ID: 1082086848

View in Genome Browser
Species Human (GRCh38)
Location 11:48057507-48057529
Sequence AAGGCTGCCCGTGACTGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 138}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086848_1082086855 4 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086855 11:48057534-48057556 ACCCAGAGGCCTTCTCACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1082086848_1082086852 -10 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086852 11:48057520-48057542 GGGCAGCCTTGGGTACCCAGAGG 0: 1
1: 0
2: 7
3: 53
4: 278
1082086848_1082086864 26 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086848_1082086862 20 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086848_1082086860 14 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1082086848_1082086854 3 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086854 11:48057533-48057555 TACCCAGAGGCCTTCTCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1082086848_1082086858 10 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1082086848_1082086865 29 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086848_1082086861 17 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265
1082086848_1082086863 23 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086848 Original CRISPR AAGGCTGCCCGTGACTGGCC TGG (reversed) Intronic
900594975 1:3476543-3476565 AGGGCTGCCCGGGCCTGGGCTGG - Intronic
901219870 1:7577437-7577459 ACGGTTGCCTGTGACTGGTCGGG + Intronic
901859982 1:12068201-12068223 AAGGATGACTGTGTCTGGCCCGG + Intronic
903651430 1:24924825-24924847 AAGGCTCCTCGTGTCTGGCAGGG + Intronic
904235833 1:29116447-29116469 AAAGATACCTGTGACTGGCCAGG - Intronic
905631622 1:39522001-39522023 GAGTCGGCCCTTGACTGGCCTGG + Intronic
905666131 1:39764171-39764193 GAGTCGGCCCTTGACTGGCCTGG - Intronic
911054724 1:93700024-93700046 AGCTCTGCCCTTGACTGGCCAGG - Intronic
912716978 1:111989906-111989928 GAGGCAGCCCGTGGCCGGCCGGG - Intergenic
913186866 1:116376441-116376463 AAAGTTGCCCGGGCCTGGCCGGG + Intronic
916500524 1:165383302-165383324 AAGGCTGGCCGAGCCAGGCCTGG - Intergenic
918629109 1:186694589-186694611 AAGGCAGCCCCTTACTGGCTAGG - Intergenic
922555586 1:226529865-226529887 GAGTCGGCCCCTGACTGGCCTGG + Intergenic
923673818 1:236064166-236064188 GATCCTCCCCGTGACTGGCCGGG - Intronic
924563714 1:245178736-245178758 AAGACTGCCCGTGTCAAGCCTGG + Intronic
1062969922 10:1639464-1639486 CAGGCTGCTCGTGAATGGTCTGG - Intronic
1065642430 10:27797800-27797822 AAGGCTGACCGTTACTGCTCTGG + Intergenic
1072282112 10:93875802-93875824 AAGGTTGGCCGTGGCTGGACAGG - Intergenic
1073885970 10:108039987-108040009 GAGGCTGCCCGTTACTGGGCGGG + Intergenic
1074598306 10:114887912-114887934 AAGGCTCCCAGAGAATGGCCTGG + Intronic
1076370743 10:129951577-129951599 AACCCAGCCCTTGACTGGCCTGG + Intronic
1077352665 11:2100099-2100121 CAGGCTGCCTGAGGCTGGCCTGG + Intergenic
1077549971 11:3195840-3195862 CAGGCTGCCTCTGACTGCCCAGG - Intergenic
