ID: 1082079058

View in Genome Browser
Species Human (GRCh38)
Location 11:47997734-47997756
Sequence GGGCATATCTCTTGTGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 133}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082079058 Original CRISPR GGGCATATCTCTTGTGTGGA AGG (reversed) Intronic
901468717 1:9440837-9440859 GGGTGTGTCTCTGGTGTGGATGG - Intergenic
903406863 1:23104536-23104558 GTGCATTTCTCTTGCGGGGAAGG - Intronic
908339028 1:63157345-63157367 GTGCATATCTGTTGTGGGAAGGG + Intergenic
910903590 1:92149389-92149411 TAGCATATTTGTTGTGTGGAGGG + Intergenic
913503060 1:119489411-119489433 TGGCATGTCTCTTGTTGGGAAGG + Intergenic
915206630 1:154274835-154274857 GGAATTATCTCTTCTGTGGAAGG + Intronic
917108194 1:171516881-171516903 GGGCTTCTGTCTTGGGTGGAGGG - Intronic
922022459 1:221718259-221718281 GGGCATATATCTAATGAGGAGGG - Intronic
924379128 1:243445586-243445608 AGGCATATTTTTTGTGTGTAAGG + Intronic
1065520271 10:26565444-26565466 TGGTATATCTCTTGTGGGGTTGG - Intronic
1066640229 10:37548194-37548216 GGGCAAATCTTTTTTGTGGGAGG + Intergenic
1067692584 10:48511431-48511453 GGGCACATGGCTTGTGTGGAGGG - Intronic
1069631776 10:69901639-69901661 GGGCTTAGCTCTTGTGAGGAGGG - Intronic
1069728595 10:70597050-70597072 GTGCATATCTTTTGTGCGGGGGG - Intergenic
1071837890 10:89437762-89437784 GGTCATATCTCAAGTGTGAATGG + Intronic
1073579936 10:104656204-104656226 GGGCATATGGCTTCTGTGGCAGG + Intronic
1075085892 10:119414061-119414083 GGGCAGCCCCCTTGTGTGGAAGG + Intronic
1077032798 11:477264-477286 GGGCATCCCTCCTGTGTGAACGG + Intronic
1079990469 11:27241166-27241188 GGGCATTTCTCTTGTCTTGGAGG + Intergenic
1080336513 11:31203653-31203675 GGGCAGGTATCTTTTGTGGAAGG - Intronic
1080914883 11:36647010-36647032 GGGGATATCTATAGTGTTGAGGG + Intronic
1082079058 11:47997734-47997756 GGGCATATCTCTTGTGTGGAAGG - Intronic
1082633126 11:55563702-55563724 GGGCTTTTCTCTTGTGAGCAGGG - Intergenic
1083414022 11:62513644-62513666 GGGCTTATGTGGTGTGTGGAGGG - Intronic
1083910481 11:65706106-65706128 GGGCAAATTACTTGTGTGGGTGG + Intergenic
1085799766 11:79578494-79578516 GGGCAGCTCTCTGGTGAGGAAGG - Intergenic
1090055378 11:123418935-123418957 GGACATAAATCCTGTGTGGATGG + Intergenic
1091016991 11:132060076-132060098 GGGCCTATGTCTCATGTGGAGGG - Intronic
1093575921 12:20729817-20729839 AAGCAAATATCTTGTGTGGAAGG + Intronic
1095852225 12:46823293-46823315 GGTCATATCTCCTGTGTGTGTGG - Intronic
1097455048 12:59789940-59789962 GGGCATTTCTTTTGTCTGAATGG + Intergenic
1098541767 12:71664627-71664649 GTGGCTATCGCTTGTGTGGAAGG + Intronic
1100043058 12:90343990-90344012 GGAAACATCTCTTGTGTAGATGG - Intergenic
1102786853 12:115612045-115612067 GGGCTTATCTGTGCTGTGGATGG - Intergenic
1103046117 12:117736050-117736072 TGGCATATCTGGTGTGTGTAAGG - Intronic
1103598128 12:122036666-122036688 GGGCATTTTCCTTGGGTGGATGG - Intronic
1106584420 13:31044488-31044510 GCGCATCTCACTTGTGTGAAAGG + Intergenic
1106630797 13:31470551-31470573 GGCCATGTCTATTGTGTTGAAGG - Intergenic
1106811760 13:33365087-33365109 GGTCATCTCACATGTGTGGAAGG - Intergenic
1114958212 14:27849452-27849474 GGGCAGAACTCCTGTGGGGAGGG + Intergenic
1115532873 14:34343127-34343149 TGGCATATCTCTGGTCAGGAAGG + Intronic
1116161742 14:41275630-41275652 GGGAATATATCTTGTTTGGTGGG - Intergenic
1116357652 14:43950095-43950117 GAGCAAATCTCTTGTGGAGAAGG - Intergenic
