ID: 1082086851

View in Genome Browser
Species Human (GRCh38)
Location 11:48057512-48057534
Sequence TACCCAAGGCTGCCCGTGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 81}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086851_1082086855 -1 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086855 11:48057534-48057556 ACCCAGAGGCCTTCTCACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1082086851_1082086862 15 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086851_1082086866 30 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086851_1082086861 12 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265
1082086851_1082086854 -2 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086854 11:48057533-48057555 TACCCAGAGGCCTTCTCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1082086851_1082086863 18 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086851_1082086858 5 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1082086851_1082086865 24 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086851_1082086864 21 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086851_1082086860 9 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086851 Original CRISPR TACCCAAGGCTGCCCGTGAC TGG (reversed) Intronic
900647847 1:3717159-3717181 TGCCCAAACCTGCCCGTGCCGGG + Intronic
901490360 1:9593481-9593503 TACCCAGGGCTGAGAGTGACAGG + Intronic
902980381 1:20118466-20118488 TACCCTTGGCTGCCACTGACAGG + Intronic
903058427 1:20652991-20653013 TAGCCAGGGCTGGCCATGACTGG + Intronic
904209493 1:28877321-28877343 TAGGCAAGGCTGCCCGAGACCGG + Intergenic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
918043748 1:180928559-180928581 TACCCAGGGCAGCCGGTGAGTGG + Exonic
919351824 1:196466890-196466912 TACCCAAGGCTGACCCTGCTTGG - Intronic
922930040 1:229381881-229381903 TGCCCAAGGGTGCCAGTGCCAGG + Intergenic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
1066049464 10:31620580-31620602 CACCCAAGGCTGGGGGTGACAGG - Intergenic
1067222487 10:44353934-44353956 TCCCCATGGCTGCCCATGGCAGG + Intergenic
1070506952 10:77122099-77122121 TGCCCTAGGCTGCCCTTTACTGG - Intronic
1073523282 10:104155195-104155217 CACCCAGGGCAGCCAGTGACCGG - Intronic
1075900891 10:126042055-126042077 TCCCCAAGGCCTCCTGTGACTGG - Intronic
1076320764 10:129579935-129579957 CACCCAGGCCTGCCCGTGAGAGG + Intronic
1076491548 10:130865109-130865131 TTCCCAGGGCTGCCCAAGACAGG + Intergenic
1077410869 11:2403345-2403367 TTCCCAAGGCCGCCCCTGCCTGG - Exonic
1077472425 11:2770273-2770295 TGCCCAGGGCTGCCTGTGCCAGG - Intronic
1078108344 11:8372672-8372694 TTCCCAAGGCTGACTGGGACAGG + Intergenic
1081871149 11:46383055-46383077 GACCAAATGCTGCCCGTGGCTGG - Intronic
1082086851 11:48057512-48057534 TACCCAAGGCTGCCCGTGACTGG - Intronic
1083815085 11:65128184-65128206 TCCCCATGGCTGCCTGGGACTGG + Exonic
1091550771 12:1533444-1533466 CAGCCAAGGCTGCCCGTAAGTGG - Intronic
1098536086 12:71595067-71595089 CATCCAATGCTGCCTGTGACTGG - Intergenic
1101638207 12:106565108-106565130 TACCTATGGCTCCCAGTGACTGG - Intronic
1103870902 12:124090904-124090926 CACCTAAGGCTGCCCTTGTCAGG + Intronic
1104668674 12:130666042-130666064 GACCCAAGGCTGGCAGTGAGTGG + Intronic
1112493246 13:99885430-99885452 GACCCAAGCCTGCCCATGATGGG - Intronic
1118617596 14:67585382-67585404 TAGACAAGGCTGCTTGTGACAGG - Intronic
1121539104 14:94711726-94711748 TCTCCAAGGCTGCCTGGGACAGG + Intergenic
1123505761 15:20940777-20940799 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123562995 15:21514483-21514505 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1123599242 15:21951766-21951788 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1126096792 15:45095814-45095836 TACCCAAAGGTGCCCGTCACTGG - Exonic
1202971347 15_KI270727v1_random:241618-241640 TATCCAGGGCTGCCCGCGGCGGG + Intergenic
