ID: 1082079375

View in Genome Browser
Species Human (GRCh38)
Location 11:48000353-48000375
Sequence CACAGCTGGCCTCCAAGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1334
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 1248}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082079375 Original CRISPR CACAGCTGGCCTCCAAGTCC TGG Intronic
900240135 1:1612764-1612786 CAAGGCTGGTCTCCAACTCCTGG + Intergenic
900317593 1:2066844-2066866 CAAGGCTGGTCTCCAACTCCTGG - Intronic
900689690 1:3973162-3973184 CCTAGCTGGCCTCAAACTCCTGG + Intergenic
901013941 1:6217077-6217099 CAAAGATGGTCTCCAACTCCTGG + Intronic
901188210 1:7388587-7388609 CAGGGCTGGGCTCCAAGGCCGGG - Intronic
901399035 1:9003506-9003528 CACCGATGGCCTCCTAGACCAGG + Exonic
901469086 1:9443209-9443231 CCCAGCTGGCCTCAAACTCCTGG - Intergenic
901667285 1:10833453-10833475 CAGAGCTGGTCTCGAACTCCTGG - Intergenic
901802651 1:11717771-11717793 CAAGGCTGGTCTCCAACTCCGGG - Intronic
901951290 1:12749400-12749422 CCCAGCTGGTCTCGAACTCCTGG - Intronic
902858463 1:19226781-19226803 CCAAGCTGGCCTCAAACTCCTGG + Intronic
902876685 1:19344660-19344682 CAGAGCTGGCCGCCAATCCCTGG - Intronic
903055928 1:20635955-20635977 CCCAGCTGGTCTTCAACTCCTGG - Intronic
903162508 1:21499278-21499300 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
903291917 1:22319380-22319402 CGCTGCTGCCCTCCAAGGCCAGG + Intergenic
903398869 1:23024056-23024078 CCCAGCTGGCCTCGAACTTCTGG + Intronic
903417766 1:23196048-23196070 CACGGCTGGTCTCAAACTCCTGG + Intergenic
903619885 1:24690304-24690326 CAAGGCTGGCCTCAAACTCCTGG - Intergenic
903770731 1:25762635-25762657 CACGGCTGGTCTCAAACTCCTGG + Intronic
904018882 1:27446569-27446591 CAAGGCTGGCCTCCAACTCCTGG - Intronic
904524497 1:31122543-31122565 CCAAGTTGGCCTCCAATTCCTGG - Intergenic
904533269 1:31182527-31182549 CACAGCTGTCCTCCTCCTCCAGG + Exonic
904731135 1:32592324-32592346 CCGAGCTGGTCTCCAACTCCTGG - Intronic
904738397 1:32652440-32652462 CAGGGCTGGTCTCCAACTCCTGG - Intronic
904771692 1:32884675-32884697 CACAGCTGGCCCCCCAGGCCTGG + Intergenic
904899396 1:33844618-33844640 CACTGCTGGGCTGCAAATCCTGG + Intronic
905056996 1:35104024-35104046 CCAAGCTGGCCTCAAATTCCTGG - Intronic
905150258 1:35921543-35921565 TCCAGCTGGCCTCCAAGCCTGGG - Exonic
905593718 1:39187758-39187780 CCAAGCTGGCCTCAAACTCCTGG + Intronic
905754009 1:40492070-40492092 CCAAGCTGGCCTCGAATTCCTGG + Intronic
905880720 1:41461793-41461815 CCCAGGTGGTCTCCAACTCCTGG + Intergenic
906956522 1:50379843-50379865 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
907284162 1:53369658-53369680 CCAGGCTGGCCTCAAAGTCCTGG - Intergenic
907298860 1:53472704-53472726 CCCAGCTGGGCAGCAAGTCCTGG - Intergenic
907370331 1:53998393-53998415 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
907690834 1:56663888-56663910 CAAAGCTGGTCTCAAACTCCTGG - Intronic
907984350 1:59515974-59515996 CACTGCTGGCATCTAAGTTCAGG - Intronic
908190520 1:61698792-61698814 CTCTGCTGGCCTCAAACTCCTGG + Intronic
908200906 1:61794352-61794374 CCAGGCTGGCCTCAAAGTCCTGG + Intronic
908682302 1:66675741-66675763 CCCAGCTGGTCTCGAACTCCTGG + Intronic
908718518 1:67097147-67097169 CCCAGCTGGCCTCAAACTCCTGG - Intronic
908841991 1:68289135-68289157 CCAAGCTGGCCTCGAACTCCTGG - Intergenic
909437496 1:75659578-75659600 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
910813500 1:91263530-91263552 CTAAGCTGGCCTCAAACTCCTGG - Intronic
910966338 1:92811646-92811668 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
910994159 1:93086292-93086314 CCCAGCTGGTCTCAAACTCCTGG - Intronic
910997117 1:93117815-93117837 CAGAGCTGGTCTCCAATTCCTGG - Intronic
911002612 1:93181105-93181127 CAAGGCTGGCCTCGAACTCCTGG - Intronic
911038483 1:93573836-93573858 CCCAGCTGGTCTCGAATTCCTGG + Intronic
911542590 1:99175959-99175981 CACACCTGGGTTCCAAGACCAGG - Intergenic
911857643 1:102901108-102901130 CCCAGCTGGTCTCGAACTCCTGG - Intronic
912414968 1:109501902-109501924 CACTGCAGGGCTCCACGTCCTGG + Intronic
912539402 1:110401861-110401883 CCAAGCTGGCCTCAAACTCCTGG + Intronic
912679427 1:111719796-111719818 CACAGATCACCTCCATGTCCTGG - Intronic
912915886 1:113813579-113813601 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
912924515 1:113902238-113902260 CCCAGCTGGTCTCAAATTCCTGG + Intronic
913002596 1:114596161-114596183 CAGGGCTGGTCTCCAACTCCTGG - Intronic
913169142 1:116216485-116216507 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
913415737 1:118604669-118604691 CCCAGCTGGACTCCAGCTCCTGG - Intergenic
913684470 1:121218418-121218440 CCCAGCTGGTCTCTAACTCCTGG + Intronic
914036309 1:144006033-144006055 CCCAGCTGGTCTCTAACTCCTGG + Intergenic
914153147 1:145061912-145061934 CCCAGCTGGTCTCTAACTCCTGG - Intronic
914665787 1:149831562-149831584 CACAGCTGGGCACTAAATCCTGG + Intergenic
914669978 1:149862232-149862254 CACAGCTGGGCACTAAATCCTGG - Intronic
915127134 1:153673761-153673783 CTAAGCTGGTCTCCAACTCCTGG + Intergenic
915135059 1:153725734-153725756 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
915193589 1:154172465-154172487 CCAGGCTGGCCTCCAACTCCTGG + Intronic
915474222 1:156143505-156143527 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
915535427 1:156532636-156532658 CCAAGCTGGCCTCAAACTCCTGG - Intronic
915596720 1:156900458-156900480 CAGAGCTGGGATCCAAATCCAGG - Intronic
915614767 1:157028955-157028977 CCCAGCTGGTCTCGAACTCCTGG - Intronic
915826389 1:159082538-159082560 CAAAGCTGGACCCTAAGTCCTGG + Intronic
916242520 1:162654234-162654256 CCAAGCTGGTCTCCAACTCCTGG - Intronic
916335842 1:163670449-163670471 CACAGCTGGGCTTCCATTCCAGG - Intergenic
916495211 1:165340304-165340326 CACTGCTGGTCTCAAACTCCTGG + Intronic
917105627 1:171488535-171488557 CCTGGCTGGCCTCCAACTCCTGG + Intronic
917409772 1:174747191-174747213 CCAAGCTGGTCTCCAATTCCTGG - Intronic
917788470 1:178484475-178484497 CACAGCCGGCCTTGAACTCCTGG - Intergenic
918032425 1:180828084-180828106 CCCAGCTGGTCTCGAATTCCTGG + Intronic
918048695 1:180956221-180956243 AACAGCTGCCCTGCCAGTCCTGG + Intergenic
918401538 1:184167759-184167781 CACAGTTTGCCTCCAAATCTTGG + Intergenic
918436045 1:184514085-184514107 CCAGGCTGGCCTCAAAGTCCTGG - Intronic
918625742 1:186654083-186654105 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
918849831 1:189672782-189672804 CCCAGCTGGCCTCGAACTCCTGG + Intergenic
919069945 1:192741471-192741493 CCCAGCTGTTCTCAAAGTCCTGG + Intergenic
919754393 1:201057750-201057772 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
920188956 1:204180099-204180121 CAAAGCTGGCCTTGAATTCCTGG - Intergenic
920259837 1:204681539-204681561 CACAGCTGGAGTTCAAATCCAGG - Intronic
920292891 1:204936409-204936431 CAAGGCTGGCCTCAAACTCCTGG + Intronic
920453422 1:206078328-206078350 CTAAGCTGGTCTCAAAGTCCTGG - Intronic
920471778 1:206236931-206236953 CCCAGCTGGTCTCTAACTCCTGG + Intronic
920627329 1:207615016-207615038 CCCAGCTGGTCTCAAACTCCTGG + Intronic
921093603 1:211867089-211867111 CCAAGCTGGCCTCAAATTCCTGG + Intergenic
921239390 1:213162490-213162512 CCCAGCTGGTCTCAAACTCCTGG + Intronic
921486544 1:215721852-215721874 CCCAGCTGGTCTCAAATTCCCGG - Intronic
922231201 1:223688291-223688313 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
922239258 1:223744830-223744852 CCCAGCTGGTCTCGAACTCCTGG - Intronic
922339852 1:224646613-224646635 CCAAGCTGGTCTCCAATTCCTGG + Intronic
922359497 1:224808616-224808638 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
922372417 1:224924781-224924803 CCAAGCTGGCCTCAAACTCCTGG + Intronic
922681799 1:227604596-227604618 CACAGCTGATCTCAAACTCCCGG + Intronic
922904273 1:229162111-229162133 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
922915027 1:229250205-229250227 CCCAGCTGGTCTCAAACTCCTGG + Exonic
923036983 1:230291457-230291479 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
923289796 1:232533398-232533420 CACAGTTCTCCTCCAAGTGCTGG + Intronic
923387674 1:233481400-233481422 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
923627018 1:235622502-235622524 CCCAGCTGGTCTCAAACTCCTGG - Intronic
923720081 1:236459406-236459428 CATGCCTGGCCTCAAAGTCCTGG + Intronic
923865256 1:237932681-237932703 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
924109704 1:240686355-240686377 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
924430701 1:243994191-243994213 CCAGGCTGGTCTCCAAGTCCTGG - Intergenic
924456861 1:244225689-244225711 CCCAGCTGGTCTCCAACTCCTGG - Intergenic
924603945 1:245516157-245516179 CAGATATGGCCTGCAAGTCCGGG - Intronic
924938113 1:248789522-248789544 CTCAGCTGGTTTCAAAGTCCTGG + Intergenic
1062874336 10:932269-932291 CACAGCTGGGATCAAGGTCCCGG + Intergenic
1062929966 10:1346393-1346415 CACAGGTGCCCTCCAACTCTGGG + Intronic
1063546767 10:6988898-6988920 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1063572295 10:7227363-7227385 CACAGCTGGGCAGCAAGTCCAGG + Intronic
1063940480 10:11123457-11123479 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1063999815 10:11654155-11654177 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1064001321 10:11665855-11665877 CCCAGCTGGTCTCAAACTCCAGG + Intergenic
1064311176 10:14213025-14213047 CACAGCTGGTTTCAAACTCCTGG - Intronic
1064616892 10:17168091-17168113 CACGGCTGGCCTAAAAGCCCTGG - Intronic
1064629618 10:17296492-17296514 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1064658636 10:17582836-17582858 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1064722636 10:18245538-18245560 CACAGCTGGTCTTAAACTCCTGG + Intronic
1064872563 10:19955241-19955263 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1065003953 10:21362564-21362586 CCAAGCTGGTCTCAAAGTCCTGG + Intergenic
1065090926 10:22232765-22232787 CCCAGCAGGTCTTCAAGTCCTGG - Intergenic
1065717788 10:28590109-28590131 CAGGGCTGGCCTCAAACTCCTGG - Intronic
1065768929 10:29058671-29058693 CAGAGCTGACTTCTAAGTCCTGG + Intergenic
1065785110 10:29205506-29205528 CCGGGCTGGCCTCCAACTCCTGG + Intergenic
1065813025 10:29459879-29459901 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1066212704 10:33255659-33255681 CAAGGCTGGGCTCCAACTCCTGG + Intronic
1066279215 10:33898768-33898790 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1066482591 10:35811580-35811602 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1066626791 10:37415303-37415325 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1067130354 10:43558656-43558678 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1067136303 10:43609893-43609915 CACGGCTGGTCTCGAACTCCTGG + Intronic
1067292552 10:44954732-44954754 CCCAGCTGGTCTCTAACTCCTGG - Intergenic
1067355678 10:45523314-45523336 CAAGGCTGGCCTCAAACTCCTGG - Intronic
1067486256 10:46653333-46653355 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1067608500 10:47688322-47688344 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1068414747 10:56705472-56705494 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1068717909 10:60208563-60208585 CTCAGCTGGTCTCAAACTCCTGG + Intronic
1068766956 10:60774924-60774946 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1068794336 10:61061629-61061651 CCAAGCTGGTCTCCAAATCCTGG + Intergenic
1069529691 10:69207523-69207545 CCCAGCTGGTCTCGAACTCCTGG + Intronic
1069552402 10:69373797-69373819 CCCAGCTGGTCTCGAACTCCTGG + Intronic
1069597960 10:69684835-69684857 CAGGGCTGAGCTCCAAGTCCAGG + Intergenic
1070155585 10:73832825-73832847 CCCAGCTGGCCTCGAATTCCTGG + Intronic
1070191444 10:74115249-74115271 CACACCTGGCTCCCAATTCCTGG - Intronic
1070233778 10:74601881-74601903 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1070243903 10:74711846-74711868 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1070698673 10:78582744-78582766 CAAAGCTGGCCTGGAACTCCAGG + Intergenic
1070900768 10:80027068-80027090 CAGGGCTGGCCTCAAACTCCTGG - Intergenic
1070901475 10:80033585-80033607 CAGGGCTGGCCTCAAACTCCTGG - Intergenic
1071431150 10:85608026-85608048 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1071624086 10:87149957-87149979 CCAAGCTGGCCTCGAACTCCTGG + Intronic
1072014909 10:91337138-91337160 CACAGGTGGTCTCAAACTCCTGG - Intergenic
1072050234 10:91697079-91697101 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1072333649 10:94377916-94377938 CAAAGCTGGTCTCTAACTCCTGG + Intergenic
1072798804 10:98377514-98377536 CACAGCTGGACTCCCTGTTCAGG + Intergenic
1072961454 10:99933083-99933105 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1072964873 10:99963278-99963300 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1073039431 10:100592120-100592142 CCAAGCTGGTCTCCAACTCCAGG - Intergenic
