ID: 1082085554

View in Genome Browser
Species Human (GRCh38)
Location 11:48046730-48046752
Sequence TGTAATAATCCACATAGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 111}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082085554_1082085557 0 Left 1082085554 11:48046730-48046752 CCTACCCTATGTGGATTATTACA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1082085557 11:48046753-48046775 GTTTACTTGTGTGTAAACTTAGG 0: 1
1: 0
2: 1
3: 51
4: 576
1082085554_1082085560 15 Left 1082085554 11:48046730-48046752 CCTACCCTATGTGGATTATTACA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1082085560 11:48046768-48046790 AACTTAGGCTCAGAGAGGCTGGG 0: 1
1: 5
2: 101
3: 424
4: 1351
1082085554_1082085558 10 Left 1082085554 11:48046730-48046752 CCTACCCTATGTGGATTATTACA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1082085558 11:48046763-48046785 GTGTAAACTTAGGCTCAGAGAGG 0: 1
1: 0
2: 55
3: 912
4: 3673
1082085554_1082085559 14 Left 1082085554 11:48046730-48046752 CCTACCCTATGTGGATTATTACA 0: 1
1: 0
2: 0
3: 4
4: 111
Right 1082085559 11:48046767-48046789 AAACTTAGGCTCAGAGAGGCTGG 0: 1
1: 6
2: 53
3: 249
4: 753

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082085554 Original CRISPR TGTAATAATCCACATAGGGT AGG (reversed) Intronic
901782790 1:11605126-11605148 TGTAAACATCCACACAGGTTGGG - Intergenic
907606508 1:55823087-55823109 TGAAATAACCCACATATGGAAGG - Intergenic
907616480 1:55931803-55931825 GGTAATAATCCACATACCATAGG - Intergenic
908490561 1:64639790-64639812 TGTATTAAGCCACAGAGTGTTGG - Intronic
910519061 1:88097038-88097060 TTTAATGACCCACAGAGGGTTGG - Intergenic
913544802 1:119857873-119857895 TGTCAAAATCCACAAAGGGGTGG - Intergenic
916495576 1:165343935-165343957 TGAAATAATTCACATTGGGATGG - Intronic
917018922 1:170564948-170564970 TTTAAAAATCCACATAGAATTGG + Intergenic
918201697 1:182273373-182273395 TGTAAAATTCCACAGAGGGATGG + Intergenic
919444428 1:197684372-197684394 TGTAAAAAAATACATAGGGTTGG - Intronic
920832633 1:209479203-209479225 TGTCACAATGCACATATGGTGGG + Intergenic
922688282 1:227665043-227665065 TGGTATAATCCCCATTGGGTAGG - Intronic
923541594 1:234892108-234892130 TGTATTAATACACACAGTGTAGG - Intergenic
924102993 1:240623333-240623355 TGTTACAATCTACACAGGGTTGG - Intergenic
1064818869 10:19300704-19300726 TGTTTTAATCCACATTGAGTTGG - Intronic
1070608971 10:77920510-77920532 TCTAAAAACCCACATAGTGTTGG + Intronic
1082085554 11:48046730-48046752 TGTAATAATCCACATAGGGTAGG - Intronic
1082226722 11:49716418-49716440 TGTAATACTCAACAGAGAGTTGG - Intergenic
1082241214 11:49873045-49873067 TTTAATATTCAACATAGAGTAGG + Intergenic
1082910270 11:58364996-58365018 TATAATAATCCACATAAGTGTGG + Intergenic
1089095485 11:115916666-115916688 TGTCATAACCCACATAGGCTGGG - Intergenic
1092436469 12:8450925-8450947 TGTAATAATCCACATTCCTTTGG - Intergenic
1093548955 12:20383959-20383981 TGCAATAATCCAGAGATGGTTGG + Intronic
1098456791 12:70683533-70683555 TTTAATAATGCAAAGAGGGTGGG - Intronic
1105567124 13:21560675-21560697 TGCAATAATCCCAATGGGGTAGG - Intronic
1109511482 13:63380480-63380502 TACAATAATCCACATAAGGCTGG - Intergenic
