ID: 1082086853

View in Genome Browser
Species Human (GRCh38)
Location 11:48057526-48057548
Sequence AGAAGGCCTCTGGGTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 211}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086853_1082086862 1 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086853_1082086858 -9 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1082086853_1082086860 -5 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1082086853_1082086866 16 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086853_1082086865 10 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086853_1082086864 7 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086853_1082086861 -2 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265
1082086853_1082086863 4 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086853 Original CRISPR AGAAGGCCTCTGGGTACCCA AGG (reversed) Intronic
900299443 1:1969519-1969541 AGAAGCCCTCCGGGCAGCCAAGG - Intronic
900312034 1:2038229-2038251 AGAAGACCTCTGTGCAGCCATGG - Intergenic
901055813 1:6448237-6448259 AGAAGGACTGCGGGTCCCCAGGG - Intronic
902125698 1:14209145-14209167 AGGAGGGATCTGGGTAACCACGG - Intergenic
902478581 1:16700401-16700423 AGAAGGACTGCGGGTCCCCAGGG + Intergenic
902970790 1:20047042-20047064 ACAAGGCCCCTGGTTACTCAGGG - Intronic
905311516 1:37052182-37052204 AGAAGGTCTCTGGGTGTCAAGGG - Intergenic
907527463 1:55062377-55062399 AGCAGCCCTCAGTGTACCCAGGG - Intronic
916166842 1:161972602-161972624 GACAGGCCCCTGGGTACCCAGGG - Intergenic
916185136 1:162124323-162124345 TGAATGCCTTTGCGTACCCAGGG + Intronic
918083293 1:181223809-181223831 AGAAGGCCTCTGGGATTCCTGGG + Intergenic
919854311 1:201695212-201695234 AGCATGGCTCTGGGTACACAGGG - Intronic
920101174 1:203517901-203517923 GGAAATCCTCTGGGTACCCCAGG + Intergenic
920367292 1:205455001-205455023 AGAGGGCGTCTGGGGGCCCAAGG - Intronic
1062814352 10:488707-488729 ATGACGCCTCTGGGTACCCACGG + Intronic
1064992616 10:21269187-21269209 AGAAGGCCCCTGGGTACCAGAGG - Intergenic
1065964839 10:30762717-30762739 AGAAGGAGACTGGGTATCCATGG + Intergenic
1068530568 10:58181163-58181185 AGAAGGCCACTGGGCAACCCTGG + Intergenic
1070905768 10:80071859-80071881 ACAAGGCCCCTGGTCACCCAGGG + Intergenic
1075693630 10:124418403-124418425 AGGAGGCCTTTGGGCACCCTTGG - Intronic
1075779960 10:125011100-125011122 CCAAGGCCTCTGAGCACCCAGGG + Intronic
1075810699 10:125222661-125222683 AGGTGGCCTCTGGGGAGCCAGGG + Intergenic
1076929969 10:133525670-133525692 AGCAGGCCTCTGGCTCCCCTGGG - Intronic
1080577020 11:33609343-33609365 CGAAGGCCACTGGGTTCCCCAGG + Intronic
1081489952 11:43559514-43559536 AGTATGCATGTGGGTACCCAGGG + Intronic
1082086853 11:48057526-48057548 AGAAGGCCTCTGGGTACCCAAGG - Intronic
1083725462 11:64625699-64625721 AGAAGGCTTCTTGTTACCAAGGG - Intronic