1082086848 11:48057507-48057529 AAGGCTGCCCGTGACTGGCCTGG - Intronic
1083306013 11:61762389-61762411 GAGGCTGCCCGAGGCTGCCCAGG - Intronic
1083486218 11:62984465-62984487 CAGGCTGCCCCTGCCTGTCCCGG + Exonic
1083726665 11:64632004-64632026 AAGACTGCCCCAGTCTGGCCTGG + Intronic
1084087473 11:66861197-66861219 GAGGCTGCCCGGGCCTGGCCAGG - Intronic
1084428915 11:69100762-69100784 AATGCTGCCCGAGCCTGGGCTGG + Intergenic
1085698927 11:78729227-78729249 AGACCTGTCCGTGACTGGCCAGG - Intronic
1087161639 11:94953928-94953950 AAGGTTGCCCCTTACTGGCAAGG + Intergenic
1087499428 11:98931719-98931741 AATGCTGCCCTAGACTGTCCCGG - Intergenic
1088896294 11:114081106-114081128 AAGCCTGCCTGTGACTGCCCAGG + Intronic
1091767403 12:3130555-3130577 AGGGCTTCTCGGGACTGGCCTGG + Intronic
1092166777 12:6347443-6347465 AAGCCAGCCCCCGACTGGCCTGG - Exonic
1096532518 12:52250565-52250587 GACGCTGCCCGTCACCGGCCGGG + Intronic
1096542326 12:52314742-52314764 GACGCTGCCCGTCACCGGCCGGG + Exonic
1098668878 12:73199331-73199353 AGGGGTGCCCGTGATTGCCCAGG - Intergenic
1098679236 12:73329103-73329125 TAGGCTGACCGTGTCTGACCAGG + Intergenic
1098750814 12:74292279-74292301 AAGGCTGGGCGGGGCTGGCCAGG - Intergenic
1103919340 12:124391281-124391303 AAGGCTGGAGGTGACTGGCTGGG - Intronic
1103948308 12:124539068-124539090 CAGGCTGCCCGCGAGCGGCCAGG + Intronic
1104454404 12:128898885-128898907 CAGGCTGCCCTTGAATGGTCAGG + Intronic
1105505599 13:21006866-21006888 CAGGCAGCCCGTGAGTGCCCAGG + Intronic
1106683345 13:32031183-32031205 AAGGCTTCCCGTGAGCGGCCCGG - Intergenic
1109257791 13:60104794-60104816 AACACTGCCAGTGATTGGCCAGG + Intronic
1109612660 13:64786976-64786998 AAGGCTACCTGGGACTGGGCAGG - Intergenic
1113707279 13:112443037-112443059 AAGGCTAAACGTGGCTGGCCCGG + Intergenic
1113958635 13:114113029-114113051 AAGGCTTCCCGTGCATGGCAGGG - Intronic
1114080247 14:19197654-19197676 AAGTCAGCCCTTGCCTGGCCTGG - Intergenic
1114382206 14:22218953-22218975 CAGGCTCCAGGTGACTGGCCAGG - Intergenic
1119899472 14:78247675-78247697 AAGGCTGCCCATAACAGGACGGG - Intronic
1121369074 14:93340466-93340488 AAGGCCACCTATGACTGGCCTGG + Intronic
1122405120 14:101496338-101496360 AAGCCTCCACGTGACTAGCCAGG + Intergenic
1126336356 15:47589749-47589771 AAGGCCACCAGTGACTGTCCTGG - Intronic
1128223260 15:65983231-65983253 AAGGCTGCCTGTTACTTCCCAGG - Intronic
1128524884 15:68405583-68405605 AAGGCTGCCCGCTGCTAGCCAGG - Intronic
1130657054 15:85799087-85799109 AAGCCTGCCCTGGTCTGGCCTGG + Intergenic
1132742142 16:1420163-1420185 ACGTTTGCCCGTGACTGTCCTGG - Exonic
1132827760 16:1913611-1913633 AGGGCTGGGCGTGACTGGCAAGG - Intronic
1132974671 16:2705400-2705422 GAGGGTGCCCGTGCCAGGCCAGG + Intronic
1135643612 16:24142534-24142556 GAGGCTGCCTGTGCCAGGCCTGG - Intronic
1136248156 16:28986705-28986727 CAGGCTACCTGTGAGTGGCCAGG + Exonic
1138342507 16:56299429-56299451 GAGGCTGCATGTGACTGGCAGGG + Intronic
1138536611 16:57663666-57663688 AAGTCTGCGGCTGACTGGCCTGG - Exonic
1138606871 16:58095277-58095299 AAGGCTCCCCGAGTCTGGCCAGG + Intergenic