1111376669 13:87388357-87388379 TGGATTAATCCACATTTGGTTGG + Intergenic
1113274026 13:108708024-108708046 TGTAATAATACACACAGGCTGGG - Intronic
1114921778 14:27341826-27341848 TGTAATAATCCCCATGTGTTGGG + Intergenic
1116169493 14:41381813-41381835 TTTAATAATCAACAGAGGCTGGG + Intergenic
1119694913 14:76705478-76705500 TGTACCCATCCACATATGGTTGG - Intergenic
1120264171 14:82228065-82228087 TGTATTTATACACATAGGCTTGG + Intergenic
1124012769 15:25852055-25852077 TGAAATAATGCAGAGAGGGTGGG - Intronic
1139231043 16:65282714-65282736 TGTAATAGTCCACATAGTATTGG - Intergenic
1143004523 17:3820243-3820265 GTTAATAATACACATAGGATGGG - Intronic
1146533270 17:33628589-33628611 TTTAAAAAGCCAGATAGGGTTGG - Intronic
1148939300 17:51194271-51194293 TTTAAAAGTCCACATAGGGCTGG + Intronic
1149627105 17:58087633-58087655 TGTAATAATCCTCATCATGTAGG + Intronic
1151978192 17:77494125-77494147 TGGGATCATCCACTTAGGGTAGG - Intronic
1152987933 18:336344-336366 TCTAATAATACACATAAGGAAGG + Intronic
1153066045 18:1046228-1046250 TGATCTAATCCACCTAGGGTGGG + Intergenic
1153501971 18:5759071-5759093 TGCAAAAATCCATATAGGCTGGG - Intergenic
1154301537 18:13197518-13197540 TATAGTAATCCAAATAGTGTGGG - Intergenic
1155749783 18:29407212-29407234 TGTAATAATAGACATACAGTAGG + Intergenic
1156792738 18:40996560-40996582 TGTAACCATCCACATATGATGGG - Intergenic
1159571276 18:70115286-70115308 AGTAATAATCCACATAGCACTGG - Intronic
1159805076 18:72946537-72946559 TGTAATTTCCTACATAGGGTAGG + Intergenic
1161635544 19:5386580-5386602 AGCACAAATCCACATAGGGTGGG + Intergenic
1162143705 19:8600106-8600128 TGTAAAAATACACACAGGCTGGG - Intronic
1162424591 19:10586940-10586962 TGTATTAATTCTCATTGGGTGGG + Intronic
1165363666 19:35351425-35351447 TGTAATTCTCCACACAGGGCTGG + Intergenic
1165681239 19:37778217-37778239 TAAAATAATCCACATAAGGCTGG + Intronic
925256877 2:2498021-2498043 TGTAATAATCCCCACATGTTGGG + Intergenic
925692498 2:6539220-6539242 TGCATTAATTCACTTAGGGTTGG - Intergenic
928762197 2:34597855-34597877 TGTAGTAATCAGGATAGGGTAGG + Intergenic
928941946 2:36735351-36735373 TGTGATAAGCCAAATATGGTGGG - Intronic
932006194 2:67929526-67929548 AATAATAATCCTCATAGGTTAGG - Intergenic
932106637 2:68949316-68949338 TTTAATTATGTACATAGGGTAGG - Intronic
932346076 2:70995984-70996006 TGAAATAAGCCAAATAGGGAAGG + Intergenic
933415313 2:81979975-81979997 TGTAATAATCCATATTTAGTAGG - Intergenic
937512863 2:122617313-122617335 TTTAACATTTCACATAGGGTTGG + Intergenic
944215147 2:197247324-197247346 TGTAACAAGTCACATTGGGTGGG + Intronic
944737012 2:202576186-202576208 TGGAATAATAGACATTGGGTGGG - Intergenic
948432744 2:237930408-237930430 TGTAAAAAACCAATTAGGGTAGG - Intergenic
949053006 2:241907581-241907603 TGTTATAATGAACAAAGGGTTGG - Intergenic
1171891538 20:30722919-30722941 TATAATAAGCAACATAGGCTGGG + Intronic
1173814955 20:45981290-45981312 TTTAAAAATGCACATAGGGCCGG - Intergenic
1174718673 20:52787376-52787398 TGTAATAATTAACATAGCCTTGG - Intergenic
1176625654 21:9089138-9089160 TATAATAAACAACATAGGCTGGG - Intergenic
1178665519 21:34543122-34543144 TGTTATGATCCACATAGGTGTGG + Intronic
1179776229 21:43664944-43664966 TGTAATAATCCCCACGTGGTGGG - Intronic
