ID: 1082078213

View in Genome Browser
Species Human (GRCh38)
Location 11:47991345-47991367
Sequence AGCCATAGCCAGAGTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 165}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082078213_1082078220 18 Left 1082078213 11:47991345-47991367 CCTGGCCAACTCTGGCTATGGCT 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1082078220 11:47991386-47991408 CATTTTCTGTGGCGGTCAAGAGG 0: 1
1: 0
2: 1
3: 10
4: 118
1082078213_1082078218 7 Left 1082078213 11:47991345-47991367 CCTGGCCAACTCTGGCTATGGCT 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1082078218 11:47991375-47991397 GTCTCTCGGTACATTTTCTGTGG 0: 1
1: 0
2: 0
3: 10
4: 87
1082078213_1082078219 10 Left 1082078213 11:47991345-47991367 CCTGGCCAACTCTGGCTATGGCT 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1082078219 11:47991378-47991400 TCTCGGTACATTTTCTGTGGCGG 0: 1
1: 0
2: 0
3: 8
4: 94
1082078213_1082078215 -7 Left 1082078213 11:47991345-47991367 CCTGGCCAACTCTGGCTATGGCT 0: 1
1: 0
2: 0
3: 21
4: 165
Right 1082078215 11:47991361-47991383 TATGGCTGCCTCCTGTCTCTCGG 0: 1
1: 0
2: 0
3: 30
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082078213 Original CRISPR AGCCATAGCCAGAGTTGGCC AGG (reversed) Intronic
900963232 1:5939378-5939400 AGCCATGGCCTGGGTTGGGCCGG + Intronic
902575620 1:17375384-17375406 AACCATAGGCAGTGTTGGACGGG - Intronic
904349166 1:29893796-29893818 ACCCATTGCCAGGGCTGGCCAGG - Intergenic
905001822 1:34678306-34678328 AACCATACCAAGTGTTGGCCAGG - Intergenic
905315028 1:37076972-37076994 ACCCAGAGCCAGAGGAGGCCAGG - Intergenic
906353756 1:45085197-45085219 AGCCACAGCCAGAGCTGGAGTGG + Intronic
907323669 1:53621295-53621317 AGCCAAGGCCAGGGATGGCCAGG + Intronic
910355317 1:86346003-86346025 AACCATAGCTTGAGTAGGCCAGG + Intergenic
910507170 1:87962501-87962523 AGCCAAAGCCAGAGTCAGGCTGG - Intergenic
910988295 1:93027819-93027841 AGCAATAGCCAGACTGGCCCTGG + Intergenic
911193747 1:94973267-94973289 ATCCATTGCCAGAGTGGGGCAGG - Intergenic
915294330 1:154909542-154909564 AGCAAGAGGAAGAGTTGGCCAGG + Intergenic
920398588 1:205663295-205663317 AGGCATAGACAGAGTAGGCCTGG + Exonic
920742079 1:208590552-208590574 AGCCAATCACAGAGTTGGCCTGG + Intergenic
921934726 1:220786369-220786391 AGCCAAGGCCAGAGTTCTCCCGG - Intergenic
922464655 1:225838835-225838857 AGCCATAGCCAGGGATGGAAGGG - Exonic
923424960 1:233859577-233859599 AGCCATAGCCACAGTAGAACTGG - Intergenic
924384280 1:243487839-243487861 AGCCACACCCAGCGTTGTCCGGG - Intronic
1065873248 10:29974200-29974222 AGCCCTGGCCAGAGTTGTGCAGG + Intergenic
1069627572 10:69877557-69877579 AGCCATGGCCCCAGCTGGCCAGG - Intronic
1069826812 10:71259782-71259804 AGCCATAGCCAGGCTCAGCCAGG + Intronic
1070281142 10:75049794-75049816 AGGCATCGCCACAGCTGGCCTGG - Intronic
1070827103 10:79397696-79397718 AACCAGATCCAGAGTGGGCCTGG - Intronic