1141624170 16:85252785-85252807 GAGGCTGCCGGTGACAGGACGGG + Intergenic
1141644875 16:85361953-85361975 AAGGCTCCTGGTGGCTGGCCAGG + Intergenic
1141707319 16:85674111-85674133 AGGGCTGCCAGTCACTGGTCTGG + Exonic
1143838891 17:9714924-9714946 AAGGCCACCGGTGACTTGCCAGG + Intronic
1146398424 17:32486499-32486521 AAGGCAGCACGTGTCTGGGCGGG + Intergenic
1150000348 17:61432617-61432639 AAGGATGCCAGTGATAGGCCGGG - Intergenic
1151651965 17:75475710-75475732 GAGGCTGCCCGGGAATGCCCAGG - Intronic
1152582107 17:81170755-81170777 AAGGATGCCCCTGCCTGGCTGGG + Intergenic
1155367881 18:25066783-25066805 AAGGCTGCTTGTGGATGGCCTGG - Intronic
1156478562 18:37421779-37421801 CAGGCTGCGCGTGACTGTCCTGG - Intronic
1161352406 19:3801353-3801375 AAGGCTGACTGTGACTGGGCCGG + Intronic
1161459137 19:4386132-4386154 AAGGCTGGCCTTGAAGGGCCAGG + Intronic
1161576798 19:5058872-5058894 CAGGATGCCGGTGACTCGCCTGG - Intronic
1161783569 19:6309667-6309689 AAGGCTGCAGGTGCCTGGGCAGG - Intronic
1162013708 19:7832307-7832329 CAGGCTGCGCGGGACTGGACCGG - Intronic
1162267177 19:9584996-9585018 AAAGCTGCCAGTGAATGGCATGG + Intergenic
1164157667 19:22606316-22606338 GAGGCTCCCCGTGGCTGGGCAGG + Intergenic
1165732086 19:38152453-38152475 AAGGCAGCCCGAGAGAGGCCTGG + Intronic
1166198355 19:41220690-41220712 AAGGGTGCCCGTGAGTCCCCGGG - Exonic
1168268773 19:55238414-55238436 ATGGCTGCCCATGGCTGCCCCGG - Intronic
925257476 2:2502587-2502609 CAGGCTGCCACTGACTTGCCTGG + Intergenic
925997319 2:9304039-9304061 CAGGCTGCCAGTGGCTGTCCCGG - Intronic
932102846 2:68916402-68916424 TGGGCTCCCCGTGGCTGGCCTGG - Intergenic
932302446 2:70676765-70676787 GAGGCTGCCCCTGACTGGCGGGG - Intronic
933420841 2:82043380-82043402 AGGTCTGCCCGTGGCTGCCCAGG + Intergenic
933870787 2:86563396-86563418 GCGGCTGCCCGTGACCTGCCTGG - Intronic
946170774 2:217894076-217894098 AAGGCTGCTCTTGGCTGGCCTGG - Intronic
948768677 2:240236337-240236359 CAGGCTGGCCCTCACTGGCCTGG + Intergenic
948929014 2:241118941-241118963 TAAGCTGCCCGTGGCTGGCAAGG + Intronic
1171229795 20:23475239-23475261 AAGCCTGCCCATGACGGGGCTGG - Intergenic
1171429180 20:25069784-25069806 AAGGCAGCCCGTGACCAGTCGGG - Intergenic
1172867414 20:38110979-38111001 AAGGCTGCAGGTGGCAGGCCAGG - Intronic
1173339341 20:42139610-42139632 CAGGCTGCCTGTGCCTGGGCAGG + Intronic
1173650322 20:44659651-44659673 AAGGCTCCCCGTGAGCAGCCAGG + Intergenic
1174212984 20:48894729-48894751 AAGACTACACGTGACTGGCCTGG + Intergenic
1174756899 20:53168004-53168026 CAGGTTGCCCATGACTGGCAAGG - Intronic
1175465894 20:59191243-59191265 TAGGCTGCCCGTCACTAGCGGGG - Exonic
1180500529 22:15925030-15925052 AAGTCAGCCCTTGCCTGGCCTGG + Intergenic
1180671594 22:17557835-17557857 AAGGCTGCTGGGGACTGACCGGG - Intronic
1182024453 22:27107048-27107070 AAGGCTTCCCTTGACAGGCAAGG + Intergenic
1182833239 22:33320853-33320875 GAGGCTGCCAGTGACTCACCGGG - Intronic
1184773241 22:46610118-46610140 CAGGCTGCCCCAGCCTGGCCAGG + Intronic
950120979 3:10482488-10482510 AAGGCAGCCCTTTCCTGGCCAGG + Intronic