1073204192 10:101760053-101760075 CAGAGCTGGGCTCCTTGTCCTGG + Intergenic
1073272580 10:102278045-102278067 CAAAGCTGGTCTCAAACTCCTGG - Intronic
1073834459 10:107425213-107425235 CAAGGCTGGCCTCAAACTCCTGG - Intergenic
1074451401 10:113562652-113562674 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1074504253 10:114053942-114053964 CAGAGCTGGTCTCAAACTCCTGG + Intergenic
1074821776 10:117185149-117185171 AAGACCTGGCCTCCAAGACCAGG - Intergenic
1075020603 10:118949313-118949335 CTCAGCTGGAATGCAAGTCCAGG + Intergenic
1075126391 10:119703473-119703495 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
1075127664 10:119713597-119713619 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1075150129 10:119921382-119921404 CACTGCTGGTCTCAAACTCCTGG + Intronic
1075414156 10:122250084-122250106 CCCAGGTGGCCTCTAATTCCAGG + Intronic
1075738088 10:124676488-124676510 CACAGCTGGCCTGCAGCTGCTGG + Intronic
1076055752 10:127371216-127371238 CACAACTAGCCTCTAATTCCAGG - Intronic
1077001736 11:326804-326826 CACAGCAGCCCTCCAGGCCCAGG + Intronic
1077021929 11:420815-420837 CTCTGCGGGCCTCCGAGTCCGGG - Exonic
1077029230 11:456384-456406 CCGAGCTGGTCTCCAACTCCTGG + Intronic
1077209184 11:1360557-1360579 AACAGATGGCTTCCAAGTCCCGG + Intergenic
1077250452 11:1558478-1558500 CACGGCTGGCCTCCGACTGCAGG + Intronic
1077290801 11:1790968-1790990 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1077364970 11:2157993-2158015 GCCAGCTGCCCTGCAAGTCCTGG + Intronic
1077429803 11:2510758-2510780 CAGAGCCTGCCTCCAGGTCCTGG + Intronic
1078597733 11:12702995-12703017 CACAGCTGGGATTCAAGCCCAGG + Intronic
1078640995 11:13096083-13096105 CAAAGCTGGTCTCGAATTCCTGG + Intergenic
1078721925 11:13892875-13892897 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1078766771 11:14305833-14305855 CCCAGCTGGTCTCGAATTCCTGG - Intronic
1078830004 11:14969793-14969815 AACAGCTGGGCCCCAGGTCCCGG + Intronic
1079048840 11:17134708-17134730 CAAGGCTGGTCTCCAACTCCTGG + Intronic
1079215779 11:18510209-18510231 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1079419207 11:20270429-20270451 CCTAGCTGGTCTCCAACTCCTGG + Intergenic
1080001401 11:27354642-27354664 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1080490085 11:32753015-32753037 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1080522883 11:33083001-33083023 GCCAGCTGGCCTCGAACTCCTGG + Intronic
1080547126 11:33331586-33331608 CCAAGCTGGTCTCAAAGTCCTGG + Intronic
1080904261 11:36524698-36524720 CAGAGTTGGCCTCAAACTCCTGG + Intronic
1080976763 11:37351660-37351682 CCCAGCTGGCCTCAAACTTCTGG - Intergenic
1081466969 11:43329130-43329152 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1081608318 11:44541699-44541721 CGCAGCCAGCCTCCAACTCCTGG - Intergenic
1081692797 11:45089487-45089509 CCCAGCTGGCCTCCAAGGCCAGG + Intergenic
1082011352 11:47451789-47451811 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1082039343 11:47672158-47672180 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1082079375 11:48000353-48000375 CACAGCTGGCCTCCAAGTCCTGG + Intronic
1082217789 11:49595779-49595801 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1083016510 11:59459595-59459617 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1083059994 11:59859919-59859941 CTCAGCTGGGCTCCATGGCCTGG - Intronic
1083159650 11:60847315-60847337 CCCGGCTGGTCTCCAACTCCTGG + Intronic
1083291086 11:61690608-61690630 CACAGCAGGGGTCCAAGTCTAGG + Intronic
1083438412 11:62659366-62659388 CTAGGCTGGCCTCCAACTCCTGG - Intronic
1083671407 11:64301878-64301900 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1083858192 11:65404313-65404335 CACAGCTGGGCACCAAGGACAGG - Intronic
1084052114 11:66606655-66606677 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1084096604 11:66915550-66915572 CACAGCTGGCCCTCAGCTCCAGG - Intronic
1084136768 11:67189512-67189534 CCAAGCTGGCCTCAAAATCCTGG - Intronic
1084621860 11:70277223-70277245 CCCAGCTGGTCTTCAACTCCTGG + Intronic
1084623433 11:70289865-70289887 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1084952834 11:72676183-72676205 CACAGCTCCCCTTCATGTCCTGG + Intergenic
1084966286 11:72746349-72746371 CACAGCTGGTCTCCAGGTGCCGG - Intronic
1084974046 11:72786868-72786890 CTAAGCTGGTCTCCAACTCCTGG - Intronic
1085010151 11:73134259-73134281 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1085071016 11:73545756-73545778 CACGGCTGGACTCAAACTCCTGG + Intronic
1085450814 11:76631145-76631167 GACAGCTGGCCTTGAACTCCAGG - Intergenic
1085577955 11:77624051-77624073 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1085628512 11:78092793-78092815 CTCAGCTGGTCTCGAACTCCTGG + Intergenic
1086339989 11:85838951-85838973 CAAGGCTGGCCTCAAATTCCTGG + Intergenic
1087062558 11:93995276-93995298 CACGGCTGGTCTCAAACTCCTGG + Intergenic
1087749495 11:101990961-101990983 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1087936079 11:104036228-104036250 CCGGGCTGGCCTCCAACTCCTGG - Intronic
1087948269 11:104191881-104191903 CAAGGCTGGTCTCCAACTCCTGG + Intergenic
1088030555 11:105243454-105243476 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
1088853749 11:113727589-113727611 CCCAGCTGGTCTTGAAGTCCTGG - Intergenic
1088897780 11:114091137-114091159 CCAAGCTGGTCTCCAACTCCAGG - Intronic
1088935004 11:114390746-114390768 ACCAGCTGGTCTCCAACTCCTGG - Intergenic
1089064784 11:115654233-115654255 CCCAGCTGTTCTCCTAGTCCCGG - Intergenic
1089344051 11:117778786-117778808 CAGAGCTGGGCTCCAAACCCAGG + Intronic
1089483712 11:118828451-118828473 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1089657160 11:119957552-119957574 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1089842756 11:121432622-121432644 CAAGGCTGGCCTCAAACTCCTGG - Intergenic
1090102705 11:123817186-123817208 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1090120844 11:124026191-124026213 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1091084747 11:132710641-132710663 CCAAGCTGGTCTCAAAGTCCTGG - Intronic
1091265622 11:134269108-134269130 CAGGGCTGGCCTCAAACTCCTGG - Intergenic
1091394437 12:145040-145062 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1091446792 12:548319-548341 CCCACCTGGCCTCCATCTCCAGG - Intronic
1091625405 12:2117571-2117593 CAGAGCTGGACTTCAAATCCAGG + Intronic
1092187358 12:6490679-6490701 TAAGGCTGGCCTCCAACTCCTGG + Intergenic
1092198605 12:6565682-6565704 CCAAGCTGGTCTCCAATTCCTGG + Intronic
1092220734 12:6711363-6711385 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1092493401 12:8967510-8967532 CACAGCTGGTCTCAAACTCCTGG - Intronic
1092757371 12:11776452-11776474 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
1092816394 12:12315900-12315922 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1093233710 12:16580173-16580195 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1094255749 12:28424137-28424159 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1094547714 12:31420344-31420366 CTCAGCTGGTCTCAAACTCCTGG + Intronic
1094622597 12:32094415-32094437 CTCAGCTGGTCTCGAACTCCTGG + Intergenic
1094658741 12:32445955-32445977 CAAGGCTGGTCTCGAAGTCCTGG - Intronic
1094695428 12:32813568-32813590 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1095234333 12:39778365-39778387 TACAGCTGGCCCCCAAGAGCTGG - Intronic
1096129451 12:49146080-49146102 CAGAGCTGGTCTCTAACTCCTGG - Intergenic
1096131856 12:49165677-49165699 CTCAGCTGGTCTTCAACTCCTGG + Intergenic
1096169485 12:49455829-49455851 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1096215963 12:49797432-49797454 CACAGCTGGGATCCAGTTCCAGG + Intronic
1096333899 12:50738432-50738454 CCCAGTTGGCCTCAAACTCCTGG - Intronic
1096449240 12:51723272-51723294 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1096504783 12:52085920-52085942 GACAGCTTGCCTCCAACTCAAGG - Intergenic
1096526833 12:52215004-52215026 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
1096601883 12:52735537-52735559 CAGACCTGGTCTCCAAATCCAGG + Intergenic
1096628332 12:52908794-52908816 CTCAGCTGGTCTCAAACTCCTGG - Intronic
1096667734 12:53177847-53177869 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1096949771 12:55455748-55455770 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
1096989377 12:55787018-55787040 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1096991914 12:55811345-55811367 CAGGGCTGGCCTCAAACTCCTGG - Intronic
1097029099 12:56079278-56079300 CCCAGGTGCCTTCCAAGTCCAGG - Intergenic
1097109663 12:56649055-56649077 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1097181697 12:57175374-57175396 CCCTGCTGGGCCCCAAGTCCTGG - Intronic
1097291722 12:57922265-57922287 CCCAGCTGGTCTCAACGTCCTGG - Intergenic
1097300648 12:58015081-58015103 CCCAGCTGGTCCCCAATTCCTGG + Intergenic
1098060868 12:66560916-66560938 CACAGGTTGCTTCCAAATCCTGG - Intronic
1098251627 12:68576045-68576067 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1098596065 12:72273637-72273659 CCCAGCTGGCTTCCAATACCCGG + Intronic
1099015431 12:77338425-77338447 CCAAGCTGGTCTCAAAGTCCTGG - Intergenic
1099873057 12:88371580-88371602 CACAGCTGGGCTGGAAGTGCAGG + Intergenic
1099910546 12:88827816-88827838 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1099962882 12:89413404-89413426 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1100173166 12:92000353-92000375 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1100338422 12:93655134-93655156 CCCAGCTGGACTCAAACTCCTGG + Intergenic
1100488619 12:95056055-95056077 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1100987885 12:100221870-100221892 CCAAGCTGGCCTCCAACTCCTGG + Intronic
1101147364 12:101853856-101853878 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1101379993 12:104206171-104206193 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1101414996 12:104501220-104501242 CACAGCTGGGCCACAAGCCCAGG + Intronic
1101839408 12:108317010-108317032 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1102080584 12:110094712-110094734 CCCAGCTGGTCTCCAACTCGTGG - Intergenic
1102195196 12:111020489-111020511 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1102256668 12:111419099-111419121 CCAAGCTGGTCTCGAAGTCCTGG - Intronic
1102337430 12:112093668-112093690 CAGAGCTGGTCTCGAATTCCTGG - Intronic
1102388949 12:112534383-112534405 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1102564631 12:113787686-113787708 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1102586314 12:113925532-113925554 CAAAGCTGGGATCCAAGCCCAGG + Intronic
1102824777 12:115939826-115939848 CCAAGCTGGACTCCAACTCCTGG - Intergenic
1102919652 12:116782307-116782329 CCAAGCTGGTCTCAAAGTCCTGG - Intronic
1103021208 12:117535896-117535918 CAAAGCTGGGATCCAACTCCAGG + Intronic
1103026282 12:117576863-117576885 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1103094745 12:118123708-118123730 CTCAGCTGGTCTCAAACTCCTGG + Intronic
1103153918 12:118667177-118667199 CCTAGCTGGTCTCCAACTCCTGG - Intergenic
1103277533 12:119725211-119725233 CCCAGCTTGTCTCCAACTCCTGG - Intronic
1103361179 12:120354982-120355004 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1103369220 12:120405674-120405696 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1103511137 12:121475295-121475317 CACACCTGGCCTCCAAGTTTTGG - Intronic
1103519995 12:121531881-121531903 CCCGGCTGGTCTCCAACTCCTGG - Intronic
1103520699 12:121535848-121535870 CAGAGAAGGCTTCCAAGTCCAGG + Intronic
1103641078 12:122352942-122352964 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1103669075 12:122596629-122596651 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1103713500 12:122929817-122929839 CCCAGCTGCCCTCCGAGCCCAGG - Exonic
1103746359 12:123127248-123127270 CACCGCTGCCCTCCATTTCCTGG + Intronic
1104400869 12:128475099-128475121 CACAGCAGGGCTTCAACTCCAGG + Intronic
1104460693 12:128953384-128953406 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1104685958 12:130784296-130784318 CTAGGCTGGCCTCCAACTCCTGG - Intergenic
1104864776 12:131946589-131946611 CACAGGTGGTCTCAAACTCCTGG + Intergenic
1104964090 12:132501255-132501277 CACAGCTGGACTAGAATTCCGGG + Intronic
1105018455 12:132800747-132800769 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1105062707 12:133168471-133168493 CAAGGCTGGCCTCAAACTCCTGG + Intronic
1105420954 13:20251879-20251901 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
1105496534 13:20935610-20935632 CTGGGCTGGCCTCCAACTCCTGG - Intergenic
1105524220 13:21160912-21160934 CAATGCTGGCCTCAAACTCCTGG - Intronic