1072018079 10:91369731-91369753 AGCAATAGTAAGAGTTGGACTGG + Intergenic
1073171277 10:101510894-101510916 AGCCATAGTCACATTTTGCCTGG + Intronic
1073176390 10:101560027-101560049 GGCCAGAGCCAGGGTGGGCCTGG - Intergenic
1073459430 10:103658194-103658216 AGGCAGAGCCAGAGGTGGCTGGG + Intronic
1075761006 10:124856570-124856592 AGAAACAGCCAGAGTTGGCCAGG - Intergenic
1076591860 10:131588917-131588939 AGCCCTAGCCAGAGCAGGCCTGG - Intergenic
1076809025 10:132877161-132877183 GTGCACAGCCAGAGTTGGCCTGG + Intronic
1078851942 11:15171966-15171988 AGACATGGCCACAGATGGCCAGG + Intronic
1078891090 11:15559853-15559875 AGCCAGAGGCAGAGCTGGCAAGG + Intergenic
1079102073 11:17547957-17547979 AGCCACAGCCAGAGCCAGCCGGG + Intronic
1079377238 11:19904503-19904525 ACCCATAGCCAAAGTTTGCAGGG + Intronic
1081731728 11:45376464-45376486 AGCCACAGCAAGGGCTGGCCCGG - Intergenic
1081874887 11:46401706-46401728 AGCCATAGAGAGGGGTGGCCAGG - Intronic
1082078213 11:47991345-47991367 AGCCATAGCCAGAGTTGGCCAGG - Intronic
1083631408 11:64097329-64097351 AGCTCTGGCCAGAGGTGGCCTGG - Intronic
1084038962 11:66530668-66530690 AGTCAGAGGCAGAGCTGGCCTGG - Intronic
1084100743 11:66946984-66947006 AACCATAGCCAGTGTTGGGGAGG + Intronic
1084490351 11:69475125-69475147 TGGCACAGCCAGAGGTGGCCAGG + Intergenic
1084605834 11:70171116-70171138 AGCTAGAGCCAGAGCTGGCCAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085533968 11:77207210-77207232 AGGCATAGCCAGAGGGGCCCGGG + Intronic
1089302474 11:117507002-117507024 AGACATAGGCAGTGTTGGCAGGG - Intronic
1089951920 11:122536004-122536026 AGCCACAGCTGGAGTTGGACTGG - Intergenic
1091197510 11:133744594-133744616 AGCCATGGCTTGAGTGGGCCCGG + Intergenic
1091796628 12:3301008-3301030 AGAAATAGACAGAGTGGGCCAGG + Intergenic
1095645655 12:44542885-44542907 AGCCATAGCCAAAGAATGCCTGG + Intronic
1098627796 12:72694119-72694141 AGCTATGGCCAGAGTTGGAAGGG - Intergenic
1099237533 12:80099584-80099606 AGCCATAGCCAGTGCTTCCCTGG + Intergenic
1102250026 12:111380553-111380575 ATCCATAGCCAGGGCTGGCCTGG - Intergenic
1106621366 13:31374041-31374063 AGCCTTAGCCAGAGCTGGGAGGG - Intergenic
1108034167 13:46270724-46270746 AGCCATAGGCCGAGGAGGCCTGG + Intronic
1110270688 13:73586657-73586679 AAAAATAGCCAGAGATGGCCGGG + Intergenic
1110875909 13:80510216-80510238 ACCCATAGGCAGAGTTGGTTAGG - Intergenic
1113523133 13:110954516-110954538 AACCGAAGCCAGAGTTGGCCAGG - Intergenic
1113702231 13:112396293-112396315 AACCGAAGCCAGAGTTGGCCAGG + Intronic
1114469736 14:22951957-22951979 AGACAAAGCCACAGTTGGCCTGG + Intronic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117339552 14:54781714-54781736 AGCCACAGCAAGGGTTGGCCTGG + Intronic
1121813513 14:96912150-96912172 AGGCAAGGCCAGAGTTGGCATGG - Intronic
1123706618 15:22955481-22955503 AGCCACAGACAGAGTTGCCCCGG + Intronic
1124204803 15:27707910-27707932 ACCCATGGCCAGAGTGGACCAGG + Intergenic