1183968439 22:41457887-41457909 TTTAAGAAAACACATAGGGTTGG + Intergenic
953523949 3:43671216-43671238 TGTTATAATCCACACACTGTGGG - Intronic
960467503 3:118015206-118015228 TGCAATAATCCACAAAGGAGAGG - Intergenic
969177993 4:5414327-5414349 TGTAATACTCCATACAGGTTTGG + Intronic
972029294 4:34432700-34432722 TGTACTAATCAAGATAGGATTGG + Intergenic
973028342 4:45303064-45303086 AGTCATAATCCATTTAGGGTAGG - Intergenic
975426733 4:74238158-74238180 TGTAATAATCCATACAGAGGTGG + Intronic
977886706 4:102259779-102259801 TGTAATAACCCATATGGGGCAGG + Intronic
978363157 4:107952172-107952194 TGTAATTATTCAAATAAGGTAGG - Exonic
979992185 4:127388539-127388561 TGTAATCATCCCCATAAGATTGG + Intergenic
980727306 4:136780259-136780281 TGTAATAGACAACATATGGTTGG + Intergenic
983574602 4:169247574-169247596 GGTAATAACACATATAGGGTGGG + Intronic
984369427 4:178843195-178843217 TGAAATAATTCAAAAAGGGTTGG + Intergenic
997612440 5:135224635-135224657 TGTAATGATCCAAAGAGAGTGGG + Intronic
1000308398 5:160017504-160017526 TGAAATAATCCCCATTGTGTTGG - Intronic
1000806693 5:165803941-165803963 TGTAATAGTCAACATAGAATTGG - Intergenic
1004591547 6:17056455-17056477 TGGAATAATCTTCATGGGGTGGG - Intergenic
1008578658 6:52885516-52885538 GGTAATAATGCACATATGGAAGG + Intronic
1008778084 6:55065311-55065333 CGGAATAATCCAAAGAGGGTCGG + Intergenic
1015390147 6:132672840-132672862 TGTATTAATCAGCATAGGCTAGG - Intergenic
1017306068 6:152919923-152919945 TGAAATAATCAACATATGCTTGG + Intergenic
1018914023 6:168121801-168121823 TCTATTAATCCAGATGGGGTAGG - Intergenic
1020829763 7:13079967-13079989 TGTATTAGTCAACATAGGATGGG + Intergenic
1023324163 7:39034514-39034536 TATAATAATGCACATAAAGTCGG + Intronic
1023353679 7:39345707-39345729 TGGAAGAATCCACATGGGGTAGG + Intronic
1026357782 7:69574474-69574496 TGTAATTTTCCACAAAGAGTGGG - Intergenic
1027210251 7:76141462-76141484 GGTAATATTTCACATAGGCTAGG - Intergenic
1032838998 7:135699194-135699216 TGTAATAAGGCACATTGGGAGGG - Intronic
1036736938 8:11327938-11327960 TGTAATCATTCACCTTGGGTTGG + Exonic
1037173025 8:15916264-15916286 TGTAATCTTCCACATAGGAGCGG + Intergenic
1041400015 8:57432759-57432781 TGTAATAATTAACATATAGTGGG + Intergenic
1042451755 8:68955740-68955762 TGTAATAATTATGATAGGGTAGG + Intergenic
1042865976 8:73357021-73357043 TTTAATAATCCACATTGTTTGGG + Intergenic
1043552788 8:81393752-81393774 TGTGATATTCCAGATAGAGTTGG + Intergenic
1044752447 8:95429545-95429567 TGTAATAATCAGGGTAGGGTAGG + Intergenic
1051341567 9:16116594-16116616 TTTAAAAATCCAAAAAGGGTTGG + Intergenic
1051761051 9:20464876-20464898 TGTAATAACCCACACAGGTCTGG + Intronic
1055672060 9:78617784-78617806 TGTGTTCAGCCACATAGGGTGGG + Intergenic
1062421790 9:136486109-136486131 TGTAAAACTCCACATGGGGCTGG + Intergenic
1203748823 Un_GL000218v1:59567-59589 TATAATAAACAACATAGGCTGGG - Intergenic
1186588308 X:10900606-10900628 TGTAGGAATCCATATAGGTTTGG - Intergenic
1186857271 X:13638318-13638340 TCTAATAATTCACAAAGGGGTGG + Intergenic
1187662063 X:21559522-21559544 TGTTATAATGAACAAAGGGTCGG + Intronic
1197350772 X:125380364-125380386 TGTAATCTTTCACATAGGTTAGG + Intergenic
1200086434 X:153609563-153609585 TGAAATAATCCACTTCTGGTAGG - Intergenic