1106017729 13:25885024-25885046 CTGAGCTGGCCTCCATGTCCTGG + Intronic
1106044651 13:26127628-26127650 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1106268043 13:28127433-28127455 CCCGGCTGGTCTCCAAATCCTGG + Intergenic
1106449315 13:29865466-29865488 CACAGCCTGCCTCCAGCTCCTGG + Intergenic
1106568870 13:30908911-30908933 CCAAGCTGGCCTCGAAGTCCTGG - Intronic
1106781135 13:33060152-33060174 CCCAGCTGGTCTCCAACTCCTGG + Intronic
1107323896 13:39219422-39219444 CCAAGATGGCCTCCAACTCCTGG - Intergenic
1107479750 13:40776312-40776334 CCCAGCTGGTCTCTAACTCCTGG - Intergenic
1107538195 13:41357109-41357131 CCAGGCTGGCCTCCAAATCCTGG - Intronic
1108314747 13:49226197-49226219 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
1108682685 13:52792949-52792971 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1109059610 13:57597929-57597951 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1109334500 13:60975829-60975851 CAGAGCTGGGATCCAAATCCAGG + Intergenic
1109457794 13:62615526-62615548 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1109593641 13:64521492-64521514 CCCAGCTGGTCTTCAAGTCCTGG - Intergenic
1109830676 13:67782857-67782879 CCAAGCTGGCCTCCAACTCCTGG + Intergenic
1110016301 13:70409562-70409584 CCCAGCTGGACTCAAACTCCTGG - Intergenic
1110271407 13:73595186-73595208 CAGGGCTGGCCTCAAACTCCTGG - Intergenic
1111134612 13:84024930-84024952 CCCGGCTGGTCTCCAACTCCTGG - Intergenic
1111470609 13:88676279-88676301 CAAAGCTGGTCTCAAACTCCTGG - Intergenic
1111925808 13:94462296-94462318 CATAGCTGGTCTCAAACTCCTGG - Intronic
1112315107 13:98354049-98354071 TAAAGCTTCCCTCCAAGTCCAGG + Intronic
1112322677 13:98421646-98421668 CAAAGCTGGCCTTGAATTCCTGG - Intronic
1112348790 13:98615444-98615466 CCAAGCTGGTCTCAAAGTCCTGG + Intergenic
1112502216 13:99951874-99951896 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1113468408 13:110527847-110527869 CCAAGCTGGGCTCCAACTCCTGG - Intronic
1113675538 13:112204536-112204558 CGCAGCTGGCCTCCAAGCTGTGG + Intergenic
1114168640 14:20248410-20248432 TCCAGCTGGTCTCCAACTCCTGG - Intergenic
1114497016 14:23139798-23139820 CAGGGCTGGCCTCGAACTCCTGG - Intronic
1114520450 14:23331053-23331075 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1114650702 14:24282828-24282850 CACTGCTGGCATTTAAGTCCAGG + Intergenic
1114882065 14:26798453-26798475 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1114982493 14:28183000-28183022 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1115382368 14:32755734-32755756 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1115447209 14:33504873-33504895 CTCAGCTGTCTTCCAAGTCTGGG - Intronic
1115556497 14:34548524-34548546 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1116080601 14:40166006-40166028 CACAGGTTGCTTCCAAATCCTGG - Intergenic
1116261245 14:42630058-42630080 CTCACCTGGCCTCAAAGACCAGG + Intergenic
1116382110 14:44282484-44282506 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1117296544 14:54385623-54385645 GACAGCTGTGTTCCAAGTCCAGG - Intergenic
1117348279 14:54855602-54855624 CCAAGCTGGCCTCGAACTCCTGG - Intronic
1117353817 14:54904488-54904510 CAAAGCTGGTCTCGAACTCCAGG + Intergenic
1117354239 14:54908195-54908217 CCCGGCTGGCCTCAAACTCCTGG - Intergenic
1117390620 14:55258892-55258914 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1118576646 14:67248309-67248331 CTCAGCTGGACTCAAACTCCTGG - Intronic
1118663988 14:68046527-68046549 CCAGGCTGGCCTCCAATTCCTGG - Intronic
1119237718 14:73033511-73033533 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1119280934 14:73407050-73407072 CCAGGCTGGCCTCCAACTCCCGG + Intronic
1119453264 14:74731042-74731064 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1119580679 14:75777035-75777057 CCAAGCTGGCCTCGAATTCCTGG - Intronic
1119794953 14:77387839-77387861 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1120191843 14:81446776-81446798 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
1120444860 14:84581788-84581810 CAGAGGTGGCCTCCAAGTCCAGG + Intergenic
1120914932 14:89702248-89702270 CACAACTGGACTTCAAGTCCTGG - Intergenic
1121002077 14:90458682-90458704 CACTGCTGGGATCCCAGTCCAGG - Intergenic
1121150353 14:91627756-91627778 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1121474907 14:94190086-94190108 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1122892115 14:104736954-104736976 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1122904252 14:104794874-104794896 CCCAGCTGCCCTCCAAGCCTTGG + Intronic
1123414891 15:20088138-20088160 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1123524233 15:21095252-21095274 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1124446919 15:29743514-29743536 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1124666029 15:31593603-31593625 CAGAGGTGGCCTCCATGTCCTGG - Intronic
1124702980 15:31933148-31933170 CACAGCTTGTCTCCAACTCATGG + Intergenic
1125528028 15:40391002-40391024 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1125655573 15:41354164-41354186 CCCAGCTGGCCTCAAAATCCTGG - Intronic
1125782398 15:42281472-42281494 CATAGCTGGTCTCAAACTCCTGG - Intronic
1125994064 15:44139679-44139701 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1126163730 15:45636036-45636058 CCCAGCTGGTCTCGAACTCCTGG + Intronic
1126583448 15:50261569-50261591 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1126664204 15:51061213-51061235 CAAAGCTGGCCTTGAACTCCAGG + Intronic
1127418093 15:58776810-58776832 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1127420767 15:58803605-58803627 AACAGCTGGTCTCGAACTCCTGG - Intronic
1127470271 15:59283746-59283768 CACAGCTGGGCTTCAAACCCAGG + Intronic
1127490400 15:59456782-59456804 CCCAGCTGGCCTCGAAATTCTGG + Intronic
1127653586 15:61033857-61033879 CCCAGCTGGTCTCAAAGTTCTGG - Intronic
1127786937 15:62364009-62364031 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1127924995 15:63530520-63530542 CAAAGCTGGTCTCGAACTCCTGG + Intronic
1128241257 15:66102650-66102672 CTAAGCTGGCCTCAAACTCCTGG + Intronic
1128294563 15:66506764-66506786 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1128881471 15:71247105-71247127 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1129199195 15:73988785-73988807 AACAGCTGGCCTCTAAGGACGGG - Exonic
1129358648 15:75010601-75010623 CACAGCTGGTCTCAAATTCCTGG - Intronic
1129866544 15:78913415-78913437 CACAGGTGGCCACCAAGAGCAGG + Intergenic
1130126101 15:81095318-81095340 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1130130651 15:81139090-81139112 CAAAGCTGGTCTACAACTCCTGG - Intronic
1130601264 15:85275609-85275631 CCAGGCTGGCCTCCAATTCCTGG - Intergenic
1131017403 15:89069335-89069357 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1131185621 15:90271554-90271576 CAAAGCTCTCCTCCAGGTCCTGG - Exonic
1131453992 15:92569083-92569105 CAGAGCTGGTCTCAAACTCCTGG - Intergenic
1131803039 15:96091500-96091522 CCCAGCTGGTCTCCAACTCCTGG + Intergenic
1132029794 15:98430278-98430300 CACAGCCGGCCTCCAACCCCTGG - Intergenic
1132127018 15:99236595-99236617 CCCGGCTGGTCTCCAACTCCTGG + Intronic
1132752853 16:1466741-1466763 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1133000955 16:2851363-2851385 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1133179914 16:4046058-4046080 CCGGGCTGGCCTCCAAATCCTGG + Intronic
1133259021 16:4536725-4536747 CCCAGCTGGTCTCTAACTCCTGG - Intronic
1133274782 16:4631029-4631051 CCAGGCTGGCCTCAAAGTCCTGG + Intronic
1133469933 16:6065242-6065264 CACGGCTGGTCTCAAACTCCTGG + Intronic
1133596015 16:7293578-7293600 CTCATCTGGCCTGCGAGTCCAGG - Intronic
1133769629 16:8860201-8860223 CGCAGCAGGCCCCCCAGTCCTGG - Intronic
1133827471 16:9291213-9291235 CACAGCTGGGATTCAAGCCCAGG + Intergenic
1133863647 16:9620747-9620769 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1134168430 16:11948926-11948948 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1134311417 16:13078613-13078635 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1134420647 16:14085067-14085089 CAAGGCTGGTCTCCAACTCCAGG - Intronic
1134448864 16:14351228-14351250 CTCAGCTGGTCTCAAACTCCTGG + Intergenic
1134465112 16:14468830-14468852 CCCAGCTGGTCTCCTATTCCTGG - Intronic
1134622833 16:15702613-15702635 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1134850902 16:17478028-17478050 CCAAGCTGGTCTCAAAGTCCTGG - Intergenic
1135079315 16:19420670-19420692 CTAAGCTGGTCTCCAACTCCTGG + Intronic
1135096826 16:19571424-19571446 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1135173753 16:20209883-20209905 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1135357006 16:21777415-21777437 CCAGGCTGGCCTCAAAGTCCTGG + Intergenic
1135408687 16:22216950-22216972 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1135414131 16:22256305-22256327 CACGGTTGGTCTCCAACTCCTGG + Intronic
1135455509 16:22593529-22593551 CCAGGCTGGCCTCAAAGTCCTGG + Intergenic
1135542222 16:23339455-23339477 CAAGGCTGGCCTCAAACTCCTGG + Intronic
1135668495 16:24355362-24355384 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1135688755 16:24519543-24519565 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1135776349 16:25259982-25260004 CCAAGCTGGTCTCCAATTCCTGG - Intergenic
1135829548 16:25761231-25761253 CACAGCTGCCATCCAATTCACGG + Intronic
1136085635 16:27882894-27882916 CAAGGCTAGCCTCCAACTCCTGG - Intronic
1136111848 16:28068353-28068375 CCCTGCTGGTCTCCAATTCCTGG - Intergenic
1136473414 16:30496852-30496874 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1137279909 16:46967304-46967326 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1137514332 16:49130007-49130029 CAAGGCTGGTCTCCAACTCCTGG + Intergenic
1137584188 16:49654265-49654287 CAGAGCTGGCCCCCAAGTCATGG - Intronic
1137600216 16:49751414-49751436 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1137664335 16:50240449-50240471 CACAGCTGGCCAGAAACTCCAGG - Intergenic
1138710708 16:58967357-58967379 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1138958186 16:61996788-61996810 CAAAGCTGGTCTCGAACTCCCGG + Intronic
1139383264 16:66548021-66548043 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1139387734 16:66584888-66584910 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1139435926 16:66936311-66936333 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1139438303 16:66949358-66949380 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1139484313 16:67247429-67247451 CGCAGCGCGCCTCCGAGTCCCGG + Exonic
1139509974 16:67421985-67422007 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1139610262 16:68051598-68051620 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1139655689 16:68386011-68386033 CTTAGCTGGTCTCCAACTCCTGG - Intronic
1139695885 16:68674521-68674543 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1139702258 16:68715214-68715236 CACGGCTGGTCTCGAACTCCTGG - Intronic
1139783874 16:69374545-69374567 CACTGCTGCCCTCAAATTCCTGG - Intronic
1139843828 16:69904578-69904600 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1140087042 16:71806451-71806473 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1140227240 16:73088360-73088382 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1140451530 16:75074856-75074878 CCAGGCTGGCCTCCAAGTCCTGG - Intronic
1140611355 16:76602838-76602860 CCACGCTGGCCTCCAACTCCTGG + Intronic
1140674823 16:77317541-77317563 CCCAGCTGGTCTCGAACTCCTGG + Intronic
1140741465 16:77945497-77945519 CAAAGCTGGTCTCGAATTCCTGG + Intronic
1140759980 16:78101528-78101550 CCCGGCTGGTCTCCAACTCCTGG + Intronic
1141132078 16:81444164-81444186 CCCAGCCGGCCTCGAACTCCTGG - Intergenic
1141516740 16:84549911-84549933 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1141570615 16:84931460-84931482 CAGAGCTGGCCTCCCAGCCCCGG + Intergenic
1141668156 16:85476820-85476842 CCCAGCTGGCCTTGAACTCCTGG + Intergenic
1141686508 16:85573206-85573228 CCAGGCTGGCCTCGAAGTCCTGG + Intergenic
1141692406 16:85603714-85603736 CTGAGCTGGTCTCCAACTCCAGG + Intergenic
1141873531 16:86806097-86806119 CAGAGCTGGAATCCAAGCCCAGG + Intergenic
1142612021 17:1113956-1113978 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1142714102 17:1738649-1738671 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1142756970 17:2022359-2022381 CCGAGCTGGCCTCGAACTCCTGG + Intronic
1143195424 17:5072668-5072690 CACAGCTGTCCTTGAGGTCCAGG - Intergenic
1143546693 17:7600968-7600990 CCAAGCTGGCCTCGAACTCCTGG - Intronic