1125588230 15:40837303-40837325 ATCCATAGCCAAATTAGGCCAGG + Intergenic
1126273099 15:46844996-46845018 AGCCATAGCTAGAGCTGGAGTGG + Intergenic
1130543506 15:84838983-84839005 ACCCAGAGCCAGAGGTGACCTGG + Exonic
1133273822 16:4625011-4625033 AGCGATAGGCCGAGTTCGCCTGG - Exonic
1134841377 16:17404638-17404660 AGTAACAGTCAGAGTTGGCCAGG + Intronic
1135169264 16:20168807-20168829 AGCCATAGATAGATCTGGCCAGG + Intergenic
1136398310 16:30004892-30004914 AGCCAGAGGCGGAGTCGGCCTGG - Intronic
1137911134 16:52379702-52379724 AGAAATAGCCACTGTTGGCCAGG + Intergenic
1139025064 16:62805923-62805945 AGCCATACCAAGAGTTGCCTTGG - Intergenic
1139589773 16:67927167-67927189 AGCCTGAGCCAGCGTTGGGCGGG + Intronic
1139595355 16:67954604-67954626 GGACATGGCCAGAGTTGGCCAGG + Intronic
1143117910 17:4591043-4591065 AGCCACATCCAGAGTGAGCCCGG - Intronic
1143405568 17:6675163-6675185 AGACAGAGCCAGAGTGGGACTGG + Intergenic
1145259320 17:21345321-21345343 AGGCATGGCCTGGGTTGGCCCGG + Intergenic
1147292589 17:39455956-39455978 AGCCATAGTAAGTGTTGGCATGG - Intergenic
1147878406 17:43638039-43638061 AGGCATAGGAAGTGTTGGCCTGG + Intergenic
1148801069 17:50226247-50226269 AAACATAACAAGAGTTGGCCAGG + Intergenic
1149226230 17:54474183-54474205 AAAAATAGCCAGAGTAGGCCAGG - Intergenic
1150050641 17:61958766-61958788 AGTCATAGCCACTGTTGGCTGGG - Intronic
1152267221 17:79302382-79302404 AGAAATAGACAGTGTTGGCCAGG + Intronic
1154020795 18:10662644-10662666 AACCATACTCAGAGCTGGCCTGG - Intergenic
1155995044 18:32322159-32322181 AGCCTCAGCCAGAGATGGGCAGG - Intronic
1159693769 18:71527127-71527149 AGCCACAGACAAATTTGGCCAGG + Intergenic
1160578664 18:79871376-79871398 AGCCGCAGGCAGAGTTGTCCTGG + Intronic
1162057822 19:8075289-8075311 AGCCATGGCCTGAGCTGACCAGG + Exonic
1163600693 19:18247589-18247611 AGAAATACCCAGAGCTGGCCAGG - Intronic
1168646383 19:58061531-58061553 AGCCAGTGCCAGGGTTGGCTTGG + Intronic
925061754 2:896960-896982 AGCCATAGCTGGAGTTGGAGTGG - Intergenic
926404547 2:12537893-12537915 AGACATAAGCAGAGCTGGCCAGG - Intergenic
927143541 2:20145644-20145666 ATCCACAGACAGTGTTGGCCAGG - Intergenic
931208956 2:60174446-60174468 AGCCATCACCTGAATTGGCCTGG + Intergenic
931289686 2:60861668-60861690 AGCCAGAGCCAAAACTGGCCAGG - Intergenic
933446004 2:82380451-82380473 AGACACAGCCATAGTTGGCGTGG - Intergenic
937859892 2:126699276-126699298 ATCCCTAGTCAGAGCTGGCCTGG + Intergenic
938166156 2:129028772-129028794 AGCTATACCCAGGGTGGGCCTGG + Intergenic
942272679 2:174292588-174292610 AGCCAGAGCAAGATCTGGCCAGG + Intergenic
946039821 2:216773936-216773958 AGCCATGGCCAGATATGGCCTGG + Intergenic
946419015 2:219554522-219554544 AGACACAGCCTGAGTCGGCCAGG + Exonic
947328070 2:228999596-228999618 AGCCATAGCTAGAGCTGGAATGG - Intronic
947581374 2:231321294-231321316 AGCCAAGGCCAGGGCTGGCCCGG + Intronic
