ID: 1082086854

View in Genome Browser
Species Human (GRCh38)
Location 11:48057533-48057555
Sequence TACCCAGAGGCCTTCTCACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 94
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086848_1082086854 3 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086854 11:48057533-48057555 TACCCAGAGGCCTTCTCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 87
1082086851_1082086854 -2 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086854 11:48057533-48057555 TACCCAGAGGCCTTCTCACGTGG 0: 1
1: 0
2: 0
3: 6
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086854 Original CRISPR TACCCAGAGGCCTTCTCACG TGG Intronic
903779006 1:25809925-25809947 TCCCCAGAGCCCATCTCATGGGG + Intronic
904644340 1:31954771-31954793 GACCCAGTGGCCTGCCCACGTGG + Intergenic
907242045 1:53086299-53086321 TTCCCTGAGGCCTCCTCACCTGG - Intergenic
907386856 1:54131550-54131572 ATCCCAGAGGTCTTCTCATGAGG + Intergenic
911048812 1:93652005-93652027 TACCCAGAGAACTTCTGAGGGGG + Intronic
914403001 1:147341403-147341425 TACCCTGTGGCCCTCTCAAGAGG + Intergenic
918364337 1:183790487-183790509 TACCCTCAAGCCTTCTCAAGTGG + Intronic
921291323 1:213660365-213660387 TGCCCAGAGGCCTTCCAATGAGG - Intergenic
1064201006 10:13284888-13284910 GACCCAGAGCCCTTCTCTCCTGG + Intronic
1067170674 10:43903673-43903695 TGCCCAGACCCCTTCTCAGGAGG - Intergenic
1073065380 10:100755749-100755771 TAACCAGAGCCCTTGTCACAGGG + Intronic
1082086854 11:48057533-48057555 TACCCAGAGGCCTTCTCACGTGG + Intronic
1088552247 11:111025033-111025055 TAACCAGAGGCATTTTCACTAGG + Intergenic
1088820650 11:113453914-113453936 TACCCAGAGTCCTTTTGATGGGG + Intronic
1090260497 11:125315470-125315492 TGCAGAGAGGCCTTCTCACAGGG + Intronic
1090710938 11:129384454-129384476 TTCCCAGAGTCCTTTTCACTCGG + Intronic
1091677580 12:2502435-2502457 TTCCCAGAGCACTTCTCACTTGG - Intronic
1093187104 12:16032975-16032997 AACACAGAGGCTTTCTCACAAGG + Intronic
1099599916 12:84721904-84721926 TACCAAGATGCCTTATTACGGGG - Intergenic
1108176212 13:47795430-47795452 TATCCAGGGGTCTTCTCATGTGG + Intergenic
1108742674 13:53355038-53355060 CACCCAGAGGGCATCTCACATGG - Intergenic
1114601284 14:23957365-23957387 TACCCAGTGGCCTCCTCATCTGG + Intronic
1119203924 14:72779876-72779898 GACCCAGAGGCCTTCTGTCCTGG - Intronic
1119838262 14:77770631-77770653 TACCCAGACACCTTCTCAAGGGG + Intergenic
1119939716 14:78627465-78627487 TACCCAGAGCCCTTTTCCAGAGG + Intronic
1120829406 14:88984763-88984785 TTCCCAGAGGCCACCTCACTTGG - Intergenic
1129267104 15:74399639-74399661 TCCTCAGAGGCCTTGTCTCGAGG - Intergenic
1130918420 15:88324141-88324163 TACCCGACGGCCCTCTCACGGGG - Intergenic
1142023851 16:87801829-87801851 TGCCCAGAGGCCTCCACAGGAGG + Intergenic
1144238246 17:13283834-13283856 AACCCAGATGCTTTCTCATGTGG + Intergenic
1146204371 17:30889292-30889314 AACACAGTGGCCTTCTCAGGAGG - Intronic
1150647733 17:66990271-66990293 TACCCACAGTCCTTGCCACGTGG + Intronic
1151664994 17:75540673-75540695 TACCCACAGCCCTTCTGACTTGG + Intronic
1151849174 17:76679865-76679887 TTCCCAGGGGCCTTCTCATCTGG - Intronic
1152260801 17:79266026-79266048 TTCCCAGAGGGCTGCTCACCCGG + Intronic
1157577892 18:48755736-48755758 TACCCTGGGCCCTTCTCAGGAGG - Intronic
1157996986 18:52570294-52570316 TTCCCAGTGGCCTTCTTAGGTGG + Intronic
1162814260 19:13183785-13183807 CACCCACAGGGCTTCTCATGGGG - Intergenic
1164826637 19:31289229-31289251 GACCCAGAGGCCTTTACAAGAGG - Intronic
1167402764 19:49283869-49283891 TACACAGATGGCTTGTCACGAGG + Intergenic
1167598018 19:50437475-50437497 TGCCCAGAGGCATCCTGACGGGG - Exonic
926817646 2:16815700-16815722 TACCCAGCGGTCCTCTCAAGTGG + Intergenic