1143947515 17:10606072-10606094 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1144391483 17:14797801-14797823 GACAGCGTGCCTCCAAATCCTGG - Intergenic
1144750254 17:17643493-17643515 CCAGGCTGGCCTCAAAGTCCTGG - Intergenic
1144871157 17:18372012-18372034 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1144999419 17:19293167-19293189 CCAAGCTGGCCTCGAACTCCTGG - Intronic
1145291833 17:21552857-21552879 CACAGGTGCACCCCAAGTCCAGG - Intronic
1145321289 17:21768929-21768951 CCCAGCTGGTCTCCAGCTCCTGG + Intergenic
1145388197 17:22434073-22434095 CACAGATGCACTCCAAGTCCAGG + Intergenic
1145755571 17:27387638-27387660 CCAAGCTGGCCTCGAACTCCTGG + Intergenic
1145771350 17:27495447-27495469 CAGACATGTCCTCCAAGTCCTGG - Intronic
1145781093 17:27563816-27563838 AAGAGCTGACCTCTAAGTCCCGG - Intronic
1145930568 17:28682413-28682435 CCAGGCTGGCCTCCAAATCCTGG - Intronic
1145987770 17:29058873-29058895 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1146144552 17:30401693-30401715 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1146394142 17:32449193-32449215 CAGAGCTGGTCTCAAATTCCTGG - Intronic
1146684313 17:34830484-34830506 CTAAGCTGGCCTCAAACTCCTGG - Intergenic
1146813586 17:35924002-35924024 CCCACCTGGTCTCCAACTCCTGG - Intronic
1147060381 17:37871683-37871705 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1147119915 17:38329869-38329891 CAAAGCTGGCCTCCAGTCCCTGG - Exonic
1147214604 17:38891883-38891905 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1147227732 17:38993003-38993025 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1147676918 17:42213414-42213436 CAAGGCTGGCCTCAAATTCCTGG + Intronic
1148108447 17:45131795-45131817 CACAGCAGCCCTCCAAGCCGCGG - Intronic
1148336166 17:46842580-46842602 CAGAGCTGGTCTCGAACTCCTGG + Intronic
1148372706 17:47112865-47112887 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1148452006 17:47784767-47784789 CAAGGCTGGCCTCTAACTCCTGG + Intergenic
1148879661 17:50716187-50716209 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1148908158 17:50924638-50924660 CCCAGCTGGTCTCTAACTCCTGG + Intergenic
1149428256 17:56576371-56576393 CTCAGCTGGTCTCAAACTCCTGG + Intergenic
1149519784 17:57310048-57310070 CCCGGCTGGCCTGGAAGTCCAGG + Intronic
1149659690 17:58327826-58327848 CATAGCTGGACTCCAGGTCGAGG - Exonic
1149745949 17:59098453-59098475 CAAAGCTGGCCTCAAACTCCTGG - Intronic
1149766885 17:59286490-59286512 CCAAGCTGGCCTCGAACTCCTGG - Intergenic
1149771415 17:59324802-59324824 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1149919734 17:60645931-60645953 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1149961739 17:61117381-61117403 CCCAGCTGGTCTCCAACTCCTGG - Intronic
1150126055 17:62635738-62635760 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1150176025 17:63057035-63057057 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1150615573 17:66768294-66768316 CCAAGCTGGTCTCCAATTCCTGG + Intronic
1150766373 17:68005291-68005313 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1150774630 17:68069560-68069582 CTCAGGTGGCCTCAAACTCCTGG + Intergenic
1151077892 17:71295452-71295474 CCAGGATGGCCTCCAAGTCCTGG + Intergenic
1151202172 17:72476619-72476641 CCCAGCTGGACTCCAACTTCAGG - Intergenic
1151277921 17:73049911-73049933 CCAAGCTGGTCTCAAAGTCCTGG - Intronic
1151507717 17:74540465-74540487 CACGGCTGGACTCCAATGCCAGG + Intergenic
1151509263 17:74548292-74548314 CACGGCTGGACTCCAATGCCAGG + Intergenic
1151701584 17:75745522-75745544 CCAAGCTGGCCTGCAACTCCTGG - Intronic
1151731033 17:75911209-75911231 CTCGGCTGGTCTCAAAGTCCTGG - Intronic
1151777422 17:76215232-76215254 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1151902971 17:77029411-77029433 CCAAGCTGGCCTCGAACTCCTGG + Intergenic
1152336972 17:79704151-79704173 CAAGGCTGGCCTCAAACTCCTGG - Intergenic
1152347854 17:79764639-79764661 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1152413246 17:80141898-80141920 CACAGCTGCACTCCAAGGCCTGG + Intronic
1152574507 17:81134145-81134167 CACAGAGGGCCTCAAAGTCGAGG + Intronic
1152614379 17:81331102-81331124 CAGAGCTGGCATCCCAGCCCTGG - Intergenic
1152932499 17:83116995-83117017 TACGTCTGTCCTCCAAGTCCAGG - Intergenic
1153238992 18:3013782-3013804 CCCGGCTGGTCTCCAACTCCTGG + Intergenic
1153256823 18:3180085-3180107 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1153306043 18:3631983-3632005 CCAAGCTGGCCTCCAACTCCTGG + Intronic
1153648114 18:7213407-7213429 CAAGGCTGGTCTCCAACTCCTGG + Intergenic
1153757477 18:8298902-8298924 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1153807564 18:8722347-8722369 CCAAGCTGGCCTCAAAGTCCTGG - Intronic
1153977055 18:10278570-10278592 CCAAGCTGGACTCCAACTCCTGG + Intergenic
1154004310 18:10513713-10513735 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1154154591 18:11934049-11934071 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1154269293 18:12905529-12905551 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1154951167 18:21211358-21211380 CCAAGCTGGTCTCAAAGTCCTGG - Intergenic
1155244682 18:23896124-23896146 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1155359736 18:24988123-24988145 CAAAGCTGGGCTCCAAATCCAGG - Intergenic
1155454028 18:25991773-25991795 CAAAGCTGGTCTCAAACTCCTGG - Intergenic
1155494441 18:26428955-26428977 CCCAGCTGGCCTTGAACTCCTGG + Intergenic
1155593129 18:27451586-27451608 CCAGGCTGGCCTCAAAGTCCTGG + Intergenic
1155715687 18:28940673-28940695 CCAGGCTGGCCTCTAAGTCCTGG - Intergenic
1156086348 18:33409292-33409314 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1156307752 18:35894431-35894453 CAGGGCTGGACTCCAATTCCTGG - Intergenic
1156418841 18:36928327-36928349 CACTGCTGGAATTCAAGTCCTGG + Intronic
1156764015 18:40629408-40629430 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1157038983 18:44014961-44014983 CACACCTGGCATCCAAATCTTGG - Intergenic
1157128096 18:44976669-44976691 CAGAGCTGGGATCCAAGTCTGGG - Intronic
1157653950 18:49366580-49366602 CCAAGCTGGCCTCCAACTCCTGG - Intronic
1157707157 18:49816744-49816766 CAGGGCTGGCCTCAAACTCCTGG + Intronic
1158504976 18:58039409-58039431 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1158546610 18:58403179-58403201 CCCAGCTGGGCTGCAAGTCTCGG + Intergenic
1159281070 18:66286805-66286827 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1160403208 18:78626581-78626603 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1160511347 18:79455347-79455369 CCCAGCTGGCCTGCCAGTCACGG - Intronic
1161057242 19:2196802-2196824 CTCAGCTGACCGCCAAGACCAGG - Intronic
1161101041 19:2422075-2422097 GACAGCTGGCCTCACAGTCCCGG + Exonic
1161154824 19:2727178-2727200 CACAGCTGGCCTCGGTGTCCTGG - Intronic
1161201497 19:3017659-3017681 CTCAGCTGGTCTCAAACTCCTGG + Intronic
1161403712 19:4080588-4080610 CCAGGCTGGTCTCCAAGTCCTGG - Intergenic
1161450196 19:4341512-4341534 CCATGCTGGTCTCCAAGTCCTGG - Intronic
1161779500 19:6281682-6281704 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1161812443 19:6478600-6478622 CCCAGCTGGTCTCGAACTCCAGG + Intronic
1161820569 19:6528532-6528554 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1161835101 19:6640544-6640566 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1161859146 19:6784701-6784723 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1162023191 19:7877841-7877863 CCTAGCTGGCCTCAAACTCCCGG - Intergenic
1162074557 19:8176721-8176743 CAGAGCTGGTCTCAAACTCCTGG + Intronic
1162101441 19:8341698-8341720 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1162360074 19:10214278-10214300 CTAAGCTGGCCTCAAACTCCTGG - Intronic
1162409487 19:10496724-10496746 CACTGCAAGCCTCCATGTCCTGG - Intronic
1162424334 19:10585003-10585025 CAAAGCTGGTCTCAAACTCCTGG - Intronic
1162442679 19:10702592-10702614 CCAAGCTGGTCTCCAACTCCCGG - Intronic
1162647157 19:12058230-12058252 CCATGCTGGCCTCCAACTCCTGG + Intergenic
1162658911 19:12154408-12154430 CAAGGCTGGTCTCCAACTCCTGG + Intronic
1162832211 19:13292401-13292423 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1162843706 19:13374878-13374900 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1162865087 19:13539799-13539821 CCCAGCTGGTCTCAAATTCCTGG - Intronic
1162886349 19:13700274-13700296 CCCAGCTGGGCCCCAACTCCAGG - Intergenic
1162960866 19:14125760-14125782 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1162995212 19:14330451-14330473 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1163007067 19:14403701-14403723 CACAGCTGGTCTCAAACTCCTGG + Intronic
1163025153 19:14506559-14506581 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1163402068 19:17100176-17100198 CACGCCTGGCCTACAAGTGCAGG - Intronic
1163404042 19:17111630-17111652 CAAGGCTGGTCTCCAACTCCTGG + Intronic
1163465056 19:17462846-17462868 CCAGGCTGGCCTCCAAGTCCTGG + Intergenic
1163690949 19:18738108-18738130 ACCAGCTGGTCTCCAACTCCTGG - Intronic
1163778389 19:19231768-19231790 CAAGGCTGGTCTCCAATTCCTGG - Intronic
1163792521 19:19316041-19316063 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1164640224 19:29819489-29819511 CCCGGCTGGTCTCCAACTCCTGG + Intronic
1164655286 19:29916691-29916713 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1165054544 19:33166048-33166070 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1165082362 19:33315789-33315811 CCAAGCTGGCCTCAAATTCCCGG - Intergenic
1165128498 19:33617807-33617829 CACAGCAGGCCTTCAGATCCTGG + Intergenic
1165334489 19:35159814-35159836 CGCAGCTGGAATCGAAGTCCAGG + Intronic
1165382498 19:35491068-35491090 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1165458093 19:35926613-35926635 CCCGGCTGGTCTCCAACTCCTGG + Intergenic
1165679205 19:37759095-37759117 CTCAGCTGGTCTCTAACTCCTGG - Intronic
1165759862 19:38314820-38314842 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1165810990 19:38611571-38611593 CCCAGCTGGTCTCCAACTCCTGG - Intronic
1165891577 19:39115766-39115788 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1165897556 19:39152141-39152163 CTCAGCTGGTCTCGAACTCCTGG + Intronic
1166049216 19:40248122-40248144 CAGAGCTGGGATCCACGTCCAGG - Intronic
1166522624 19:43491052-43491074 CACAGAAGGCCTCTAAGCCCAGG - Intronic
1166538779 19:43592440-43592462 CAGAGCTGGCCTCCACGCCCCGG + Exonic
1166717939 19:44980741-44980763 CAGGGCTGGCCTCAAACTCCTGG - Intronic
1166832997 19:45649262-45649284 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
1167052580 19:47088698-47088720 CCAGGCTGGCCTCCAACTCCCGG + Intronic
1167198066 19:48044314-48044336 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1167386099 19:49164950-49164972 CACAGCTGGTCTCGAACTCCTGG + Intronic
1167468764 19:49664073-49664095 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1167484023 19:49749819-49749841 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1167876647 19:52419573-52419595 CCCAGCTGGTCTCCAACTCTTGG + Intergenic
1168111494 19:54193990-54194012 CAGAGCTGGTCTCAAACTCCTGG - Exonic
1168427229 19:56248640-56248662 CAAGGCTGGTCTCAAAGTCCTGG + Intronic
1168509055 19:56960061-56960083 CCAAGCTGGCCTCCAACTCCTGG - Intergenic
1168532240 19:57138979-57139001 CCCAGCTAGCCTCAAACTCCTGG - Intronic
924971619 2:133170-133192 CCAAGCTGGTCTCAAAGTCCTGG - Intergenic
925065128 2:923589-923611 CAGCGCTGGCCTCGAACTCCTGG + Intergenic
925385136 2:3456786-3456808 CCCAGCTGGTCTCTAACTCCTGG + Intronic
925562463 2:5211629-5211651 CACATCTGCCCGCCAAGGCCTGG + Intergenic
925824006 2:7828997-7829019 CACATGTGGCCTCCAAATCTCGG - Intergenic
926017275 2:9464934-9464956 CAAGGCTGGTCTCCAACTCCTGG + Intronic
926066236 2:9842884-9842906 CCCGGCTGGTCTCCAACTCCTGG + Intergenic
926099067 2:10102374-10102396 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
926379086 2:12266242-12266264 CATGGCTGGTCTCCAACTCCTGG + Intergenic
927165386 2:20315109-20315131 CCCAGCTGGTCTCAAACTCCTGG + Intronic
927209299 2:20628997-20629019 CACCGCTGCTCTCCTAGTCCAGG - Intronic
927241028 2:20919594-20919616 CTGAGCTGGCCACCAAGGCCGGG + Intergenic
927479668 2:23442300-23442322 CCCAGCTGGCCTCAAACTCCTGG + Intronic
927484623 2:23479975-23479997 CAGAGCTTGCCTCCAATCCCAGG - Intronic
927661038 2:24993026-24993048 CACAGCTGGTCTTGAACTCCTGG - Intergenic
927718693 2:25369307-25369329 CACAGCTGGGCTCCGGGACCTGG + Intergenic
927753004 2:25686661-25686683 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
927806207 2:26149028-26149050 CTCAGCTGGTCTCGAATTCCTGG - Intergenic
927942272 2:27112058-27112080 CCAAGCTGGCCTCCAACTTCTGG - Intronic
928003470 2:27541980-27542002 CCCAGCTGGTCTCAAACTCCTGG + Intronic