948492522 2:238322204-238322226 AGCCACAGCTAGAGTGGGCTGGG - Intronic
948560350 2:238847768-238847790 AGACAAAGCCAGGCTTGGCCGGG + Intergenic
948678387 2:239612363-239612385 AGCCATGGCCAGCGTGGCCCTGG - Intergenic
1169926244 20:10787429-10787451 AACCTAACCCAGAGTTGGCCTGG - Intergenic
1172217468 20:33246362-33246384 AATCATATCCAGAGATGGCCAGG - Intergenic
1172347604 20:34216110-34216132 CGCCAGAGACGGAGTTGGCCGGG + Intronic
1172632125 20:36385649-36385671 AGGAACAGCCAGAGCTGGCCTGG - Intronic
1175180621 20:57144129-57144151 CAACATAGCCAGTGTTGGCCAGG + Intergenic
1175744383 20:61445163-61445185 ATCCCTGGCCAGAGGTGGCCAGG - Intronic
1177525696 21:22287579-22287601 AGCCATCGCCAGAACTGGCGTGG - Intergenic
1177734599 21:25072993-25073015 AGCCATGGCCTGAGTTGTACTGG + Intergenic
1179489711 21:41733459-41733481 AGGCATATCCAGAGTGGGGCTGG - Intergenic
1179960637 21:44765397-44765419 AGGCATGGGCAGAGTTGGCGTGG - Intergenic
1180960205 22:19759081-19759103 AGCCCTAGCCCGAGGTGGCAGGG - Intronic
1181112794 22:20611719-20611741 CAGCATAGCCAGAGCTGGCCTGG + Intergenic
1181839402 22:25643288-25643310 AGGCATAGCCAGACTTTACCAGG - Intronic
1182613790 22:31572024-31572046 AGAGATAGCCAGAGCTGGACAGG + Intronic
1183695571 22:39420015-39420037 AGGCGAAGCCAGAGTTGGCATGG + Intronic
1185320791 22:50199460-50199482 AGACACAACCAGAGATGGCCTGG - Exonic
949278027 3:2310317-2310339 AGTCATAGCCAATGTTAGCCTGG - Intronic
949519934 3:4841757-4841779 AGCCTGAGTAAGAGTTGGCCAGG + Intronic
950303830 3:11903541-11903563 AGCCATAGCAAGTGCTGGCCAGG - Intergenic
950506068 3:13395290-13395312 AGCAATAGCAAGTGCTGGCCAGG + Intronic
951622566 3:24621358-24621380 AGCCATTGGCAGAGAAGGCCAGG - Intergenic
952764225 3:36941302-36941324 AGCTAAACCCAGAGTTGGCTTGG + Intronic
953463412 3:43099504-43099526 AGCCATGGGCAGTGATGGCCAGG + Intronic
953666478 3:44929594-44929616 AGAGATAGCCAGTGTGGGCCAGG - Intronic
955782863 3:62504887-62504909 AGCTAGAGCCAGAGTTGGTCAGG - Intronic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
963494866 3:146045826-146045848 AGCCATAGCTGGAGTTGGAGTGG + Intergenic
965683760 3:171279541-171279563 GCCAATAGCCAGAGTTGGCAAGG - Intronic
968968128 4:3779685-3779707 AGCCAGCGCCCGAGCTGGCCTGG - Intergenic
969211796 4:5693478-5693500 AGCCACAGCCAAGGATGGCCTGG + Intronic
969699564 4:8760749-8760771 AGCCACAGCCTGTGTTGGCCTGG + Intergenic
970478750 4:16451702-16451724 AGACATAGCAGGAATTGGCCGGG - Intergenic
983653629 4:170057658-170057680 AAGCATAGCCATAGTTGGCCAGG - Intergenic
986545908 5:8896613-8896635 AGCCATAACCAAAGCTGGTCAGG - Intergenic
994179826 5:96751928-96751950 AACCATGGCCAGAGTTGGTGGGG - Intronic
996069284 5:119116477-119116499 AGCCACAGCCAGAGATGTGCAGG - Intronic
997378714 5:133419742-133419764 GACCATAGCCAGTGTTGGCAAGG - Intronic
997857030 5:137381649-137381671 AGCCATGGCCAGAGCTGGAGTGG + Intronic
1001452117 5:171834964-171834986 GGCCACAGCCAGAATTGGCCTGG - Intergenic