959501719 3:107114355-107114377 AAGCCTGCCAGTTACTTGCCTGG + Intergenic
963291592 3:143495665-143495687 AAGGCTGCCAGAGACACGCCTGG + Intronic
968433394 4:572709-572731 AAGGCTGCCTGGCACTGCCCTGG - Intergenic
968552078 4:1228939-1228961 AATGCTGCCCCTGGCTGGCGAGG + Intronic
968966683 4:3772423-3772445 GAGGCTGCCCATGCCTGCCCAGG - Intergenic
982160029 4:152559145-152559167 ATGGGTGCCTGTGACTTGCCAGG - Intergenic
984444528 4:179818345-179818367 AAGGCAGTCCCTGACTGGCAAGG + Intergenic
997863610 5:137442045-137442067 AAGTCTGTCAGTGACAGGCCTGG + Intronic
998051008 5:139035481-139035503 AAGGCAGCCGGTGACTGGAGGGG - Intronic
998129280 5:139643213-139643235 CAGGCAACCCGTGACTGCCCAGG + Intergenic
999243929 5:150143498-150143520 AAGGCTGCCAGTTCCAGGCCTGG + Intronic
1000449857 5:161372281-161372303 AAGGATGCCCCTGCATGGCCAGG + Intronic
1002661399 5:180793011-180793033 AAGGCTGCCCTGGGCTTGCCCGG + Exonic
1006793498 6:36718180-36718202 AATGGGGCCAGTGACTGGCCAGG + Intronic
1013012396 6:106132466-106132488 AAGGCTCCATGTGACTGCCCTGG - Intergenic
1018386204 6:163305457-163305479 CAGGCTGAGCGTGACTGCCCAGG - Intronic
1019396572 7:823143-823165 AACGCTGCACGTGACTGGAAGGG - Intronic
1023702876 7:42910429-42910451 CTGGCTGCTGGTGACTGGCCTGG + Exonic
1026538195 7:71257891-71257913 AAGGCTGCCTGTCAATGCCCAGG - Intronic
1026839037 7:73658597-73658619 AAAGCAGCCAGTCACTGGCCGGG + Intergenic
1029477759 7:100795075-100795097 GCGGCTGCCAGAGACTGGCCAGG - Intronic
1034254632 7:149717802-149717824 AAGGCTGCCGGTTAGTGGCAGGG + Intronic
1034690329 7:153008550-153008572 GAGGCTGCCCGGGACAGCCCCGG - Intergenic
1035338545 7:158145602-158145624 AAGCCTGGCCGCGTCTGGCCAGG - Intronic
1035663426 8:1363822-1363844 CCGGCTGCCCGTGGCAGGCCTGG + Intergenic
1037745948 8:21644278-21644300 AAGGCTGCCCATGCCTGATCTGG - Intergenic
1045935386 8:107672613-107672635 AAGGCTGCCCCTGACTAGGCTGG + Intergenic
1048001048 8:130379949-130379971 GAGGCTGCAGGAGACTGGCCAGG + Intronic
1049615120 8:143572609-143572631 GGGGCTGCCCCTGCCTGGCCCGG + Exonic
1050259821 9:3829232-3829254 TGGGCTGCCCGTGACCGACCTGG - Intronic
1052355893 9:27504493-27504515 AAGACTGTCAGTGACTGGCCTGG + Intronic
1057845232 9:98517742-98517764 AGGGCAGCACGTGAGTGGCCTGG + Intronic
1061135225 9:128729874-128729896 AAGTCTGCCAGGGTCTGGCCGGG + Exonic
1061324749 9:129856829-129856851 ACGGATGCCTGTGACTGGCCAGG + Intronic
1061883523 9:133579493-133579515 AAGGCTACCCCTGACTGGGGAGG + Intronic
1062034545 9:134377097-134377119 AAGGCTGAGCAAGACTGGCCAGG - Intronic
1062134255 9:134916391-134916413 GAGGCTGCCCGGGGCTGCCCGGG - Exonic
1062552896 9:137098240-137098262 AGAGCTGCCTGGGACTGGCCAGG - Intronic
1187190265 X:17027964-17027986 AAGCCTGCCTGTGACTGGAAAGG - Intronic
1187936542 X:24341748-24341770 AAGGCTGGCCATGGCTAGCCAGG - Intergenic
1191022192 X:55874030-55874052 AAGGCAGCCCCTTACTGGCAAGG + Intergenic
1194240104 X:91435073-91435095 TAGCCAGCCCGAGACTGGCCAGG + Intronic
1200916356 Y:8574648-8574670 AAGGCTGGCTGTGACCAGCCGGG + Intergenic