928110137 2:28500700-28500722 CCGAGCTGGTCTCCAACTCCTGG - Intronic
928629751 2:33178948-33178970 CAAAGCTGGTCTCAAACTCCTGG + Intronic
928819248 2:35341670-35341692 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
928976163 2:37088729-37088751 CAAGGCTGGTCTCCAACTCCTGG + Intronic
929124644 2:38512144-38512166 CCCAGGTGGCCTCAAACTCCTGG + Intergenic
929125793 2:38521734-38521756 GACTGCTGGGCTCCATGTCCAGG + Intergenic
929302559 2:40322446-40322468 CCCAGCTGGCCTTGAACTCCTGG - Intronic
929560593 2:42954104-42954126 CCCGGCTGGCCTCAAACTCCTGG + Intergenic
929941959 2:46340927-46340949 CCCAGCTGGTCTCAAACTCCTGG + Intronic
929988704 2:46765240-46765262 CCCAGCTGGTCTCAAAATCCGGG - Intergenic
930027178 2:47036137-47036159 CACAACTGGCCTCCGGGTCTCGG - Intronic
930194913 2:48499511-48499533 CCCAGCTGGTCTCAAAGTCCTGG - Intronic
930347850 2:50208020-50208042 CACAGCAGCTCACCAAGTCCAGG - Intronic
930629048 2:53732166-53732188 CCAAGCTGGTCTCCAACTCCTGG + Intronic
930733789 2:54754184-54754206 CCAAGCTGGCCTCAAACTCCTGG + Intronic
931066014 2:58588050-58588072 CAAAGCTGGTCTCAAACTCCTGG - Intergenic
931290852 2:60871913-60871935 CAGAGCTGGTCTCAAACTCCTGG - Intergenic
931326742 2:61233614-61233636 CCCAGCTGGTCTCAAACTCCAGG - Intronic
931442493 2:62300301-62300323 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
931660713 2:64559911-64559933 CCCAGATGGTCTCCAACTCCTGG + Intronic
931752500 2:65342901-65342923 CCAGGCTGGCCTCCAACTCCTGG - Intronic
932715554 2:74098975-74098997 CAGAGCAAGCCTCCAGGTCCTGG + Intronic
932747041 2:74342507-74342529 CACAGCTGAATTCCAAATCCTGG + Exonic
933131351 2:78677390-78677412 CAAAGCTGGCCTCCCTGGCCTGG + Intergenic
933213882 2:79603982-79604004 CACTGCTGTCCCCCAAGTCAGGG - Intronic
933768301 2:85726258-85726280 CAAAGCTGGTCTCAAACTCCTGG - Intergenic
934075627 2:88426469-88426491 CACAGCTGGTTTTCAACTCCTGG - Intergenic
934085317 2:88504444-88504466 CCCAGCTGGTCTCAAACTCCAGG - Intergenic
934088143 2:88527268-88527290 AACTGCTGGCCTCAAACTCCTGG - Intronic
934669638 2:96202672-96202694 CCAAGCTGGCCTCAAATTCCTGG + Intronic
935172629 2:100622282-100622304 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
935280829 2:101516419-101516441 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
935332450 2:101986950-101986972 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
935639730 2:105279468-105279490 CCAAGCTGGCCTCAAACTCCTGG + Intronic
935709531 2:105885183-105885205 CAGAGCTGGCCTGCAAGTGCGGG + Intronic
936657747 2:114507256-114507278 CCCGGCTGGCCTCAAATTCCTGG + Intronic
936839717 2:116754606-116754628 CACAGCCGGCCTCCCTGTCCCGG - Intergenic
937092450 2:119215600-119215622 CCCAGCTGGCCTGTAACTCCCGG + Intergenic
937116906 2:119413108-119413130 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
937922086 2:127137920-127137942 GACAGCTGTCTTCCAAGTTCAGG + Intergenic
938927250 2:136055358-136055380 CTCAGCTGGTCTCGAACTCCTGG - Intergenic
939242840 2:139583866-139583888 CAGAGCTGGTATCCAAATCCAGG - Intergenic
939264849 2:139858379-139858401 CAGAGGTGGTCTCCAACTCCCGG + Intergenic
939979851 2:148766972-148766994 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
940229606 2:151436328-151436350 CACAGGTGGTATCCAACTCCTGG - Intronic
940358734 2:152773956-152773978 CAGAGCTGGTCTCAAACTCCTGG + Intergenic
941152947 2:161938061-161938083 GCCAGCTGGCCTCTAACTCCTGG - Intronic
941687637 2:168463696-168463718 CGCAGCTGGTCTCAAATTCCTGG - Intronic
941721325 2:168816228-168816250 CTCAGCTGGCCCACAAGTTCAGG - Intronic
942300103 2:174552914-174552936 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
942521176 2:176805952-176805974 CATACTTGGCCTCCAAATCCTGG + Intergenic
943698288 2:190960583-190960605 CCAAGCTGGTCTCCAACTCCTGG + Intronic
943840451 2:192573900-192573922 CCCGGCTGGCCTCAAACTCCAGG + Intergenic
944297784 2:198086409-198086431 CCAAGCTGGCCTCGAACTCCTGG - Intronic
944430183 2:199624889-199624911 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
944567035 2:201001879-201001901 CTAAGCTGGCCTCAAACTCCTGG + Intronic
944698107 2:202221171-202221193 CCAGGCTGGCCTCCAACTCCTGG - Intronic
944699618 2:202235077-202235099 CCAAGCTGGTCTCAAAGTCCTGG + Intronic
944805828 2:203280229-203280251 CTGAGCTGGCCTCCAACTCCTGG - Intronic
945100003 2:206255094-206255116 CATAGCTGGTCTCAAACTCCTGG + Intergenic
945296958 2:208179939-208179961 CACTGCTGGTCTCAAATTCCTGG - Intronic
946171358 2:217897932-217897954 CACAGCTGTCCTCCATGGTCCGG + Exonic
946568222 2:220991818-220991840 CCAAGCTGGTCTCCAACTCCCGG - Intergenic
946752621 2:222907549-222907571 CCCAGCTGGTCTCAAACTCCTGG - Intronic
946917696 2:224542615-224542637 CCAAGCTGGTCTCGAAGTCCTGG + Intronic
946986367 2:225278214-225278236 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
946993215 2:225359564-225359586 CCCAGCTGGTCTCAAATTCCTGG + Intergenic
947336978 2:229096964-229096986 CACAGCTGACTTCCCAGTGCTGG - Intronic
947600226 2:231443230-231443252 CCCAGCTGGTCTCAAACTCCCGG - Intergenic
947788920 2:232851109-232851131 CCCAGCTGGTCTCAAACTCCTGG - Intronic
948593627 2:239066168-239066190 TACAGCTGGCCTCTGAGACCTGG - Intronic
1168754603 20:307664-307686 CTCAGCTGGCCTCAAACTCCTGG - Intergenic
1168783845 20:519502-519524 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1168791821 20:582779-582801 CCAGGCTGGTCTCCAAGTCCTGG - Intergenic
1168799165 20:633573-633595 CTCATCTGGCCTCCATGTGCTGG - Intergenic
1169066688 20:2697918-2697940 CCCAGCTGGCCTCCCTCTCCGGG - Intronic
1169324004 20:4660653-4660675 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1169325591 20:4672927-4672949 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1170516746 20:17137946-17137968 CACAGCTCCCCTCCAAACCCAGG + Intergenic
1170850305 20:19998385-19998407 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1170946296 20:20894047-20894069 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1171432714 20:25094248-25094270 CCCAGCTGGTCTCTAATTCCTGG - Intergenic
1171501517 20:25597221-25597243 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1171943742 20:31356208-31356230 CCAGGCTGGCCTCCAACTCCAGG - Intergenic
1171959388 20:31482922-31482944 CAAAGCTGGTCTCAAACTCCTGG - Intronic
1172002718 20:31792600-31792622 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1172022683 20:31925474-31925496 CAGAGCTGGCATTCAAATCCAGG + Intronic
1172046202 20:32082075-32082097 CACAGCTGGGATTCAAATCCAGG - Intronic
1172047116 20:32087982-32088004 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1172073259 20:32274525-32274547 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1172254347 20:33503729-33503751 CCCGGCTGGCCTCGAACTCCTGG + Intronic
1172336409 20:34120063-34120085 CCCAGCTGGTCTCAAAGTCCTGG + Intergenic
1172442120 20:34973179-34973201 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1172544318 20:35747605-35747627 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1172657769 20:36547513-36547535 CACAGCTGGGATCCAAACCCAGG + Intronic
1172661054 20:36569038-36569060 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1172747811 20:37226473-37226495 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1172943656 20:38671890-38671912 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1173392433 20:42647104-42647126 CAGGGCTGGTCTCCAACTCCTGG + Intronic
1173520053 20:43692722-43692744 CTGAACTGGCCTCCAACTCCTGG - Intronic
1173623559 20:44454890-44454912 CCAAGCTAGCCTCCAACTCCTGG + Intronic
1173669098 20:44785418-44785440 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1173813507 20:45970798-45970820 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1173891820 20:46518497-46518519 CAGGGCTGGTCTCCAACTCCTGG - Intergenic
1173935057 20:46854161-46854183 CACGGCTGGTCTCAAACTCCTGG - Intergenic
1173944785 20:46941964-46941986 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1174305687 20:49612729-49612751 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1174504411 20:51007799-51007821 CCAGGCTGGCCTCAAAGTCCTGG - Intronic
1174625116 20:51907779-51907801 CAGGGCTGGCCTCAAATTCCTGG - Intergenic
1174662241 20:52223726-52223748 CCGAGCTGGCCTCAAACTCCTGG + Intergenic
1174665896 20:52257366-52257388 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1174809573 20:53634124-53634146 CAGAGCTGGTCTCAAACTCCTGG + Intergenic
1174812898 20:53662606-53662628 CCAAGCTGGCCTCGAACTCCTGG + Intergenic
1175001146 20:55632009-55632031 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1175132755 20:56801839-56801861 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
1175221083 20:57416848-57416870 CAGAGCTGGGCTCCAAACCCCGG + Intergenic
1175328618 20:58147483-58147505 AAGAGCTGCCCTCCAAGGCCAGG + Intergenic
1175767848 20:61603506-61603528 CACACCTGGCCTCCACAGCCTGG - Intronic
1175805347 20:61825196-61825218 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1176167570 20:63682056-63682078 CACACCTGCCCTCCAGGCCCTGG - Intronic
1176367241 21:6040504-6040526 CACAGCTCTGCTCCAATTCCAGG + Intergenic
1176870133 21:14077389-14077411 CAGAGCTGGTCTCAAACTCCTGG - Intergenic
1177182129 21:17755920-17755942 TCCAGCTGGTCTCCAACTCCTGG + Intergenic
1177474219 21:21597734-21597756 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1178163148 21:29941484-29941506 CAAGGCTGGCCTCGAACTCCTGG - Intergenic
1178258745 21:31079374-31079396 CAAAGCTGGTCTCGAATTCCTGG + Intergenic
1178502196 21:33134830-33134852 CACAGCTGCCCACCAACACCCGG + Intergenic
1179007023 21:37524216-37524238 CCAAGCTGGTCTCCAAATCCTGG - Intergenic
1179085981 21:38218178-38218200 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1179562637 21:42225831-42225853 CACAGCTGCCCTCCGAGGCAAGG - Exonic
1179593220 21:42425011-42425033 CACAGATGCCCTCATAGTCCTGG - Intronic
1179756278 21:43498042-43498064 CACAGCTCTGCTCCAATTCCAGG - Intergenic
1179893463 21:44349413-44349435 CCCTGCTGGCCTCCATGTCCAGG - Intergenic
1180217218 21:46332897-46332919 CAAAGCTGGCCTCAAAATCCTGG - Intronic
1180317317 22:11286025-11286047 CAAGGCTGGCCTCAAATTCCTGG + Intergenic
1180640041 22:17290982-17291004 CAGAGCTGGTCTCGAACTCCTGG - Intergenic
1180730922 22:17981891-17981913 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1180736142 22:18018980-18019002 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1180864472 22:19108359-19108381 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1180882002 22:19210940-19210962 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1181184000 22:21088488-21088510 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1181306415 22:21919810-21919832 CAGAGCTGTCCTCCCAGCCCTGG + Exonic
1181511661 22:23392113-23392135 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1181809956 22:25397898-25397920 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1182259536 22:29063373-29063395 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1182263016 22:29089450-29089472 CACAGCTGCCAGCCTAGTCCAGG + Intronic
1182348095 22:29681098-29681120 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1182399637 22:30065995-30066017 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1182526431 22:30923242-30923264 AACAGCTGCCCACCAAGGCCTGG - Intergenic
1182545218 22:31071421-31071443 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1182871705 22:33653343-33653365 CATAGCTGAGCTCAAAGTCCAGG - Intronic
1183166362 22:36150019-36150041 CAGAGCTGGTCTCCAACTCCTGG + Intronic
1183209455 22:36441876-36441898 CCAAGCTGGCCTCCAACTCCTGG - Intergenic
1183211364 22:36453455-36453477 CACAGGTGCCCTCCAGGTTCTGG - Intergenic
1183250085 22:36724279-36724301 CTAAGCTGGCCTCCAACTCCTGG - Intergenic
1183517536 22:38275688-38275710 CAGGGCTGGCCTCAAACTCCTGG + Intergenic
1183737944 22:39654204-39654226 CACAGCTGACCTCAATCTCCGGG - Intronic
1184352034 22:43950819-43950841 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
1184379058 22:44133744-44133766 CCAAGCTGGTCTCGAAGTCCTGG + Intronic
1184604444 22:45564105-45564127 CACAGCTGGTATCCGAGCCCTGG + Intronic
1184775276 22:46620001-46620023 CACAGCTGACCTCCACATCAGGG - Intronic
1184861080 22:47173640-47173662 CGCAGCTGGCCTCACTGTCCCGG + Exonic
1185127301 22:49018208-49018230 CAAAGCCAGCCTCCAAATCCAGG - Intergenic
1185346354 22:50312528-50312550 CACAGATAGCCTCCAGGTGCAGG + Exonic
949187505 3:1210655-1210677 CAGAGCTGGCATTCAAATCCAGG - Intronic
949968679 3:9382936-9382958 CTCAGCTGGTCTCAAATTCCTGG + Intronic
949971732 3:9412935-9412957 CCCAGCTGGCCTTGAACTCCTGG + Intronic
949972994 3:9427093-9427115 CTCAGCTGGTCTCAAATTCCTGG + Intronic
950068959 3:10136655-10136677 CTCAGCCGGCCTGCAAGCCCAGG - Intergenic