1083761685 11:64822072-64822094 AGCAGGGCACTGGATACCCATGG + Intergenic
1083975690 11:66118030-66118052 AAAAGGCTTCAGGGTACCCTGGG - Intronic
1088725926 11:112634637-112634659 AAGAGGCCTCTGGGTTTCCAGGG - Intergenic
1088817441 11:113431374-113431396 AGGAGGCCTCAGAGGACCCATGG - Intronic
1089289095 11:117427052-117427074 ACCAGGCCTCTGGACACCCACGG + Intergenic
1089656185 11:119948578-119948600 AGCAGGCCACTGGGTAAACAGGG + Intergenic
1090733884 11:129594541-129594563 AGAAGCCATCTGGGGAGCCAGGG + Intergenic
1090998870 11:131891577-131891599 AGCAGGCCTCTGGTTCCCCGAGG + Intronic
1094502835 12:31036109-31036131 AGAAGGCCTCCTGGCAGCCACGG + Intergenic
1100356550 12:93836417-93836439 AGAAGGCTTCTGGGTAAATATGG - Intronic
1100522729 12:95390911-95390933 ACAAGGCCCCTGGTCACCCAGGG - Intergenic
1104108892 12:125687942-125687964 AGAAGGCCTCAGCCCACCCACGG + Intergenic
1107022487 13:35765966-35765988 AGAAAGCCTCTGATTGCCCATGG + Intergenic
1107529734 13:41271725-41271747 ACAAGGCCCCTGGTCACCCAGGG + Intergenic
1113519735 13:110931535-110931557 AGATTGCCTCTGGGTGGCCATGG - Intergenic
1114720247 14:24873934-24873956 AGAAGGCATCTGTCTATCCAAGG - Intronic
1116835448 14:49765944-49765966 AAAAGGTCTCCAGGTACCCACGG + Intergenic
1117327110 14:54679506-54679528 TGCAGGCCTCAGGGTAGCCATGG - Intronic
1117911585 14:60642480-60642502 AGTTGGCTTCGGGGTACCCAAGG + Intergenic
1119203925 14:72779883-72779905 AGAAGGCCTCTGGGTCACCAAGG + Intronic
1119937244 14:78603173-78603195 AGAAGACCTTTGGGAACCCTGGG - Intronic
1120417486 14:84238362-84238384 AGAAGACATCTGTGTATCCAGGG + Intergenic
1121036170 14:90705456-90705478 ACCCGGCCTCTGGGTTCCCAGGG + Intronic
1202932873 14_KI270725v1_random:54957-54979 AAGAGGCCTCTGGATACACAGGG - Intergenic
1125266170 15:37883790-37883812 ACAAGGCCACTGGGTATGCAAGG + Intergenic
1125715091 15:41815196-41815218 AGCAGTCCTCTGCCTACCCAAGG - Intronic
1129472116 15:75761749-75761771 AGAGGGCCTCTTGGTAGACACGG + Intergenic
1131057295 15:89383260-89383282 AGGAGGCCTCTGGCCACACAGGG + Intergenic
1131283490 15:91039577-91039599 AGAAGGCCCCCGGTTCCCCAGGG + Intergenic
1132083014 15:98883709-98883731 AGAGGGACTCAGGGAACCCACGG - Intronic
1133750741 16:8723360-8723382 AGAAGGGAGCTGGGTGCCCAGGG - Intronic
1134007465 16:10827854-10827876 AGAAGGCCTCTTGTCACTCAAGG + Intergenic
1134828733 16:17306075-17306097 AGAGAGCCTCTGGGTGCCAAAGG + Intronic
1135328626 16:21543535-21543557 AGAAGCCAGCTGGGTCCCCAGGG + Intergenic
1136338976 16:29629508-29629530 AGAAGCCAGCTGGGTCCCCAGGG + Intergenic
1137355068 16:47754275-47754297 AGAAGGGCTCTGGCTTCCCCAGG - Intergenic
1138100895 16:54251726-54251748 AGCAGGCCTATGGGTGCCCACGG - Intronic
1141523651 16:84597921-84597943 GAAAGGCCTCCTGGTACCCAGGG - Intronic
1142041648 16:87898074-87898096 AGAAGCCAGCTGGGTCCCCAGGG + Intronic
1142190566 16:88715425-88715447 AGAAGGACACTGCGTCCCCACGG - Exonic