1001538137 5:172514127-172514149 TTCCACAGCCAGAGTTGGGCAGG - Intergenic
1001562267 5:172677472-172677494 GGTCACAGCCAGAATTGGCCAGG + Intronic
1003838221 6:10093655-10093677 AGCCATGGCTAGAGTTGGAGTGG + Intronic
1004666523 6:17752938-17752960 AGCTATAAGCAGAGTTTGCCAGG + Intergenic
1006461508 6:34161944-34161966 AGCCATGGTCAGAGGTGGGCAGG - Intergenic
1007118145 6:39358481-39358503 AGCGAAAGCCAGAGTAGGCAAGG - Intronic
1007554831 6:42757034-42757056 AGCCAAAGCCACAGGAGGCCTGG - Intronic
1011492873 6:87910613-87910635 ATCCATGGCCACAGTTGTCCTGG - Intergenic
1013174029 6:107662288-107662310 AGCAAAAGCCAGAGTTGGGAGGG - Intergenic
1014020827 6:116587321-116587343 AGCTGTAGGAAGAGTTGGCCAGG + Intronic
1014710039 6:124796014-124796036 AGCCAGAGCCACAGTTTGGCAGG + Intronic
1015775328 6:136808550-136808572 AGATATGACCAGAGTTGGCCGGG + Intergenic
1016772553 6:147868355-147868377 ATTCATAGCAAGACTTGGCCTGG + Intergenic
1021468910 7:20979164-20979186 AGCCATATTCAAAGTTGTCCTGG + Intergenic
1021716410 7:23466991-23467013 AGCCATAGCCTGAATTGGTTAGG - Intronic
1023188628 7:37556095-37556117 AAGCATAGCAAGAGATGGCCAGG + Intergenic
1028398727 7:90402061-90402083 TGCTATTGCCAGAGCTGGCCTGG + Intronic
1028936136 7:96466040-96466062 AGCAAGAGCCAGAGATGGCCTGG - Intergenic
1033032874 7:137844800-137844822 AGACAAAGCCAGAGTTTGCAAGG - Intronic
1033257408 7:139814195-139814217 AGCCATAGGCTGAGTTGATCAGG - Intronic
1034267622 7:149788887-149788909 AGCCATCGCCACAGTCGTCCTGG - Intergenic
1034944356 7:155252363-155252385 AGCAAGAGTCAGAGTTGGTCGGG + Intergenic
1037942135 8:22959547-22959569 AGCCCTAGAAAGAGTAGGCCAGG - Intronic
1038526785 8:28281258-28281280 AGCAATAGCCATTGTTGCCCTGG - Intergenic
1043201231 8:77372372-77372394 AGCCATAGCTGGAGTTGGAGTGG - Intergenic
1044785039 8:95784268-95784290 AGCCATAGCGAGAGTGAGGCAGG - Intergenic
1045241866 8:100409720-100409742 AGCCATAAGCAGAGTGGTCCTGG + Intronic
1048087668 8:131201619-131201641 AGCCATGGCCAGAGCTGGAATGG - Intergenic
1050410360 9:5357617-5357639 GGCCAAAGCCATACTTGGCCAGG - Intergenic
1050452418 9:5797352-5797374 AGTCATAACCAGCTTTGGCCGGG + Intronic
1051894712 9:21975132-21975154 CGCCAGAGCCAGCGTTGGCAAGG + Intronic
1058741466 9:107946916-107946938 AGTCATAGCCAGAGTTGCCATGG + Intergenic
1062069753 9:134549337-134549359 AGCCAGAGTCAGAGATGGTCTGG - Intergenic
1190054047 X:47171590-47171612 AGCAATAGCCAGCACTGGCCCGG - Intronic
1194981310 X:100444025-100444047 GACCATAGCCAGTGTTGGCCTGG - Intergenic
1198594507 X:138221934-138221956 AACCAAAGCTAGAGTCGGCCTGG + Intergenic
1199748819 X:150795133-150795155 AGCCAGAGCCAGCTTGGGCCTGG - Intronic
1201612455 Y:15858407-15858429 CACCATAGCCAGATTTGCCCTGG + Intergenic
1202180152 Y:22132893-22132915 TGCTACAGGCAGAGTTGGCCTGG + Intergenic
1202211208 Y:22453506-22453528 TGCTACAGGCAGAGTTGGCCTGG - Intergenic