1116379831 14:44251608-44251630 GGACATACCTCTGGTGGGGAAGG + Intergenic
1117102281 14:52362678-52362700 TTGCATATCTCCTTTGTGGATGG - Intergenic
1122170766 14:99872858-99872880 GGGCATCTGTGGTGTGTGGATGG + Intronic
1122648237 14:103209224-103209246 GGGCATATCAAATGTGGGGAGGG + Intergenic
1124450557 15:29785443-29785465 GGGCAGACCTTTTGTGTGAAAGG - Intronic
1125470026 15:39993440-39993462 GGGAAGATCTCTTGAGAGGATGG + Intronic
1126205160 15:46036992-46037014 TGGCATCTATTTTGTGTGGAAGG - Intergenic
1134200500 16:12194407-12194429 GGTCATGTCTCTTGTGAAGAGGG + Intronic
1137747041 16:50830068-50830090 GGGCATATCTTTTCTTTGGTGGG - Intergenic
1141016244 16:80452832-80452854 GGGCATATCTGGTGTGTCCAAGG - Intergenic
1141153262 16:81579287-81579309 GGGCAGCTCTCAGGTGTGGAAGG + Intronic
1143514008 17:7410434-7410456 GTGCACAGCTCTTCTGTGGAGGG - Intronic
1144931242 17:18860565-18860587 GGTTATATCTCTTGTCTGGAAGG + Intronic
1145171157 17:20658388-20658410 GGGCACATCCCTCCTGTGGAAGG - Intergenic
1149195130 17:54110551-54110573 GGGCAGATTGCTTGTGTCGAAGG + Intergenic
1150894983 17:69199087-69199109 TGCCATATCCCCTGTGTGGAAGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1158864470 18:61624782-61624804 TGGCATGTCTCTTGTCAGGAAGG - Intergenic
1160387948 18:78508430-78508452 GGGCAGTGCTCATGTGTGGATGG - Intergenic
1162085772 19:8248288-8248310 GAGAATATCTCTTGCCTGGATGG + Intronic
1162232600 19:9280171-9280193 GGACATATTTATTATGTGGATGG - Intergenic
1164774763 19:30844309-30844331 GGGCAAGCCTCTTGTGTGGGGGG + Intergenic
1168665488 19:58201810-58201832 AGGCATATTTCTTTTGTGTATGG + Intronic
926544823 2:14226597-14226619 TGGCATATCTCCAGTGTGGTAGG + Intergenic
930362511 2:50399591-50399613 GGGCCCATCACTTGTGTGCATGG + Intronic
930386709 2:50705727-50705749 CAGCATTTCACTTGTGTGGATGG - Intronic
931065565 2:58582267-58582289 GGGATTATCCCTTATGTGGAAGG + Intergenic
934479085 2:94618592-94618614 GGGCAGAACTCCTGTGGGGAGGG - Intergenic
935894331 2:107718307-107718329 GGTCATATCTGTTTTGTAGAAGG - Intergenic
937371900 2:121304109-121304131 GGGCACATGTGTTCTGTGGATGG + Intergenic
939569829 2:143828083-143828105 GTGTATAGCTCTGGTGTGGAGGG + Intergenic
939895387 2:147785209-147785231 GGGATTGTCTCTTGTGGGGAGGG - Intergenic
943376273 2:187081103-187081125 GGGAATATTTATTGTGTGAATGG + Intergenic
943581622 2:189690766-189690788 GGGCATGGCTCTTGGGTGGTGGG + Intronic
947313514 2:228829821-228829843 GGGCATATAACTTATGTGTAGGG - Intergenic
948667139 2:239543439-239543461 GGGCTTCACTCTTGTGTGAAGGG + Intergenic
1169738075 20:8858976-8858998 TGACATACCTCTTGTTTGGAGGG + Intronic
1170117401 20:12875144-12875166 GGGCATAGCTCTGGATTGGATGG - Intergenic
1170795121 20:19540411-19540433 AGGCAGAGCCCTTGTGTGGAGGG - Intronic
1170802033 20:19598465-19598487 TGACATATCTTGTGTGTGGAAGG + Intronic
1171220233 20:23390464-23390486 GGGCATATGCCATGTGGGGAGGG - Intronic
1179142778 21:38741523-38741545 GAGCCTATTTCTTGTGTGGTTGG + Intergenic
950501649 3:13367671-13367693 GGGCATAACTCTTTTGTGCCTGG + Intronic
951679685 3:25281858-25281880 AGGGATATCTCCTGTTTGGAAGG + Intronic
952140093 3:30468633-30468655 GGGCATATCTCTTTTTGGGGGGG + Intergenic
952704328 3:36362038-36362060 GGGCTTATATTTTGTATGGAAGG - Intergenic
953575106 3:44106958-44106980 AGGCGTAGCTCTTCTGTGGATGG - Intergenic