1143371553 17:6443936-6443958 AAAACGTCTCTGGGAACCCAGGG + Intergenic
1145102075 17:20085853-20085875 ACCACGACTCTGGGTACCCACGG + Intronic
1145398732 17:22514879-22514901 AGAAGCCATCTGGACACCCAAGG + Intergenic
1146172568 17:30645121-30645143 AGAATGCCTTGGGGTACCCAGGG - Intergenic
1146346022 17:32061130-32061152 AGAATGCCTTGGGGTACCCAGGG - Intergenic
1146953957 17:36925305-36925327 TGAAGGCCTCAGGGTTCACAGGG + Intergenic
1148556545 17:48582038-48582060 AGAAGGCGGCTGGGAAGCCACGG - Intronic
1148763668 17:50023057-50023079 GAAAGGCCTCAGGGAACCCAGGG - Intergenic
1149856630 17:60088448-60088470 AGAAGGACCCAGGGTACACAGGG - Intergenic
1151805335 17:76401321-76401343 AGATGACCTCTGCGGACCCAGGG - Intronic
1153413974 18:4825036-4825058 AGAAGGGATATGGGTACTCATGG + Intergenic
1156539778 18:37898278-37898300 GGAAGGCCTCTGTGTGCCCCAGG + Intergenic
1156679612 18:39572353-39572375 AGATGGCTTATGGGTACACAGGG + Intergenic
1157093331 18:44661965-44661987 AAAAGGCCTCTGGAGACCCCTGG - Intergenic
1157289781 18:46401144-46401166 AGTAGGCCCCTGGGGACCCAGGG - Intronic
1157800347 18:50615379-50615401 AGAAGGAGCCTGGGTCCCCAAGG - Intronic
1160881569 19:1323234-1323256 GGCAGGACTCTGGGTCCCCAGGG + Intergenic
1161410295 19:4113226-4113248 AGAAGGCCTCTCGCTTCCGACGG - Intronic
1161470791 19:4455981-4456003 AGAAGGCCTCTGCTGTCCCAGGG - Intronic
1161961785 19:7527440-7527462 AGAAGGCCACTGGGGACTCTGGG + Intronic
1162989867 19:14294959-14294981 AGAATGCCCTGGGGTACCCAGGG + Intergenic
1163029108 19:14532127-14532149 AGTAGGCCTCTGAGCACCCTGGG + Intronic
1163516977 19:17770692-17770714 TGAACTCCTCGGGGTACCCAGGG - Intronic
1163767995 19:19174002-19174024 ACAAGGCTTCTGGGTGCCCCAGG - Intronic
1164704778 19:30312260-30312282 AGAAGGTCTGTGGGCACCCCAGG + Intronic
1165312490 19:35037259-35037281 AGAAGGCAGATGGGGACCCATGG + Intronic
1165706815 19:37982295-37982317 GGAAGGCCTCTGGGAGCCAATGG - Intronic
1166212682 19:41317226-41317248 AGAAGGCTTCTGTGTCCCCAAGG - Intronic
1166698235 19:44866522-44866544 AGGAGCCCTCTGGGTATCTAAGG + Intronic
1167798830 19:51727324-51727346 GGAAGGCCACTGTGGACCCAGGG - Intergenic
1202712600 1_KI270714v1_random:26232-26254 AGAAGGACTGCGGGTCCCCAGGG + Intergenic
927660050 2:24985390-24985412 AAAAGGCCTTTGAGTAGCCATGG + Intergenic
929868965 2:45741859-45741881 AGAAGGCCATGGGTTACCCAGGG + Intronic
929965116 2:46528917-46528939 TGAGGGGCTCTGGGAACCCATGG - Intronic
940566478 2:155368431-155368453 AGAAGGCCTCTGGACAGTCAGGG + Intergenic
943480368 2:188410359-188410381 AAAAGGCTTCTGGATAGCCAAGG + Intronic
946147041 2:217738864-217738886 AGAAGGCCTCTTGCTGCCCAGGG - Intronic
946955492 2:224925401-224925423 AGAATGCCTTTGAGTACCCTGGG + Intronic
948834693 2:240620380-240620402 AGACGGCCCCTGAGTGCCCAGGG + Intronic
948834696 2:240620387-240620409 AGGAGGCCCCTGGGCACTCAGGG - Intronic
