGGGGTCCGGATCCCCGG 0: 1
1: 1
2: 2
3: 27
4: 370
1082076799_1082076818 13 Left 1082076799 11:47981085-47981107 CCCCCCCGGGGGGTTCCGGGGAA 0: 1
1: 0
2: 0
3: 6
4: 77
Right 1082076818 11:47981121-47981143 CGGATCCCCGGATCCCCGGAAGG 0: 1
1: 0
2: 0
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082076799 Original CRISPR TTCCCCGGAACCCCCCGGGG GGG (reversed) Intronic
900176910 1:1295071-1295093 TTACCCGGCACCCCCCGCAGTGG + Intronic
900191669 1:1354714-1354736 TTGCCCGGAGAGCCCCGGGGGGG + Exonic
900950731 1:5857038-5857060 TTCCCAGGACCCCCTCGGAGAGG + Intergenic
901497286 1:9629345-9629367 ATTCCAGGAACCCCCAGGGGAGG + Intergenic
914200006 1:145476110-145476132 TTTCTCGGCACCCCGCGGGGAGG + Intergenic
914479124 1:148049245-148049267 TTTCTCGGCACCCCGCGGGGCGG + Intergenic
914645324 1:149647124-149647146 TTTCTCGGCACCCCGCGGGGCGG + Intergenic
917212800 1:172647189-172647211 TTCTCATGAGCCCCCCGGGGTGG + Intergenic
923944407 1:238866590-238866612 TTCCCCCGAACCCCCTAGTGCGG + Intergenic
1064981660 10:21173040-21173062 TTCCCCAGAACGCCCCTGGCTGG + Intronic
1067111867 10:43407205-43407227 CTTCCCGGAACCGCGCGGGGCGG - Intronic
1068755631 10:60649201-60649223 CTCCCAGGAACTCCACGGGGAGG + Intronic
1074465696 10:113679603-113679625 TTTCCCGGAACAACCCGCGGCGG + Intronic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1082076799 11:47981085-47981107 TTCCCCGGAACCCCCCGGGGGGG - Intronic
1083688017 11:64388919-64388941 TGCCCTGGAATCCCCAGGGGTGG + Intergenic
1084192552 11:67505435-67505457 CTGCCCGGACCCCGCCGGGGTGG - Intronic
1084409289 11:68997127-68997149 TTCACCTGAACCCCCCACGGTGG - Intergenic
1090807122 11:130209654-130209676 TCCCCCGGAATCACCCTGGGCGG - Exonic
1103900919 12:124303319-124303341 TTCCCCGGGAGCCGCTGGGGTGG - Intronic
1107282739 13:38755344-38755366 GCCCCAGGAACCCCCAGGGGTGG + Intronic
1123032260 14:105457496-105457518 TGCCCCAGAACCCCCTGGGGTGG + Intronic
1124355116 15:28989624-28989646 TTCCCAGGCACCCCCTGGAGCGG - Intronic
1128765285 15:70247626-70247648 TTCCCCGGAACCTCACAAGGAGG + Intergenic
1129711035 15:77820271-77820293 TTCCCCGGGGCCCCCGGGTGGGG - Intronic
1130994281 15:88895347-88895369 TTCCCCGGACCCTGCCCGGGAGG + Intronic
1132462438 16:62106-62128 TGCCCTGGTGCCCCCCGGGGAGG - Intronic
1133236100 16:4388116-4388138 TTCCCTGGGAGCCCCCCGGGTGG - Intronic
1135131126 16:19854628-19854650 TGCCCTGGATCCCCCCAGGGAGG - Intronic
1138389127 16:56657681-56657703 GTACCCGGAACCCCAAGGGGCGG + Exonic
1139421781 16:66853582-66853604 GTCCCCAGCACCCCCCAGGGAGG - Exonic
1140319955 16:73940936-73940958 TTCCCATGAACACCCCTGGGAGG - Intergenic
1140440599 16:74984870-74984892 CTCCCCGTAGCCCCCCGGGACGG + Intronic
1140481531 16:75265317-75265339 CTCCCGGGACTCCCCCGGGGTGG - Intronic
1142757869 17:2026059-2026081 TTTCCGCGAACCCCCCGGCGGGG - Intergenic
1143543379 17:7582573-7582595 TTCCCAGGAGCCCCCAGTGGAGG - Intergenic
1156250118 18:35344436-35344458 TTTCCCAGAAGCCCCCGGCGCGG + Exonic
1160840250 19:1143571-1143593 TTCCCCTGGAGCCCCCGGGAGGG - Intronic
1160895779 19:1401252-1401274 TTCCCCTGCGCCCCCGGGGGCGG + Intronic
1161403376 19:4078627-4078649 TCCCCCAGAACCCCCAGCGGAGG + Intergenic