953677599 3:45015395-45015417 AAGCAGATCTCTTATGTGGAAGG + Intronic
957325699 3:78690974-78690996 AGGCAAATATCCTGTGTGGAAGG - Intronic
961572763 3:127812227-127812249 TGGCATAACTCTTGACTGGAAGG - Intronic
962987971 3:140553040-140553062 TGGCATCTCTCTTGCCTGGAAGG - Intronic
969481972 4:7451548-7451570 GGGCATGTCAGGTGTGTGGAAGG - Intronic
970024406 4:11607190-11607212 GAGCATTTCTCTTGTGTGTAAGG + Intergenic
972801389 4:42479295-42479317 GGGCATATATTTTCTGTGCAGGG - Intronic
986036463 5:3945079-3945101 GGGCAGAGCTCATGTGAGGACGG - Intergenic
989167132 5:38443381-38443403 GGGGATTTCTTTTCTGTGGATGG + Intronic
993703695 5:91146933-91146955 GGGCATATCTCTTGAGCTCAGGG + Intronic
995170683 5:109108034-109108056 GAGCCAATCTCTTGTGTGCAAGG + Intronic
1008296622 6:49786251-49786273 TGGCATATCTCCTGGCTGGATGG - Exonic
1008538153 6:52523467-52523489 TTGCATATCTCTTCTGTGTAAGG - Intronic
1008803622 6:55401083-55401105 AGGCATATCCCTTTTTTGGATGG + Intronic
1009560184 6:65230638-65230660 GGGCCTATCTCACATGTGGAGGG + Intronic
1024118435 7:46214070-46214092 GGCTGTATCTCTTTTGTGGAAGG + Intergenic
1024241123 7:47437283-47437305 GGTCATATCTCTTTTCTGAAAGG + Exonic
1024525856 7:50348834-50348856 GGGCCTATCTCCTTTGTTGAAGG - Intronic
1027136799 7:75630230-75630252 GGGCATATCTCTTGAGCTCAGGG + Intronic
1027412903 7:77941380-77941402 TGACATATCTGTTGTATGGAGGG + Intronic
1027450632 7:78327167-78327189 AGGCAGCTCTCTTGAGTGGAGGG + Intronic
1029497300 7:100902882-100902904 GGGCACCTCTCTAGTGAGGAGGG - Intergenic
1036212981 8:6857618-6857640 GGGCAGATCACTTGAGTTGAGGG + Intergenic
1037294222 8:17383737-17383759 GCTCATTTCTCTTGTCTGGAGGG + Intronic
1039432660 8:37537336-37537358 GAGCAAATCTGTTGTGTGAAAGG - Intergenic
1041493982 8:58465827-58465849 GGGCTTTTCTCTTGTGGGCAGGG - Intergenic
1049154682 8:141059474-141059496 GGGCATCTGTTTTGTGGGGATGG + Intergenic
1053678743 9:40464973-40464995 GGGCAGAACTCCTGTGGGGAGGG + Intergenic
1053928728 9:43093326-43093348 GGGCAGAACTCCTGTGGGGAGGG + Intergenic
1054284980 9:63159969-63159991 GGGCAGAACTCCTGTGGGGAGGG - Intergenic
1054291821 9:63300511-63300533 GGGCAGAACTCCTGTGGGGAGGG + Intergenic
1054389839 9:64605054-64605076 GGGCAGAACTCCTGTGGGGAGGG + Intergenic
1054505875 9:65911322-65911344 GGGCAGAACTCCTGTGGGGAGGG - Intergenic
1054744616 9:68842120-68842142 GGGCATTTCTCATGCTTGGATGG + Intronic
1057646491 9:96879677-96879699 GGCCATAGCTCTTGTTGGGATGG - Intergenic
1058108381 9:101002188-101002210 GGGGTTATTTCTTGTGTGGTAGG + Intergenic
1058159134 9:101548861-101548883 GGGCATATATATACTGTGGAAGG + Intronic
1059248998 9:112871421-112871443 GGGAATATCTCTTTTGTGCTTGG - Exonic
1060406479 9:123375495-123375517 GGAAATACCTCTTGTGTGGGGGG - Intronic
1185839180 X:3372845-3372867 GTGCATTTCTCTTGTAGGGAAGG - Intergenic
1186078001 X:5901275-5901297 GTGCATAACTCATGTGTGGCAGG + Intronic
1186666635 X:11723621-11723643 GGGCAGATCTCTTGTGCCCAGGG - Intergenic
1187291263 X:17955688-17955710 GAGCAGATCTCTTTTGTGCAGGG + Intergenic
1187715160 X:22095463-22095485 TGACAAATCTATTGTGTGGAGGG + Intronic
1190473178 X:50802916-50802938 TGTCATATTGCTTGTGTGGATGG - Intronic
1192036706 X:67570913-67570935 GGGCATATTCCTTGTTTGAATGG + Intronic
1192625117 X:72719177-72719199 GGACATATCTTTTGTGGGGGTGG - Intergenic
1193575812 X:83194154-83194176 GGGCAGAACTCTAGTGTGCAAGG - Intergenic