1168741350 20:193931-193953 AGAAGGACTGAGGGTGCCCAGGG - Intergenic
1170234559 20:14087671-14087693 AGAAAGCATCTTGATACCCAGGG - Intronic
1174448289 20:50604803-50604825 AAATGGCCTCTGGGTGCCGATGG - Intronic
1174485040 20:50855666-50855688 AGAAGGGCAATGGGTGCCCACGG - Intronic
1175107439 20:56625493-56625515 AGAAGGCCTCAGGGGACACGAGG + Intergenic
1175194610 20:57234228-57234250 AGAAGGCCTATGTGTGGCCAAGG - Intronic
1175242082 20:57557105-57557127 ACAAGTCCTCTGGGTCCCCCAGG - Intergenic
1175828994 20:61951842-61951864 AGAAGGCCTCTGGGGCTCCCTGG - Intergenic
1175945764 20:62558017-62558039 CGGAGGCCCCTGGGTGCCCAGGG + Intronic
1176594260 21:8677029-8677051 AGGAGGCCTCTGGATACACAGGG - Intergenic
1180277113 22:10654163-10654185 AGGAGGCCTCTGGATACACAGGG - Intergenic
1181954801 22:26580396-26580418 TCAAGGCCCCTGGGTATCCAGGG + Intronic
1182351268 22:29701250-29701272 GTGAGGCCTCTGGGTACCCGGGG + Intergenic
1182361997 22:29752160-29752182 AGCAGGCCTCAGGGTACCTGGGG + Intronic
1182511017 22:30820473-30820495 ATGAGGCCTCTGGGAGCCCAGGG + Intronic
1182832153 22:33313069-33313091 AGAGGGCCTCAGGGAAACCAGGG - Intronic
1184333174 22:43838635-43838657 AGAAGGGCTCTGGGTTCAGATGG + Intronic
1185323852 22:50216119-50216141 AGAAAGCCTCTGGGTTTCTAGGG + Intronic
949193051 3:1272673-1272695 AGGAAGGCTATGGGTACCCAGGG - Intronic
950154166 3:10709271-10709293 TGATGTCCTCTGGGTGCCCAGGG - Intergenic
952820460 3:37481744-37481766 AGATGGTCTCTTGGTCCCCAAGG + Intronic
953158842 3:40399600-40399622 TGAAGGCCTCTGGATGCCCTAGG + Intronic
953684750 3:45067973-45067995 ATAAGACCTCTCGGAACCCAAGG + Intergenic
954115750 3:48466089-48466111 GGAAGGCCTCTGGGGTCCCCCGG + Exonic
954582784 3:51712102-51712124 AGATGGCATCTGGCTACTCAGGG - Intronic
955227579 3:57073785-57073807 CCAAGGCCTCTGGGTGGCCATGG - Exonic
955399436 3:58581117-58581139 GGAAGGACTCTGGGAAGCCAGGG + Intronic
956627713 3:71283074-71283096 GGAAGGCAGATGGGTACCCATGG - Intronic
957066265 3:75524955-75524977 AGAAGCCACCTGGGGACCCAAGG + Intergenic
959631318 3:108510274-108510296 TGAGGGCCTCTGAGTATCCAGGG - Intronic
961107865 3:124257663-124257685 AGGGGGCCTCAGGGGACCCATGG + Intronic
962325622 3:134429646-134429668 AGAGGCCCTCTGGGTGACCAGGG - Intergenic
965449888 3:168824801-168824823 AGATGGCCTCTGGGGACCAGAGG + Intergenic
965672095 3:171157709-171157731 CCAAGGCCTCTTGGTAGCCATGG - Intronic
965819627 3:172672391-172672413 AGAAGGCCTATGGAAAACCAGGG + Intronic
966646229 3:182248679-182248701 AGAAGGCCTCAGGAAACCCTGGG + Intergenic
967324746 3:188228015-188228037 AGAAGGCCTGTGGTTGCCCACGG - Intronic
969618093 4:8265393-8265415 AGGAGGCCTCTGGTGACCCTCGG - Intergenic
970419326 4:15890592-15890614 GGTAGTCCTCTGGGTACACATGG - Intergenic
972397882 4:38672898-38672920 AGATGGCCTCTAGGTTTCCATGG + Intronic
974610363 4:64208596-64208618 GGAGGGCCTCAGGGTATCCACGG + Intergenic