927138821 2:20115893-20115915 TCCCCAGAAGCCTTCTCTGGAGG - Intergenic
934618767 2:95791598-95791620 AACACAGAGGCCTACTCACCAGG - Intergenic
934642126 2:96032959-96032981 AACACAGAGGCCTACTCACCAGG + Intronic
935659871 2:105457127-105457149 TCACCAGAAGCCTTCTCACATGG - Intergenic
937710303 2:124973148-124973170 TTCCAAGAGGCCTTCTCACAGGG + Intergenic
939932995 2:148256433-148256455 TTCCCAGAGGTCTTGCCACGTGG + Intronic
940416118 2:153421829-153421851 TACCCAGTGGTCTTGTCACTTGG + Intergenic
941104685 2:161339812-161339834 TTCCCAGTGGCCTTCTCATCTGG - Intronic
944177840 2:196853198-196853220 TCCCCTGAGGCCTTCTCAAAGGG - Intronic
948095876 2:235333808-235333830 CACCCAGAAGCCTTGTCACTAGG - Intergenic
1170850418 20:19999113-19999135 GACACAGAGGTCTTCTCACATGG + Intronic
1174040657 20:47697339-47697361 TCCTCAGAGGCCTTCTGAGGGGG + Intronic
1175990153 20:62784670-62784692 TGCCCAGAGCCGTGCTCACGCGG - Intergenic
1178535243 21:33404759-33404781 TACCCAGAGAGCTTCTTACCTGG + Intronic
1181951913 22:26560191-26560213 TACCCAGAGGCCTTCTCTGCTGG + Intronic
1182060326 22:27392716-27392738 TACCCAGAGGCCTTGGGATGTGG + Intergenic
1183953258 22:41364344-41364366 TACCTAGAGACCTTCGGACGGGG - Intergenic
1184118148 22:42433889-42433911 TACCCTGAGGCATTGACACGAGG - Intergenic
1185110957 22:48899870-48899892 CACCCAGAGGCCTTCTCGAGTGG + Intergenic
1185348119 22:50319521-50319543 GACCCAGAGGCCCCCTCACCCGG + Intronic
957733229 3:84170411-84170433 TACCCAGATGCTTTCTCAGAAGG - Intergenic
959358914 3:105366551-105366573 AAGCCAGAGGCCTTATCACTGGG + Intergenic
964432817 3:156623757-156623779 TTCCCAGAGGTCTTGCCACGTGG - Intergenic
969255709 4:6000411-6000433 TTCCCAGTGGCCCTCTCAGGAGG + Intergenic
969411265 4:7029921-7029943 TGCCTTGAGGCCTTCTCAGGTGG + Intronic
983822324 4:172211296-172211318 TGCCCCTAGGCCTTCTCAGGAGG + Intronic
998692124 5:144598744-144598766 TACCCAGAGGCTTTCTTAATTGG + Intergenic
999297972 5:150472499-150472521 CACCCAGTGGCCTTGTCAGGGGG - Intergenic
1002493559 5:179596859-179596881 TCCCCACAGGGCTCCTCACGTGG + Intronic
1004260430 6:14102978-14103000 GAGCCAGAGGACTTCCCACGGGG - Intergenic
1008043644 6:46829573-46829595 TACTTAGAGGCATTCACACGAGG + Intronic
1012200741 6:96403527-96403549 TATCCAGAGGCCAGCTCAAGTGG + Intergenic
1016658646 6:146549666-146549688 TAGCCAGAGTCCTTCCCAGGTGG + Exonic
1019537932 7:1538549-1538571 TCCCCAGAGGCCCCCTCTCGGGG + Intronic
1021332709 7:19358372-19358394 TACTCAGATGCCTTGCCACGCGG + Intergenic
1029203430 7:98854340-98854362 TACACAGAGGGCTTCTCAACAGG + Intronic
1033322378 7:140351491-140351513 TATGCAGAGCCCTTCACACGTGG - Intronic
1034907376 7:154962343-154962365 TTCCCAGTGGCCTTCCCACCAGG - Exonic
1035270909 7:157719336-157719358 GACCCTGAGGCCTTCTCTCTAGG + Intronic
1035395397 7:158531532-158531554 CACCATGAGGCCTCCTCACGAGG + Intronic
1036512008 8:9409219-9409241 AACCCAGAGGCCTTCTGGTGGGG - Intergenic
1040022864 8:42756068-42756090 TGCCCAGAGGCCTTGCCAGGAGG - Exonic
1041621562 8:59975964-59975986 TACCCAGCAGCCTTCTCAAATGG + Intergenic
1042248803 8:66735482-66735504 TACCCAGAAACCTTCTCCAGGGG - Intronic
1049639866 8:143710636-143710658 TAGGCAGAGGCCTGCTCACATGG + Intronic
1057705113 9:97390353-97390375 TAGAGAGAGGCCTTCTCACCTGG + Intergenic
1060554270 9:124500301-124500323 TACCCAGAGCCCTTCTCTGGAGG - Exonic
1061043767 9:128153636-128153658 CACCCTGAGTCCTTCCCACGTGG + Intergenic
1189552487 X:42107597-42107619 CACACAAAGGCCTTCGCACGGGG + Intergenic
1195737936 X:108032982-108033004 TACCCAGAGCCCTTCCCACCAGG + Intergenic
1198050789 X:132951445-132951467 CTCCCAGAGGCCTTCTCAAAAGG + Intronic
1200819122 Y:7564051-7564073 TACCCAGAGGGCTTTACAGGAGG + Intergenic