950371341 3:12533453-12533475 CCAAGCTGGTCTCCAACTCCTGG - Intronic
950807093 3:15614804-15614826 CCATGCTGGCCTCCAACTCCTGG + Intronic
951333628 3:21394876-21394898 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
951706042 3:25545461-25545483 CACACCTGGACTCAAAGTCTAGG - Intronic
951931508 3:27972570-27972592 CAAAGCTGGCCTTGAACTCCTGG + Intergenic
952391974 3:32888387-32888409 CACGGGTGGCCTCAAAATCCTGG - Intronic
952767953 3:36971536-36971558 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
952949753 3:38513009-38513031 CCCAGCTGGCCTTAAATTCCTGG + Intronic
953033987 3:39195943-39195965 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
953396450 3:42575055-42575077 CACAGCTGGTCTTGAATTCCTGG + Intronic
953815676 3:46154303-46154325 AATAGCTGGCATCCATGTCCAGG + Intergenic
953982933 3:47421760-47421782 CTCAGCTGGCCTGCCAGCCCTGG + Intronic
954009528 3:47623203-47623225 CCAGGCTGGCCTCCAACTCCTGG + Intronic
954021682 3:47747747-47747769 CCAAGCTGGCCTCAAACTCCTGG - Intronic
954025323 3:47778525-47778547 CCAAGCTGGTCTCCAAATCCTGG + Intronic
954572578 3:51654476-51654498 CAAGGCTGGTCTCCAATTCCTGG - Intronic
954657440 3:52204169-52204191 CAAGGCTGGCCTCAAACTCCTGG - Intronic
954743534 3:52773691-52773713 CATAGTTGTCCTCCAGGTCCAGG - Intergenic
955062675 3:55506806-55506828 CACTGCTGGACTCCAACTGCAGG - Intergenic
955156532 3:56422135-56422157 CCTCGCTGGCCTCCTAGTCCAGG - Intronic
955157080 3:56427333-56427355 CCCAGCTGGTCTCAAACTCCTGG + Intronic
955366414 3:58313975-58313997 CACAGCCAGCCTCAAACTCCTGG - Intronic
955980188 3:64517466-64517488 CCCAGCTGGTCTCAAAATCCTGG + Intronic
958047006 3:88297226-88297248 CACAGCTGGTCTCGAACTCCTGG + Intergenic
959159154 3:102703180-102703202 CCCAGCTGGCCTCAAACTCCTGG + Intergenic
959168896 3:102820126-102820148 CCTAGCTGGCCTCAAACTCCTGG + Intergenic
959204470 3:103287314-103287336 CAAGGCTGGTCTCCAAATCCTGG + Intergenic
959961083 3:112298833-112298855 CATGGCTGGCCTCAAACTCCAGG - Intergenic
960510871 3:118547608-118547630 GGCAGCTGGCTTCCAAGTGCGGG - Intergenic
960552713 3:118994445-118994467 CCCAGCTGGTCTCAAACTCCTGG - Intronic
960611844 3:119561751-119561773 GCCAGCTGGCCTCGAACTCCTGG - Intergenic
960741163 3:120835467-120835489 CAGAGCTGGTCTCAAACTCCTGG + Intergenic
960901075 3:122555076-122555098 CTAGGCTGGCCTCCAACTCCTGG + Intronic
961060554 3:123824937-123824959 CAGGGCTGGCCTCAAACTCCTGG - Intronic
961162084 3:124736070-124736092 CAAAGCTGGTCTCAAACTCCTGG - Intronic
961242547 3:125424652-125424674 CCAGGCTGGCCTCGAAGTCCTGG - Intergenic
961534917 3:127564493-127564515 CAAAGGTGGCCTCATAGTCCTGG - Intergenic
961566699 3:127769140-127769162 CCAAGCTGGCCTCAAACTCCTGG - Intronic
961662331 3:128476003-128476025 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
961758635 3:129148034-129148056 CCAAGCTGGTCTCCAACTCCTGG + Intronic
962374989 3:134851898-134851920 CACACCAGGCCTCCAGGGCCTGG - Intronic
962590551 3:136885512-136885534 CCAGGCTGGCCTCCAACTCCTGG + Intronic
962780631 3:138712207-138712229 CACAGCTGGTCTTCATTTCCTGG - Exonic
962792394 3:138823210-138823232 CCCAGCTGGCCTGTAACTCCTGG - Intronic
963707362 3:148704137-148704159 CTCAGCTGGTCTCAAACTCCTGG - Intronic
963891396 3:150639521-150639543 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
964167608 3:153727135-153727157 CTAAGCTGGTCTCCAACTCCTGG - Intergenic
964257440 3:154792439-154792461 CAAGGTTGGCCTCCAACTCCTGG + Intergenic
965077770 3:164001806-164001828 CAAAGCTCTCCTCCAGGTCCTGG + Intergenic
965895889 3:173575094-173575116 CAAAGCTGGTCTCAAATTCCTGG + Intronic
966222432 3:177564365-177564387 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
966242128 3:177766305-177766327 CATAGCTGGCCTCCAAGCAGGGG - Intergenic
966526261 3:180922821-180922843 CCAGGCTGGCCTCCAACTCCTGG + Intronic
967498437 3:190168620-190168642 CCAAGCTGGTCTCAAAGTCCTGG - Intergenic
968014344 3:195315228-195315250 CCAAGCTGGTCTCCAATTCCTGG + Intronic
968017398 3:195350435-195350457 CAAGGCTGGTCTCCAACTCCTGG - Intronic
968150013 3:196330185-196330207 CCCAGCTGGTCTTCAACTCCTGG + Intronic
968334729 3:197903435-197903457 CACCTCTGGCCTTGAAGTCCTGG - Intronic
968344480 3:197989810-197989832 CAAAACTGGCCTCGAATTCCTGG - Intronic
968738190 4:2310592-2310614 CCCAGCTGGTCTCAAACTCCTGG - Intronic
968848626 4:3062433-3062455 CACACCAGACCTCCAAGGCCAGG - Intergenic
969274352 4:6124911-6124933 CCCAGCTGGCCTCATAGTCCTGG - Intronic
969487186 4:7478837-7478859 CACAGCTGGGCACCGAGGCCTGG + Intronic
969541786 4:7796152-7796174 CACATCTGGCCCCCAGATCCTGG + Intronic
969558603 4:7930959-7930981 CCAGGCTGGCCTCCAACTCCTGG + Intronic
969667881 4:8572509-8572531 CACTGTTGGACTCCAAGCCCTGG - Intronic
969677897 4:8624906-8624928 CACGGCTGACCTCCTAGGCCTGG + Intergenic
969678852 4:8630542-8630564 CACGGCTGACCTCCTAGGCCTGG + Intergenic
969679808 4:8636192-8636214 CACGGCTGACCTCCTAGGCCTGG + Intergenic
970050542 4:11909505-11909527 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
970438677 4:16060521-16060543 CCCAGCTGGTCTCAAACTCCTGG + Intronic
970590023 4:17551712-17551734 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
970608347 4:17703285-17703307 CCCAGCTGGTCTCGAACTCCTGG - Intronic
970636365 4:18014015-18014037 CAAGGCTGGTCTCCAACTCCTGG + Intronic
970889446 4:21026442-21026464 CCCAGCTGGTCTCAAACTCCTGG - Intronic
971254086 4:24998083-24998105 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
971387749 4:26156858-26156880 CCAGGCTGGCCTCCAATTCCTGG - Intergenic
971795689 4:31224986-31225008 GACAGCTGGCCTTGAATTCCGGG + Intergenic
972561844 4:40235762-40235784 CCAAGCTGGTCTCCAACTCCTGG - Intronic
973317492 4:48777974-48777996 GACGGCTGGTCTCCAACTCCTGG - Intronic
973556187 4:52085651-52085673 CATAGCTGGTCTCAAACTCCTGG - Intronic
973662929 4:53126523-53126545 CCAGGCTGGCCTCCAACTCCTGG + Intronic
974902959 4:68023455-68023477 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
974922778 4:68262615-68262637 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
974927391 4:68317019-68317041 CCAAGCTGGTCTCCAACTCCTGG - Intronic
975161146 4:71125361-71125383 CCAGGCTGGCCTCCAAGTCCTGG - Intergenic
975336252 4:73179566-73179588 CCAAGCTGGCCTCAAACTCCTGG + Intronic
975359896 4:73456955-73456977 CCCAGCTGGTCTCAAAATCCTGG + Intergenic
975672722 4:76798061-76798083 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
976193398 4:82510463-82510485 CAGAGCTGGATTCCAAGCCCTGG - Intronic
976283923 4:83352632-83352654 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
976610445 4:87025203-87025225 CACAGCTGGAGTCCAAGTGCTGG - Intronic
976617861 4:87096439-87096461 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
976623712 4:87155949-87155971 CACAGCTGGTCTTGAACTCCTGG - Intergenic
976727263 4:88226900-88226922 CCAAGCTGGCCTCAAACTCCTGG - Intronic
976819787 4:89192672-89192694 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
977315505 4:95442539-95442561 CCAGGCTGGCCTCCAACTCCTGG + Intronic
977553144 4:98463505-98463527 TACAGCTGGTATCCAACTCCTGG + Intergenic
978644842 4:110917893-110917915 CAGAGCTGGAATCCAAGTCTAGG - Intergenic
979364675 4:119806932-119806954 CCCAGCTGGTCTCCAACTCTTGG + Intergenic
979516158 4:121612613-121612635 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
979914231 4:126410264-126410286 AACAGCTGGTCTCGAACTCCTGG - Intergenic
979941104 4:126763935-126763957 CACAGCTGGTCTTGAACTCCTGG - Intergenic
980259996 4:130436250-130436272 TACAGATGGCCTCAAAGCCCTGG + Intergenic
980578542 4:134716862-134716884 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
981976008 4:150729107-150729129 CCCAGCTGGTCTCGAACTCCTGG - Intronic
982250368 4:153400116-153400138 CCCAGCTGGTCTCGAACTCCTGG + Intronic
982282339 4:153696817-153696839 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
982365537 4:154573952-154573974 CCAAGCTGGCCTCTAACTCCTGG - Intergenic
982706520 4:158716133-158716155 CAAAGCTGGTTTCCAACTCCTGG + Intronic
983154313 4:164327590-164327612 CACCCCTGTACTCCAAGTCCAGG + Intronic
983500171 4:168490186-168490208 CCAGGCTGGCCTCAAAGTCCTGG + Intronic
983644151 4:169972702-169972724 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
983798178 4:171892769-171892791 CCAGGCTGGCCTCCAACTCCTGG + Intronic
983987893 4:174082307-174082329 CAAGGCTGGTCTCCAACTCCTGG + Intergenic
984609720 4:181824308-181824330 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
985333602 4:188868411-188868433 CAAGGCTGGCCTCGAACTCCTGG - Intergenic
985484237 5:139938-139960 CACAGCAGGCCCCCATTTCCAGG + Intergenic
985489532 5:171309-171331 CACAGCTGGCCTCCTTGAGCAGG - Exonic
985770943 5:1810320-1810342 CCCAGCAGGCCTCTAAGCCCAGG - Intronic
985901392 5:2797771-2797793 CACTCCTGCCCTCCTAGTCCAGG - Intergenic
986297780 5:6454089-6454111 CCCAGCTGGTCTCAAATTCCTGG + Intronic
986473888 5:8104561-8104583 CCCAGCTGACCTCAAACTCCTGG + Intergenic
987316196 5:16726541-16726563 CACAGCTGAGCTTCAAATCCAGG + Intronic
988100268 5:26668076-26668098 CACATCTCGCCTCCTGGTCCTGG - Intergenic
988415680 5:30944120-30944142 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
988571439 5:32371158-32371180 CCCAGCTGGTCTCGAACTCCTGG - Intronic
988571848 5:32375714-32375736 CCAAGCTGGTCTCCAACTCCGGG + Intronic
989621929 5:43393241-43393263 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
989814341 5:45718219-45718241 CTCAGCTGGTCTCAAAATCCTGG + Intergenic
991080713 5:62596047-62596069 CAGGGCTGGTCTCCAACTCCTGG - Intronic
992652582 5:78874897-78874919 CTCAGCTGGTCTCAAACTCCTGG - Intronic
992690344 5:79235856-79235878 CACAGGTGGCCTCCGAACCCGGG - Intronic
992734340 5:79703879-79703901 CAAGGCTGGCCTCAAACTCCTGG - Intronic
992820872 5:80494721-80494743 CCCAGCTGGTCTCGAACTCCTGG + Intronic
992997044 5:82344350-82344372 CAATGCTGGTCTCCAACTCCTGG + Intronic
993008126 5:82450002-82450024 CAGAGCTGGACTCCAAGTTGTGG + Intergenic
993717191 5:91287347-91287369 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
993999402 5:94760892-94760914 CCAAGCTGGTCTCCAACTCCTGG + Intronic
994140244 5:96333610-96333632 CACAGCTGACCTCCAACAGCAGG - Intergenic
994554507 5:101281420-101281442 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
994639557 5:102389947-102389969 CAAGGCTGGTCTCCAACTCCTGG + Intronic
995072983 5:107946514-107946536 CCAGGCTGGCCTCCAACTCCTGG + Intronic
995088184 5:108140253-108140275 CCAGGCTGGCCTCCAACTCCTGG + Intronic
995360544 5:111291718-111291740 CACAGCTGGTCTCAAACTCCTGG + Intronic
995908907 5:117161767-117161789 CACACCTGGCTTCAAACTCCTGG - Intergenic
996353686 5:122573830-122573852 CCCAGCTGCCCTCAAAGTCCTGG - Intergenic
996370668 5:122749409-122749431 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
996640609 5:125747681-125747703 CCAGGCTGGTCTCCAAGTCCTGG + Intergenic
996699535 5:126436437-126436459 CCAGGCTGGCCTCCAACTCCTGG - Intronic
996715149 5:126581424-126581446 CCCAGCTGGTCTCGAACTCCGGG - Intronic
997296449 5:132771820-132771842 CACAGCAAGCCTCTAAGCCCAGG + Intronic
997497118 5:134337636-134337658 CAAAGCTAGCCTCAAATTCCTGG - Intronic
997508551 5:134437377-134437399 CTCAGCTGGCCTCCTTATCCTGG - Intergenic
997515434 5:134485202-134485224 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
997584119 5:135034531-135034553 CGCATCTGGCCTGCGAGTCCCGG + Intronic
997934252 5:138096898-138096920 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
997950209 5:138236634-138236656 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
998223603 5:140308228-140308250 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
998366450 5:141635814-141635836 CCAAGCTGGTCTCCAACTCCTGG + Intronic
998791480 5:145770304-145770326 CAAAGCTGGTCTCGAACTCCTGG - Intronic
999184217 5:149693565-149693587 CACACCTGACCACCAACTCCAGG - Intergenic
999342800 5:150787467-150787489 CACAGCTTTCTTCTAAGTCCAGG - Intronic
999985369 5:156999347-156999369 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1000301167 5:159957292-159957314 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1000307895 5:160012576-160012598 CAAGGCTGGTCTCCAACTCCTGG + Intronic
1000772079 5:165367217-165367239 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1000777546 5:165439538-165439560 CACAGCTGTTCTCCCAGGCCAGG + Intergenic
1001064646 5:168526793-168526815 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1001081795 5:168672681-168672703 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1001453570 5:171844464-171844486 CCCAGCTGGTCTCTAACTCCTGG + Intergenic
1001569615 5:172721528-172721550 CTGAGATGGACTCCAAGTCCGGG - Intergenic
1001606803 5:172966369-172966391 CTCGGCTGGTCTCCAACTCCTGG + Intronic