978286243 4:107080668-107080690 AAAAGGCCTCCAGGTACGCAGGG + Intronic
980676209 4:136085203-136085225 ATAAGCCCTCTGGGAACACAGGG + Intergenic
980985892 4:139693768-139693790 AAAAGGCCACTGGTGACCCAAGG - Intronic
982071008 4:151694274-151694296 AGAATCCCTGTGGGTCCCCAAGG + Intronic
983204781 4:164901177-164901199 GGAAGGCAGATGGGTACCCAAGG - Intergenic
985281001 4:188285294-188285316 AAAAGACACCTGGGTACCCAAGG + Intergenic
985528683 5:421197-421219 AGGAGGCCGCTGGGTCCGCAAGG - Intronic
987041368 5:14066202-14066224 AGATGCCCACTGGCTACCCAGGG + Intergenic
987268425 5:16279886-16279908 ACAAGCCCTCTGGGTCTCCAGGG - Intergenic
988679311 5:33469225-33469247 AGAAGGCCCCTGGCAAACCACGG - Intronic
989748396 5:44860379-44860401 AGGAAGCCTCTTGGTACCCTTGG - Intergenic
997743496 5:136278445-136278467 AAGAGGCCTGTGGGTACCAAAGG + Intronic
999631053 5:153571867-153571889 TGAAGGCCTCTGGGGACCTGAGG - Intronic
1000193394 5:158935388-158935410 AGCAAGCCTCTGGGGAGCCATGG + Intronic
1001313104 5:170625121-170625143 AGCAGCCCTCTGGGTACTGAGGG + Intronic
1001588133 5:172847121-172847143 TCAAGGCCTCTGAGTACCCAGGG - Intronic
1003505560 6:6737391-6737413 AGATGGCCGCTGGGTCCTCAGGG + Intergenic
1006360915 6:33586585-33586607 AGCAGCCCACTGGGAACCCAAGG - Intergenic
1006378242 6:33683604-33683626 AGCAGGCCTCTGGGTTCTCCAGG - Intronic
1006385972 6:33731154-33731176 AGGAGGCCTCGGGGTTCCCCAGG - Intronic
1008311649 6:49983067-49983089 AGAAGACCTCTGGTGACCCCAGG + Intergenic
1009632540 6:66216924-66216946 ACATGGCCTCTGGGAATCCAGGG - Intergenic
1010358528 6:74965286-74965308 TGAAGACCTCTGGCTAGCCAGGG + Intergenic
1015060426 6:128958383-128958405 AACAGGCTCCTGGGTACCCATGG + Intronic
1017489253 6:154930293-154930315 AGACGTCCTCTGGGTAACAAAGG - Intronic
1018622670 6:165746660-165746682 AGAGGGCCTCAGAGTAGCCATGG + Intronic
1019365478 7:630453-630475 CTGAGGCCTGTGGGTACCCAGGG + Intronic
1020056741 7:5122811-5122833 TGAAGGCCTCTGTGTAACCTAGG - Intergenic
1020171161 7:5846151-5846173 TGAAGGCCTCTGTGTAACCTAGG + Intergenic
1022602359 7:31773338-31773360 GGATGGCCACTGGGTTCCCAAGG - Intronic
1022785712 7:33635022-33635044 GGAAGGACACTGGGTACCGATGG - Intergenic
1023409069 7:39870098-39870120 TGAAGGCCGGTGGTTACCCAGGG + Intergenic
1023968120 7:44973906-44973928 AGACGCCCTCTGTGTTCCCAGGG + Intronic
1024020627 7:45364571-45364593 AGAAGGACTCAGGGGACCAAAGG - Intergenic
1025989036 7:66481176-66481198 AGAAGGCCTCTCTCTACTCATGG - Intergenic
1031786320 7:126038632-126038654 AAAAAGCCTCTAGGTACACATGG - Intergenic
1031991602 7:128202453-128202475 GGAAGGGCTCCGGGCACCCAAGG + Intergenic
1035270907 7:157719329-157719351 AGAAGGCCTCAGGGTCCCTTGGG - Intronic
1037565422 8:20113827-20113849 AGAGGGCCTCTGGGGTCCCTTGG + Intergenic
1038922358 8:32098882-32098904 AGAGGTCCTATGGCTACCCATGG - Intronic
1046713752 8:117544635-117544657 AGAAGGCCTCTGATTATCCTAGG - Intergenic