1136283641 16:29229065-29229087 TACCCATGGCTAGCAGTGACAGG + Intergenic
1139606633 16:68023383-68023405 TCCCCAAGGCTGGCCGGGTCTGG - Exonic
1142088673 16:88198576-88198598 TACCCATGGCTAGCAGTGACAGG + Intergenic
1142238655 16:88935186-88935208 AACCCAGGACTGCCCCTGACCGG - Intronic
1142396863 16:89837063-89837085 TTTCCAAAGCTGCCCGTGCCTGG + Intronic
1144794673 17:17882948-17882970 TCCCCAAGGCTGCCCACGAAAGG + Intronic
1146497558 17:33336658-33336680 TGCTCAAGGCTGCCTGTGTCTGG + Intronic
1147763931 17:42820182-42820204 TACCCACAGCTGCCAGTCACTGG - Intronic
1147791841 17:43018584-43018606 TACACATGGCTGCAGGTGACAGG - Exonic
1149740699 17:59043197-59043219 TACCCAAGACTGTCATTGACTGG - Intronic
1151277302 17:73045116-73045138 TACCCAAGGCTACCCCAGAGAGG - Intronic
1156646428 18:39167206-39167228 TACCCAAGACTACCTGAGACAGG - Intergenic
1162808243 19:13150078-13150100 TACCCAAGCCAGCCAGTGCCCGG - Intronic
1165243077 19:34482363-34482385 CACCGAAGGCGGCCCGGGACCGG - Exonic
1167134955 19:47610271-47610293 TCCCCGCGGCCGCCCGTGACAGG - Intronic
925358103 2:3256843-3256865 TGCCCAAGCCCGCCCGTGTCCGG - Intronic
926724421 2:15986460-15986482 TTCCCAGGGCTGGCCCTGACAGG - Intergenic
931851362 2:66254327-66254349 TAGCAGAGGCTGCCCTTGACTGG + Intergenic
932515119 2:72338788-72338810 TACCCAAGGCTGCTACAGACAGG + Intronic
947820406 2:233065024-233065046 TATCCAAGGCTGACTGTGCCGGG + Intronic
948991796 2:241559244-241559266 TCCCCGAGGCTGCCAGGGACCGG - Intronic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1169880526 20:10341796-10341818 TACCCAAGTCTGGCTGTGTCTGG - Intergenic
1174037904 20:47679308-47679330 TGACCAAGGAGGCCCGTGACAGG + Intronic
1180183762 21:46129540-46129562 TTCCCAGGGCTGCCCCCGACAGG + Intronic
1181102537 22:20551050-20551072 CACCCACGGCTGCCTCTGACAGG + Intronic
1182024450 22:27107043-27107065 TTCCCAAGGCTTCCCTTGACAGG + Intergenic
1182559365 22:31147726-31147748 TGCCCAAGGCTGCCCAGGAGGGG - Intergenic
950953821 3:17029620-17029642 TACCCAAGGCTTCCCTTTTCTGG - Intronic
957724113 3:84042491-84042513 TAGCCAAGGCTGTCTGTGACTGG + Intergenic
962892065 3:139680565-139680587 CACCCAAGGCTGCAGGAGACAGG + Intergenic
982096791 4:151930653-151930675 TCCCCAGTGCTGCCTGTGACAGG + Intergenic
983317462 4:166149964-166149986 TATAAAAGGCTGCCCGAGACTGG - Intergenic
986080628 5:4388866-4388888 TAGCCAAGGCTGCCCTGAACAGG - Intergenic
998051012 5:139035486-139035508 TTGCCAAGGCAGCCGGTGACTGG - Intronic
1001685678 5:173593179-173593201 TACCCAAGGCTCACAGTGAGTGG - Intergenic
1005807552 6:29488603-29488625 TACCCAAGGATGCCCAGGACTGG - Intergenic
1006105763 6:31715391-31715413 TACCCAAGGCAGCCCCTAGCAGG - Exonic
1006515558 6:34543892-34543914 TCCCCAAAGCTGCCCGAGGCTGG + Intronic
1016212951 6:141562394-141562416 TACCCAATGCTGCCTGTTAGAGG - Intergenic
1017603129 6:156105033-156105055 CACCCAATGCTGCCCTTGACAGG + Intergenic
1020070781 7:5225719-5225741 GGCCCAAGTGTGCCCGTGACAGG + Intronic
1020601775 7:10283966-10283988 AACCCAAAGCAGCCTGTGACAGG - Intergenic
1021408599 7:20303014-20303036 TACACAAGCCTGCCTGTTACTGG + Intergenic
1022505574 7:30907122-30907144 TACCCCAGGCTGGCCGTGCCTGG - Intergenic
1025190997 7:56895771-56895793 TACCCAAGGATGCTCGTGGCAGG - Intergenic
1025680948 7:63681158-63681180 TACCCAAGGATGCTCGTGGCAGG + Intergenic
1037912132 8:22749745-22749767 TCCACACTGCTGCCCGTGACTGG - Intronic
1041496512 8:58491528-58491550 TGCCCAAGCCTGCCCGGGACTGG + Exonic
1049491989 8:142910014-142910036 TACCCAGGGCTGCGAGTCACAGG - Intronic
1059392336 9:114007130-114007152 TCCCCAAGGCTGCTCATCACCGG + Intronic
1060522677 9:124302642-124302664 TACCCCATGCTGCCCGGGCCTGG + Intronic
1062122657 9:134842019-134842041 TACCCAGGGCTGCGCTTGCCCGG - Intronic
1187190267 X:17027969-17027991 TGGCCAAGCCTGCCTGTGACTGG - Intronic
1193840719 X:86405044-86405066 TTCCCAAGGCTGCACATGGCAGG + Intronic
1196193610 X:112818496-112818518 AAACCAAGGCAGCCCGTCACTGG + Intronic