1001618986 5:173066025-173066047 CCAAGCTGGCCTCAAACTCCCGG + Intronic
1001839107 5:174858356-174858378 CTCAGCTGGTCTCAAACTCCTGG + Intergenic
1002017397 5:176335831-176335853 CAGGGCTGGCCTCAAACTCCTGG - Intronic
1002144938 5:177172747-177172769 CTAGGCTGGTCTCCAAGTCCTGG - Intronic
1002325468 5:178402279-178402301 CCAGGCTGGCCTCCAACTCCCGG - Intronic
1002338756 5:178500376-178500398 CTAAGCTGGTCTCCAACTCCTGG - Intronic
1002372587 5:178767120-178767142 CACAGCTTGCCTGCAAGCCAGGG + Intergenic
1002629469 5:180561160-180561182 CAAAGCTGGTCTCGAACTCCTGG + Intronic
1002639956 5:180626053-180626075 GTCAGCTGGCCTCCAATGCCAGG + Intronic
1002839191 6:891322-891344 CACAGCTGGCCACCACTGCCAGG - Intergenic
1002844249 6:932709-932731 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1002974599 6:2061505-2061527 CCAAGTTGGTCTCCAAGTCCTGG - Intronic
1003226117 6:4207508-4207530 CTCAGCTGGTCTCGAACTCCTGG + Intergenic
1003500866 6:6701723-6701745 CACAGCTTGCCTCAAATCCCTGG + Intergenic
1003599501 6:7504007-7504029 CACAGCTGAGCTCAAAGTTCTGG - Intergenic
1003823192 6:9923396-9923418 CTAGGCTGGCCTCCAACTCCTGG - Intronic
1004011348 6:11691014-11691036 CCTGGCTGGCCTCCAACTCCTGG - Intergenic
1004179163 6:13365833-13365855 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1004951593 6:20679121-20679143 CAAGGCTGGCCTCAAACTCCTGG + Intronic
1005851430 6:29825891-29825913 CCTAGCTGGTCTCAAAGTCCTGG - Intergenic
1006481531 6:34298653-34298675 CCCAGCCGGCCTCAAACTCCTGG + Intronic
1006580699 6:35075967-35075989 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1006615446 6:35323087-35323109 CTCGGCTGGCCTCCAACTCCCGG + Intergenic
1006615651 6:35324695-35324717 CAAGGCTGGTCTCCAACTCCTGG - Intergenic
1006655645 6:35590086-35590108 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1006718843 6:36137158-36137180 CACATCTGGTCTCAAACTCCTGG - Intronic
1006753132 6:36392100-36392122 CCCACCTGGCCTCAAACTCCTGG + Intronic
1006947598 6:37795544-37795566 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1006948655 6:37802761-37802783 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1007042884 6:38741193-38741215 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1007110078 6:39308498-39308520 CCCGGCTGGTCTCCAACTCCTGG + Intronic
1007343602 6:41209681-41209703 CTCAGCTGGCCCCAAACTCCTGG - Intergenic
1007546617 6:42699271-42699293 GCCAGCTGGCCTCGAACTCCTGG + Intronic
1007734673 6:43973126-43973148 GGAAGCTGGCCTCCAAGTCAGGG + Intergenic
1008275554 6:49540054-49540076 CCCGGCTGGTCTCAAAGTCCTGG - Intergenic
1009718467 6:67430771-67430793 CACAGCTGATCTCAAACTCCTGG + Intergenic
1009807241 6:68616256-68616278 TACATCTTGCCTCCAAGTCTAGG - Intergenic
1009962934 6:70545538-70545560 CACTGCAGGCCTCCAACTCCTGG - Intronic
1010839337 6:80629728-80629750 CACAGGTTGCCTCCAAATCTTGG - Intergenic
1010872642 6:81061062-81061084 CACAGCTAGCTTCCAAATTCTGG + Intergenic
1011057666 6:83223362-83223384 CCAAGCTGGCCTCGAACTCCTGG + Intronic
1011593001 6:88988767-88988789 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1011679082 6:89765521-89765543 CCAAGCTGGTCTCGAAGTCCTGG + Intronic
1011692747 6:89885516-89885538 CCAAGCTGGACTCCAACTCCTGG - Intergenic
1011893840 6:92199784-92199806 CTCAGCTGGTCTCAAACTCCTGG + Intergenic
1012101071 6:95085490-95085512 CACAGCTGGTCTCTAACTCGTGG - Intergenic
1012317008 6:97793117-97793139 CAAGGCTGGCCTCGAACTCCTGG + Intergenic
1012938338 6:105391429-105391451 CTCAGCTGGTCTCAAACTCCAGG + Intronic
1013255728 6:108383026-108383048 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1013363516 6:109416956-109416978 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1013399674 6:109780420-109780442 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1013448652 6:110256976-110256998 CACAACTGCCCTTCAAGTACAGG + Intronic
1013509602 6:110832358-110832380 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1013512260 6:110855869-110855891 CAGGGCTGGTCTCCAACTCCTGG - Intronic
1013518438 6:110910880-110910902 CAAAGCTGGTCTCCAGCTCCTGG - Intergenic
1013519092 6:110916154-110916176 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1013520339 6:110926923-110926945 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1013524949 6:110965183-110965205 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1013585022 6:111570773-111570795 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1013655037 6:112237796-112237818 CACAGCTAGCATCCAAATCCAGG + Intronic
1014442097 6:121486036-121486058 CCAAGCTGGCCTCGAACTCCTGG + Intergenic
1014445156 6:121518286-121518308 CCCAGCTGGACTCAAACTCCTGG - Intergenic
1015018687 6:128445143-128445165 CTCAGCTGGTCTCCAACTCCTGG - Intronic
1015437126 6:133202287-133202309 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1015775024 6:136805086-136805108 CCCGGCTGGTCTCCAACTCCTGG + Intergenic
1016131851 6:140483128-140483150 CTAAGCTGGTCTCCAACTCCTGG + Intergenic
1016736985 6:147489956-147489978 CCCAGCTGGTCTCCAACTCCTGG - Intergenic
1016928638 6:149380028-149380050 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1017175953 6:151505078-151505100 CTCCGCGGGCCACCAAGTCCAGG - Intronic
1017427643 6:154339482-154339504 CCAAGCTGGCCTCAAACTCCAGG + Intronic
1017447158 6:154517509-154517531 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1017686566 6:156919517-156919539 CACAGCTGGCCACACACTCCAGG - Intronic
1017917907 6:158846892-158846914 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1017973093 6:159329900-159329922 CACTGCTGGCCTGCCAGGCCTGG - Intergenic
1018046615 6:159970866-159970888 TGAAGCTGGCCTCCAACTCCTGG - Intronic
1018410371 6:163539188-163539210 CACAGCTCTCCTCCAAATCCAGG - Intronic
1019351032 7:554061-554083 CCCAGCTCTCCTCCCAGTCCTGG + Intronic
1019670702 7:2276591-2276613 CTCAGCTGGTCTCGAACTCCTGG - Intronic
1019710428 7:2515913-2515935 CACAGCCGGCTCCCAAGGCCGGG - Intronic
1019769490 7:2874760-2874782 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1019822592 7:3256667-3256689 CTAGGCTGGCCTCCAACTCCTGG - Intergenic
1019903947 7:4046149-4046171 CCAGGCTGGCCTCAAAGTCCTGG + Intronic
1019958151 7:4433545-4433567 CCAAGCTGGCCTCAAACTCCTGG + Intergenic
1019973709 7:4563134-4563156 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1020011128 7:4806394-4806416 CACGGCTGGTCTCAAATTCCTGG + Intronic
1020126863 7:5537900-5537922 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1020179916 7:5914221-5914243 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1020303020 7:6810663-6810685 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1020469397 7:8518693-8518715 CCCAGGTGGCCTCAAACTCCTGG + Intronic
1020676704 7:11192361-11192383 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1021996481 7:26182994-26183016 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1021999334 7:26210078-26210100 CCAAACTGGCCTCCAACTCCTGG - Intronic
1022167167 7:27779197-27779219 CCCAGCTGGCCTCAGACTCCTGG + Intronic
1023222368 7:37932344-37932366 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1023311438 7:38890893-38890915 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1023640102 7:42248949-42248971 CTAGGCTGGTCTCCAAGTCCTGG + Intergenic
1023813313 7:43929080-43929102 CCCAGTTGGTCTCCAACTCCTGG - Intronic
1024520645 7:50302804-50302826 CCCAGGAGGCCTCCAAGTCGGGG - Intergenic
1024621542 7:51162117-51162139 CACATCTGGACTCCAAGACACGG - Intronic
1025038020 7:55612278-55612300 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1025083435 7:56003927-56003949 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1025107557 7:56184846-56184868 CCCAGCTGGCCTCCAACTCCTGG - Intergenic
1025116513 7:56263071-56263093 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1025126766 7:56350825-56350847 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1025148081 7:56522479-56522501 CCCAGCTGGTCTCCAACTCTTGG - Intergenic
1025900502 7:65740538-65740560 CCCAGCTGGTCTCCAACTTCTGG - Intergenic
1026201101 7:68215215-68215237 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1026399351 7:69993533-69993555 CCAGGCTGGCCTCAAAGTCCTGG - Intronic
1026875920 7:73879142-73879164 CCAAGCTGGCCTCGAAATCCTGG + Intergenic
1026985592 7:74553495-74553517 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1027138622 7:75641095-75641117 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1027257343 7:76439495-76439517 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1027281504 7:76612546-76612568 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1027379405 7:77590499-77590521 CAAAGCTGGTCTCAAACTCCTGG - Intronic
1027690173 7:81335788-81335810 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1028390800 7:90314411-90314433 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1028411392 7:90534092-90534114 CACAGCTGTCCTGCAGGTCTGGG - Intronic
1028463635 7:91124095-91124117 CTCAGCTGGTCTCAAACTCCTGG + Intronic
1028763763 7:94526577-94526599 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1028765866 7:94559007-94559029 CCAAGCTGGTCTCCAATTCCTGG + Intergenic
1029095807 7:98084347-98084369 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1029190005 7:98765058-98765080 CACATCTGGCCCGCAAATCCAGG + Intergenic
1029210300 7:98902861-98902883 CCGAGCTGGCCTCCAACTCCTGG - Intronic
1029237049 7:99129599-99129621 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1029238975 7:99144875-99144897 CCAGGCTGGCCTCAAAGTCCTGG - Intergenic
1029270897 7:99375711-99375733 CCATGCTGGCCTCCAACTCCTGG - Intronic
1029275627 7:99402394-99402416 CCCAGGTGGTCTCCAACTCCTGG - Intronic
1029342172 7:99954180-99954202 CCCAGCTGGTCTCGAACTCCTGG + Intergenic
1029375250 7:100173485-100173507 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1029375275 7:100173718-100173740 CCCAGCTGGGCTCCAACTCCTGG + Intronic
1029455867 7:100672068-100672090 AGCATCTGCCCTCCAAGTCCCGG - Intergenic
1029555870 7:101268674-101268696 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1029569604 7:101360890-101360912 CCAAGCTGGCCTCGAACTCCTGG + Intergenic
1029571315 7:101371437-101371459 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1029638073 7:101798769-101798791 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1029656331 7:101927446-101927468 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1029673418 7:102049628-102049650 CCCAGCTGGACTCAAACTCCTGG - Intronic
1029809968 7:103037593-103037615 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1029841140 7:103364615-103364637 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1029981104 7:104879980-104880002 CCAGGCTGGCCTCCAATTCCTGG - Intronic
1030371155 7:108700553-108700575 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1030546072 7:110897022-110897044 CAAGGCTGGCATCCAACTCCTGG + Intronic
1030683478 7:112457667-112457689 CCCAGGTGGTCTCCAACTCCTGG - Intronic
1031005615 7:116467747-116467769 CCCAGCTGGCCTTGAACTCCTGG + Intronic
1031007067 7:116485401-116485423 CAGAGCTGGTCTCAAACTCCTGG + Intronic
1031032968 7:116754609-116754631 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1031510594 7:122643879-122643901 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1031522292 7:122780715-122780737 CCCAGCTGGTCTCTAACTCCTGG + Intronic
1031969303 7:128052534-128052556 CAGAGCTGTCTTCCAAGTCACGG + Intronic
1031984473 7:128154395-128154417 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1032345487 7:131112610-131112632 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1032656772 7:133938957-133938979 CACACCTGGTCTCAAACTCCTGG + Intronic
1032829470 7:135608496-135608518 CCCGGCTGGTCTCCAACTCCTGG - Intronic
1032836125 7:135676121-135676143 CAAAGCTGGTCTCAAATTCCTGG + Intronic
1033167336 7:139051631-139051653 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1033227845 7:139575097-139575119 CACAGCTGGCGCCCCAGGCCAGG - Intronic
1033304491 7:140214466-140214488 AACAGCTGGCCTCCAAACACCGG + Intergenic
1033636329 7:143214636-143214658 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1034333727 7:150306635-150306657 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1034463545 7:151211914-151211936 CTCAGATGGCCACAAAGTCCAGG - Intronic
1034664319 7:152803255-152803277 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1034803586 7:154068514-154068536 ACCAGCTGCCCTCCAAGGCCGGG - Intronic
1035159124 7:156938322-156938344 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1035200152 7:157258154-157258176 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1035723041 8:1806681-1806703 CAGGGCTGGCCTCAAACTCCTGG - Intergenic