1047790958 8:128203134-128203156 GGAAGGCCACTGGGTATGCAGGG + Intergenic
1048379551 8:133853220-133853242 AGAAGGCCCCTGAGTACCATGGG + Intergenic
1049188266 8:141270819-141270841 AGACTTCCTCTGGGTCCCCACGG + Intronic
1049435398 8:142584023-142584045 GTAAGGCCTCGGGGTCCCCAGGG - Intergenic
1049720871 8:144114937-144114959 AGAAGGCAACAGGGTTCCCAAGG - Intronic
1049758770 8:144322483-144322505 AGACGCCCTCAGGGCACCCAAGG + Intronic
1050463175 9:5894375-5894397 AGAAGGCATCGGGGCAACCAAGG + Intronic
1052331829 9:27278316-27278338 AGAAGGCCTTTGGCTCTCCAGGG + Intergenic
1053269876 9:36742639-36742661 AGAAGGGTTCTGGGGCCCCAAGG - Intergenic
1053294054 9:36900676-36900698 AGAGGGACTCTGGGAAACCAGGG - Intronic
1053543557 9:38999296-38999318 ATAAGGCCCCTGGATACCCCTGG + Intergenic
1053807989 9:41822801-41822823 ATAAGGCCCCTGGATACCCCTGG + Intergenic
1054622603 9:67364627-67364649 ATAAGGCCCCTGGATACCCCTGG - Intergenic
1055677935 9:78684296-78684318 ACATGGCTTCTGGGGACCCAGGG + Intergenic
1056395223 9:86175640-86175662 AGAAGGCCTCAGAGTTCTCAAGG - Intergenic
1056734638 9:89198391-89198413 TGCATGCCTTTGGGTACCCATGG - Intergenic
1057178127 9:93014069-93014091 AGGAGGGCTCTGGCTGCCCAAGG + Intronic
1057585262 9:96323177-96323199 AGGAGACCTCTGGGCACCCAGGG + Intronic
1057905533 9:98980320-98980342 AGAAGTCCTCTCTGTACACACGG - Intronic
1058533373 9:105929480-105929502 AGAAGGTCTCTGGCAACTCAAGG + Intergenic
1059328934 9:113523053-113523075 AGAGGGGCTCTGGGCACCTACGG - Intronic
1061673644 9:132203122-132203144 AGCATGCCTCTGGGTTCACAGGG + Intronic
1062211310 9:135365786-135365808 AGAGGCCCTGTGGGTCCCCAGGG + Intergenic
1062459649 9:136657555-136657577 AGAAGCCTTCAGGGCACCCATGG + Intergenic
1062610148 9:137369894-137369916 AGAAGCTCTCTGGGCACCCGGGG + Intronic
1062707934 9:137955478-137955500 GGAGGCCCTCTGGGTGCCCAGGG + Intronic
1203624392 Un_KI270749v1:157290-157312 AAGAGGCCTCTGGATACACAGGG - Intergenic
1187656424 X:21480029-21480051 AGAAGGCTTCTAGGTTCCCATGG - Intronic
1189691750 X:43624037-43624059 AGGAGGCCCCTGGTCACCCAGGG + Intergenic
1189738947 X:44099177-44099199 AGAATGCCTCTGGGATCCCAAGG + Intergenic
1190909509 X:54758424-54758446 AGAAGGCCTTTGGTTGCCCAGGG - Exonic
1191248870 X:58249476-58249498 AGAATGCCTAAGGTTACCCAAGG - Intergenic
1195086061 X:101415768-101415790 AGAAGGGCTCTGGGGAGCAAAGG + Intergenic
1195666823 X:107439291-107439313 ATAAGGCCTCTGGAAACCCTAGG + Intergenic
1195709803 X:107764904-107764926 CGAAGGCCTCTGCCTCCCCAGGG + Intronic
1195767697 X:108314088-108314110 AGAAGACCTCTGGATATTCATGG - Intronic
1195990066 X:110673410-110673432 AGAAGGCCATTGGGTACAGAAGG - Intergenic
1196962843 X:121022561-121022583 AGAAGGCATTTAGGTACTCAAGG - Intergenic
1198399800 X:136257775-136257797 AGAAGCCCCCTGGGTACTGAAGG + Intergenic
1199256426 X:145723498-145723520 AGAAGCCCTCTGGGAATCCGTGG - Intergenic