1161504452 19:4636352-4636374 TTCCCCGGAACCCGCGGCCGGGG - Intergenic
1162564046 19:11435369-11435391 TGCCCGCGAACCCCCAGGGGCGG - Intronic
1166605756 19:44141505-44141527 TTCCCCGGATCCCCCTGCGTGGG - Intergenic
1167272501 19:48513789-48513811 TTCCCCTGAGCCCCCCGATGAGG - Intergenic
938263708 2:129911932-129911954 TTGCCCGGACCCTCCCCGGGTGG - Intergenic
946864998 2:224034785-224034807 TTCCTCGCAGCCCCCCTGGGTGG - Intronic
947491989 2:230603125-230603147 TTCCCCGAAACTCCCTGGGAGGG - Intergenic
947593218 2:231396366-231396388 TTCCCTGGAACCCCTAGGGCTGG + Intronic
948407228 2:237731288-237731310 TACCCCCCAACCCCCCGGGAGGG - Intronic
1175368951 20:58474019-58474041 TTCCCCGGAAGGCCCCAGGCAGG - Intronic
1175997035 20:62816601-62816623 GGCCCAGGAACACCCCGGGGAGG - Intronic
1180122865 21:45765545-45765567 GTCCCAGGAGCCCCACGGGGAGG - Intronic
1180186386 21:46141906-46141928 TGCCCTGGGCCCCCCCGGGGAGG + Intronic
1203259845 22_KI270733v1_random:167551-167573 TTCCCCGCCGCCCCCCGGGTGGG - Intergenic
968227867 3:196986972-196986994 TTCCCGTGAACACCCCTGGGAGG - Intergenic
968526364 4:1059616-1059638 TTCCCCAGAGACCCCCAGGGAGG - Intronic
968753033 4:2400065-2400087 TTCCCCGGAGCTCCTCAGGGCGG + Intronic
969333648 4:6494329-6494351 TTCCCCTGGACACCCCGGGGAGG - Intronic
970195599 4:13547663-13547685 GTCCCCGGAACCGCCCGGGCTGG + Intergenic
985677466 5:1239457-1239479 TTCTCCAGAACCCCCGGGTGTGG + Exonic
986422176 5:7596581-7596603 TTCCCTGGAGATCCCCGGGGAGG + Intronic
993491594 5:88558306-88558328 TTCCCCCGACCCACCCCGGGTGG + Intergenic
994167053 5:96618794-96618816 TCCCCCGGGAGCCCACGGGGTGG - Intronic
997402147 5:133611805-133611827 TTCCCCGCAAAGCCGCGGGGAGG + Intronic
1001707353 5:173751111-173751133 TTCCCCGGTCCCCCCCAGGAGGG - Intergenic
1001781923 5:174376177-174376199 TGCCCTGGAACCCCCCTGGGTGG - Intergenic
1002075318 5:176705061-176705083 TTCCTCGGACCCCACCGGAGTGG - Intergenic
1002445677 5:179288519-179288541 TCCCCCGGAGCCACCCTGGGTGG - Intronic
1006302274 6:33200070-33200092 TTCCCCGCCCCGCCCCGGGGGGG + Intronic
1019356862 7:584759-584781 TTCTCCAGAAGCCCCCCGGGAGG - Intronic
1020274500 7:6616025-6616047 TGCCCAGAAAGCCCCCGGGGTGG + Exonic
1025078750 7:55964716-55964738 CTCCCCGGCACCTCCCGGGAAGG - Intronic
1026004712 7:66591817-66591839 ATCCCCGGAACGCTCCGGGATGG - Intergenic
1026017531 7:66682651-66682673 CTCCCCGGAACGCGCCGGGATGG + Intronic
1037987531 8:23299226-23299248 TTCCCCAGAACTCCCAGGAGTGG - Intronic
1039608423 8:38901178-38901200 CTCCGCGGAGCCCGCCGGGGAGG - Intergenic
1049109954 8:140636054-140636076 TTCCCCGCCGCCCCCCGGTGGGG + Intergenic
1049221988 8:141432605-141432627 GTCCCCGCCACCCCCCGAGGTGG - Intergenic
1052048388 9:23821095-23821117 TCCCGCGGAACACGCCGGGGTGG - Intronic
1053145180 9:35707137-35707159 ATCCCCGGGACCCCCCGAGCTGG - Exonic
1061488712 9:130933692-130933714 TTCCCCAGAACCCCCAAGGCTGG - Intronic
1062320093 9:135986547-135986569 CTCCCAGGAACCCCCCGAGGCGG - Intergenic
1200153684 X:153964085-153964107 TTCTCTGGAACCCCCCGGGTGGG - Intronic
1200259163 X:154602898-154602920 TTCCCTGGCATCCCTCGGGGAGG - Intergenic