1035966480 8:4197667-4197689 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1036671060 8:10788350-10788372 AACTGCTGGTCTCCAACTCCTGG - Intronic
1036996470 8:13663466-13663488 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1037629099 8:20636843-20636865 CCAAGCTGTCCTCCAAGTCCTGG - Intergenic
1037771135 8:21800713-21800735 CTGGGCTGGCCTCCAACTCCTGG - Intronic
1038199949 8:25402651-25402673 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1038336099 8:26646779-26646801 CCCAGCTGGGCTCGAAGTCCTGG - Intronic
1038462502 8:27728812-27728834 CCCAGCTGGCCTCGAACTCCCGG - Intergenic
1038495301 8:27997522-27997544 CATGGCTGGTCTCCAACTCCTGG - Intergenic
1038955264 8:32461487-32461509 CAAAGCTGGTCTCGAACTCCTGG - Intronic
1039031090 8:33310498-33310520 CATAGCTGGTCTCAAACTCCTGG - Intergenic
1039143592 8:34420575-34420597 CACAGCTGGTATCCAACTCCTGG + Intergenic
1039414547 8:37382461-37382483 CCCGGCTGGTCTCCAACTCCCGG - Intergenic
1039504443 8:38041779-38041801 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1039605444 8:38876757-38876779 CCATGCTGGCCTCCAACTCCTGG + Intergenic
1039608095 8:38899542-38899564 CAGAGCTGGGCTTCAAATCCAGG + Intergenic
1040035852 8:42869117-42869139 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1040038267 8:42892372-42892394 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1040432565 8:47358295-47358317 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1040905513 8:52465649-52465671 CCACGCTGGCCTCCAACTCCTGG - Intergenic
1040988646 8:53324840-53324862 CAAAGCTGGTCTCAAACTCCTGG - Intergenic
1041007003 8:53505117-53505139 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1041051940 8:53942777-53942799 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1041167036 8:55101560-55101582 CGCTGCTGGCCTCCGAGCCCGGG + Intergenic
1041809044 8:61887263-61887285 CACTGCTGGCCTCTAATACCAGG - Intergenic
1042267881 8:66926934-66926956 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1042288880 8:67146330-67146352 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1042588486 8:70370092-70370114 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1042604384 8:70531058-70531080 CAAGGCTGGCCTCGAAATCCTGG - Intergenic
1042676949 8:71332060-71332082 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1043460683 8:80457050-80457072 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1043705726 8:83347571-83347593 GCTAGCTGGCCTCCAAGCCCTGG + Intergenic
1043854895 8:85253795-85253817 CCCAGCTGCCCTCAAACTCCTGG - Intronic
1044231202 8:89780459-89780481 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1044287437 8:90425442-90425464 CCAACCTGGCCTCCAATTCCTGG + Intergenic
1044289158 8:90447256-90447278 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1044434360 8:92144864-92144886 CTCAGCTGGTCTCCTACTCCTGG - Intergenic
1044656602 8:94554682-94554704 CCCCACTGGCCTCCAACTCCTGG - Intergenic
1045158408 8:99506646-99506668 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1045309619 8:100989685-100989707 CCAAGCTGGTCTCAAAGTCCTGG + Intergenic
1045338287 8:101228795-101228817 CCGGGCTGGCCTCCAACTCCTGG + Intergenic
1045395615 8:101757997-101758019 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1045403752 8:101844568-101844590 CACAGCTGGTCTCAAACTGCTGG + Intronic
1045636828 8:104200694-104200716 CTAGGCTGGTCTCCAAGTCCTGG - Intronic
1045637386 8:104207976-104207998 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1046034667 8:108826181-108826203 CTCAGCTGGTCTCAAACTCCTGG + Intergenic
1046535043 8:115498165-115498187 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1046793914 8:118349916-118349938 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1047763459 8:127971267-127971289 CACAGCTGGCATTCACCTCCAGG + Intergenic
1047905334 8:129467091-129467113 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1047925430 8:129678262-129678284 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1047977558 8:130146059-130146081 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
1048015886 8:130497716-130497738 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1048308830 8:133302643-133302665 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1048661662 8:136610443-136610465 CTGAGCTGGTCTCAAAGTCCTGG + Intergenic
1048869774 8:138787722-138787744 CAGGGCTTGGCTCCAAGTCCAGG + Intronic
1049062821 8:140289315-140289337 CACACCTTGGCTCCAAGTCCGGG - Intronic
1049280126 8:141739978-141740000 CACCCCTGGCCCCCAAGGCCAGG - Intergenic
1049566887 8:143344909-143344931 CACAGCTGCTCTCCAGGTGCTGG - Intronic
1049759237 8:144324474-144324496 CACACATAGCCTGCAAGTCCTGG + Intronic
1050321454 9:4457151-4457173 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1050332373 9:4558266-4558288 CAGAGCTGGCCCCCAAGTCCAGG - Intronic
1050468449 9:5958575-5958597 CCCACCTGGCCTCGAACTCCGGG - Intronic
1051248009 9:15131258-15131280 CACAGGTGGTCTCAAACTCCTGG - Intergenic
1051893971 9:21969770-21969792 TACAGCTAGCATCCAGGTCCCGG - Intronic
1052225961 9:26086635-26086657 CAGAGCTGGTCTCAAACTCCTGG - Intergenic
1052406110 9:28063471-28063493 CCAAGCTGGCCTCAAACTCCTGG + Intronic
1052912988 9:33900775-33900797 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1052967944 9:34355615-34355637 CCCAGCTGGTCTCAAATTCCTGG + Intergenic
1053220649 9:36309876-36309898 CAGAGCTGGTCTCAAACTCCTGG + Intergenic
1053314903 9:37042880-37042902 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1053385129 9:37680998-37681020 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1054911141 9:70456313-70456335 CCAAGCTGGCCTGGAAGTCCTGG - Intergenic
1055036410 9:71823082-71823104 CCCAGCTGGTCTCCAACTTCTGG + Intergenic
1055304300 9:74912876-74912898 CCAAGCTGGCCTCAAACTCCTGG - Intergenic
1055609186 9:78004072-78004094 CAAAGCTGACCTCCAACTACAGG + Intronic
1056153338 9:83810019-83810041 CTAAGCTGGTCTCCAACTCCTGG + Intronic
1056191543 9:84189007-84189029 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1056402771 9:86244281-86244303 CCCAGCTGGTCTCCAACTCTTGG + Intronic
1056419394 9:86409176-86409198 CCCAGCTGGTCTCGAACTCCAGG + Intergenic
1056897650 9:90565920-90565942 CCAGGCTGGCCTCCAACTCCTGG - Intergenic
1057259084 9:93574324-93574346 CTCAGCTGGTCTCCAAGTCTTGG - Intergenic
1057372833 9:94489626-94489648 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
1057813564 9:98277121-98277143 CCCAGCTAGTCTCCAATTCCTGG - Intergenic
1058488867 9:105473093-105473115 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1058844731 9:108945682-108945704 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1059118912 9:111623899-111623921 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1059203839 9:112444951-112444973 CACTGCAGCCCTCAAAGTCCTGG + Intronic
1059473042 9:114521599-114521621 CCAGGCTGGCCTCAAAGTCCTGG - Intergenic
1060070910 9:120546706-120546728 CACTGCAGGCCTCAAACTCCTGG + Intronic
1060165789 9:121413434-121413456 CCCAGCTTGTCTCCAACTCCTGG + Intergenic
1060200135 9:121647503-121647525 CAGAGCTGGGCTGAAAGTCCAGG - Intronic
1060347517 9:122829578-122829600 CCAGGCTGGCCTCCAAGTCCTGG - Intergenic
1060421886 9:123475226-123475248 CCAAGCTGGCCTCGAACTCCTGG + Intronic
1060521460 9:124296387-124296409 CAAGGCTGACCTCCAAGGCCAGG + Intronic
1060560209 9:124536423-124536445 CTCAAGTGGCCTCCAAGTGCTGG - Intronic
1060610204 9:124957200-124957222 CCCAGCTGGTCTCCAACTCCTGG + Intronic
1060653319 9:125349787-125349809 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1060697383 9:125721015-125721037 CCAAGCTGGTCTCCAATTCCTGG + Intergenic
1060889975 9:127181941-127181963 CACAACTGGCCTCCTATCCCTGG + Intronic
1060991523 9:127852377-127852399 CCCAGCTGGCTTCCAGGCCCTGG + Intronic
1061036304 9:128116102-128116124 CCAAGCTGGTCTCCAACTCCCGG - Intergenic
1061101618 9:128496603-128496625 CAGAGCTGGGCCCCAAGGCCAGG - Intronic
1061250888 9:129425771-129425793 CCAAGCTGGTCTCCAACTCCAGG - Intergenic
1061427823 9:130511451-130511473 CCCAGATGGCCTCAAACTCCTGG + Intergenic
1061436323 9:130564699-130564721 CCCAGCTGGTCTCAAACTCCTGG - Intergenic
1061469440 9:130812152-130812174 CAAAGCTGGTCTCAAACTCCTGG - Intronic
1061476011 9:130866884-130866906 CCCAGCTGGCCTCAAACTCCTGG + Intronic
1061720410 9:132547639-132547661 CACAGCTGGGCTCCTGGGCCGGG + Intronic
1061852222 9:133422983-133423005 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1061860286 9:133464439-133464461 CACACCAGGCCTCCAAGCACGGG - Intronic
1061952345 9:133943539-133943561 CTCAGCTGGACTTAAAGTCCAGG - Intronic
1062097628 9:134711111-134711133 CACAGCTGGCCTCCGCCTCTGGG + Intronic
1062318738 9:135980330-135980352 CCAGGCTGGCCTCCAACTCCTGG + Intergenic
1062513310 9:136919925-136919947 CCCAGCTAGTCTCCAACTCCTGG + Intronic
1203365558 Un_KI270442v1:251740-251762 CAAGGCTGGCCTCAAACTCCTGG + Intergenic
1185824767 X:3239636-3239658 CCCAGCTGGCCTTAAACTCCTGG + Intergenic
1185867261 X:3634911-3634933 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1186026257 X:5316515-5316537 CCAAGCTGGTCTCCAACTCCTGG - Intergenic
1186049399 X:5574215-5574237 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1186115076 X:6296956-6296978 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1186482163 X:9904308-9904330 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1186742836 X:12535856-12535878 CACAGCTATACTCCAAGTCAGGG - Intronic
1186881113 X:13867317-13867339 CCCAGCTGGTCTCAAACTCCTGG + Intronic
1187052112 X:15705106-15705128 CCAGGCTGGTCTCCAAGTCCTGG - Intronic
1187145904 X:16637143-16637165 CCCAGCTGGTCTCCGACTCCTGG + Intronic
1187172392 X:16864740-16864762 CCAGGCTGGCCTCCAACTCCTGG + Intronic
1187315726 X:18192928-18192950 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1187348539 X:18489839-18489861 CCCAGCTGGTCTCCAATTCCTGG - Intronic
1187380253 X:18795098-18795120 CAAGGCTGGTCTCCAACTCCTGG - Intronic
1187539322 X:20176078-20176100 CCAAGCTGGTCTCCAACTCCTGG + Intronic
1187709639 X:22040419-22040441 CCAGGCTGGCCTCCAACTCCAGG - Intronic
1187875660 X:23801592-23801614 CAAAGCTGGTCTCGAACTCCTGG - Intergenic
1187904907 X:24056647-24056669 CCCAGGTGGTCTCCAACTCCTGG - Intronic
1187925993 X:24250545-24250567 CCAAGCTGGTCTCCAACTCCTGG + Intergenic
1187950933 X:24469564-24469586 CAGGGCTGGCCTCAAACTCCTGG - Intronic
1188212474 X:27442021-27442043 CACTACTGGTCTCCAAGTCTTGG - Intergenic
1189098418 X:38163922-38163944 CACAGATGGCTTCCCAGTGCAGG + Intronic
1189153907 X:38735587-38735609 CCCAGTTGGTCTCCAACTCCTGG - Intergenic
1190002775 X:46705535-46705557 CCCAGCTGGTCTCAAACTCCTGG - Intronic
1190094175 X:47465644-47465666 CCCAGCTGGGCTCAAACTCCTGG - Intronic
1191569440 X:62590950-62590972 CACAACTGGCCTCAAAGCGCTGG - Intergenic
1192191210 X:68992265-68992287 CAGAGCTGACATCCAAGTCAGGG + Intergenic
1192489747 X:71565436-71565458 CTAGGCTGGCCTCCAACTCCTGG + Intronic
1192525139 X:71836405-71836427 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1194861199 X:99000880-99000902 CTAAGCTGGTCTCAAAGTCCTGG + Intergenic
1196087938 X:111706545-111706567 CCCAGCTGGTCTCGAACTCCTGG - Intronic
1196401857 X:115325060-115325082 CTCAGCTGGTCTCAAACTCCTGG - Intergenic
1196674632 X:118406354-118406376 CCAAGCTGGTCTCCAACTCCTGG - Intronic
1197064356 X:122220844-122220866 CCCAGCTGGACTCCAAGGCTGGG - Intergenic
1197237132 X:124079569-124079591 CCAGGCTGGCCTCCAACTCCTGG - Intronic
1197771326 X:130091495-130091517 CCAGGCTGGTCTCCAAGTCCTGG + Intronic
1198071688 X:133154652-133154674 CCCAGCTGGTCTCAAACTCCTGG + Intergenic
1198075327 X:133188340-133188362 CATGGCTGGCCTCAAACTCCTGG - Intergenic
1198083338 X:133260515-133260537 CAGAGCTGGGATCCAAATCCAGG - Intergenic
1198234211 X:134721361-134721383 CCAAGCTGGCCTCAAACTCCTGG - Intronic
1198546229 X:137695524-137695546 CCCTGCTGGCCTCAAACTCCTGG + Intergenic
1199166939 X:144687598-144687620 CATAGCTGCTCTGCAAGTCCTGG + Intergenic
1199438923 X:147846080-147846102 CAAAGCTGGTCTCAAACTCCTGG + Intergenic
1199749238 X:150798958-150798980 CAAAGCTGGTCTCAAACTCCTGG + Intronic
1199985758 X:152948980-152949002 CACAGCTAGTCCCCTAGTCCAGG - Intronic
1200074728 X:153545252-153545274 CACAGCAGCCCTGCAAGGCCAGG - Intronic
1200233091 X:154455023-154455045 CCCAGCTGGTCTCGAACTCCTGG - Intergenic
1200951912 Y:8905640-8905662 CCAAGCTGGTCTCCAAATCCTGG - Intergenic
1201159939 Y:11158765-11158787 CACAGCAAGACTCCAAGTGCAGG - Intergenic
1201700363 Y:16874562-16874584 CCAAGCTGGTCTCAAAGTCCTGG + Intergenic
1202576813 Y:26336533-26336555 CCCAGCTGGTCTCAAACTCCTGG - Intergenic