ID: 1082086855

View in Genome Browser
Species Human (GRCh38)
Location 11:48057534-48057556
Sequence ACCCAGAGGCCTTCTCACGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 85
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 77}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086851_1082086855 -1 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086855 11:48057534-48057556 ACCCAGAGGCCTTCTCACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77
1082086848_1082086855 4 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086855 11:48057534-48057556 ACCCAGAGGCCTTCTCACGTGGG 0: 1
1: 0
2: 0
3: 7
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086855 Original CRISPR ACCCAGAGGCCTTCTCACGT GGG Intronic
900289413 1:1917562-1917584 TCCCAGAGTCCTTCCCACATAGG + Intergenic
900544706 1:3222192-3222214 AGCCAGAGGGCTGCCCACGTGGG + Intronic
900889599 1:5440166-5440188 ACACAGAGGCCTTCCCAGGGTGG + Intergenic
903046304 1:20566577-20566599 ACCTAGAGGCCTTCTCCTCTGGG + Intergenic
904614724 1:31743546-31743568 ACCAAGAGCCCTTCCCAGGTAGG + Intronic
907242044 1:53086298-53086320 TCCCTGAGGCCTCCTCACCTGGG - Intergenic
918364338 1:183790488-183790510 ACCCTCAAGCCTTCTCAAGTGGG + Intronic
921162964 1:212486035-212486057 TCCCACAGGCCTTCTCTCTTTGG - Intergenic
923552550 1:234975742-234975764 GCGCAGACGCCTTCTCAGGTAGG - Intergenic
1068677223 10:59780443-59780465 CCCCAGAGGCCTTCTGATGAAGG + Intergenic
1070396298 10:76013719-76013741 ACACAGAGGCCTTCTAAGATGGG - Intronic
1071090510 10:81912738-81912760 ACCCAAAGGCCTTGTCAACTGGG - Intronic
1071533857 10:86411301-86411323 ACACAGAGGACTCCTCACGCTGG - Intergenic
1073098785 10:100996590-100996612 ACCCGCAGGCCTGCTCACCTGGG + Intergenic
1077100058 11:818733-818755 AACGAGAGGCTTTCTCAGGTTGG - Intergenic
1082086855 11:48057534-48057556 ACCCAGAGGCCTTCTCACGTGGG + Intronic
1083589891 11:63887598-63887620 ACTCCGTGACCTTCTCACGTTGG - Intronic
1089119793 11:116125470-116125492 TCCCAGAGTCCTCCTCAGGTGGG - Intergenic
1091225190 11:133952945-133952967 ATCCTGTGGCCTTCTCAGGTTGG - Intronic
1092537225 12:9401814-9401836 ATCCAGATGCCTTCTTAGGTAGG + Intergenic
1092557452 12:9571484-9571506 ATCCAGATGCCTTCTTAGGTAGG - Intergenic
1093583171 12:20807326-20807348 ACCCAGAGGCTGCCTCACCTGGG + Intergenic
1094513827 12:31116424-31116446 ATCCAGATGCCTTCTTAGGTAGG + Intergenic
1096114259 12:49046063-49046085 ACCCACAGGCTTTACCACGTAGG + Exonic
1098223022 12:68290393-68290415 ACCCAGAGGCAGTTTCAGGTAGG - Intronic
1103205639 12:119126646-119126668 AACAAGATGCCTTCTCAGGTTGG - Intronic
1104637698 12:130448364-130448386 ACCCAGTGGCCCTCTGAGGTTGG + Intronic
1108176213 13:47795431-47795453 ATCCAGGGGTCTTCTCATGTGGG + Intergenic
1108590319 13:51907056-51907078 CCCCAGATCCCTGCTCACGTTGG - Intergenic
1113458813 13:110467588-110467610 ACCCAGACTCTTTCTCACATGGG - Intronic
1115870548 14:37796943-37796965 ACTCAGAGGACTTTTCACCTTGG - Exonic
1117439430 14:55746009-55746031 ACTCAGAGGCCCTTTCATGTAGG + Intergenic
1119203923 14:72779875-72779897 ACCCAGAGGCCTTCTGTCCTGGG - Intronic
1119838263 14:77770632-77770654 ACCCAGACACCTTCTCAAGGGGG + Intergenic
1122326074 14:100881328-100881350 ACCCAGATGCCCGCTCTCGTAGG - Exonic
1122623249 14:103071514-103071536 ACCCACAGGGCGTCTCAGGTGGG - Intergenic
1129187521 15:73919162-73919184 ATCCAGAGGTGTGCTCACGTTGG + Intergenic
1130064821 15:80594790-80594812 ACGCCCAGGCCTTCTCACATGGG + Exonic
1131511089 15:93049916-93049938 ACCCAGAGGCCTCATCATCTTGG + Intronic
1134307331 16:13044690-13044712 AGCCAGATGCCCTCTCACCTCGG - Intronic
1136071102 16:27787764-27787786 ACCCAGGGTCCTTCTGAAGTTGG - Exonic
1138590516 16:57997122-57997144 GCCCAAAGCCCTTCTCACATAGG + Exonic
1139044099 16:63035319-63035341 TGCCTGAGGCCTACTCACGTTGG - Intergenic
1140651918 16:77097551-77097573 ACCCAGAGGCCTTCTTACTGAGG + Intergenic
1141664664 16:85459777-85459799 TCCCAGAGGCTTTCTCTCTTTGG + Intergenic
1148090027 17:45017978-45018000 ACCCAGAGGCCCTGTCACTCTGG + Intergenic
1151664995 17:75540674-75540696 ACCCACAGCCCTTCTGACTTGGG + Intronic
1151849173 17:76679864-76679886 TCCCAGGGGCCTTCTCATCTGGG - Intronic
1160505578 18:79424427-79424449 ACCCAGAGGCTGCCTCACGTCGG + Intronic
1161383119 19:3976999-3977021 GCCCAGAGCCCTTCTCACACTGG + Intronic
1162221740 19:9183182-9183204 ACCCAGCTGCCTGCTCCCGTGGG + Intergenic
1163505927 19:17706166-17706188 ACCCAGAGGCCTGTTCACTTTGG + Intergenic
1165421286 19:35723188-35723210 ACCCACAGTCCTGCACACGTAGG - Exonic
1168312430 19:55467686-55467708 ACCCAGGGGTCTTCTCCCTTCGG - Intergenic
926800406 2:16655244-16655266 GCCCAGAGGCATTCTCAAGATGG - Intronic
926822775 2:16871472-16871494 ACCCTGAGACCTCCTCACATTGG + Intergenic
941104684 2:161339811-161339833 TCCCAGTGGCCTTCTCATCTGGG - Intronic
942514228 2:176735105-176735127 CCCGAAAGGTCTTCTCACGTGGG + Intergenic
942701896 2:178720627-178720649 ACCCAGAAGCCTTCTCCAGTAGG - Exonic
1170850419 20:19999114-19999136 ACACAGAGGTCTTCTCACATGGG + Intronic
1173672394 20:44807907-44807929 ACCCCCAGGCCTCCTCACCTGGG + Intronic
1182060327 22:27392717-27392739 ACCCAGAGGCCTTGGGATGTGGG + Intergenic
1182108762 22:27707805-27707827 ACCCTGAGACCTTTTCACTTGGG + Intergenic
1182394974 22:30028669-30028691 CCCCAGAGGCCTTCACTCTTTGG + Intronic
1185042663 22:48513426-48513448 ACTCAGAGGCCTTCTGTCATGGG + Intronic
1185348120 22:50319522-50319544 ACCCAGAGGCCCCCTCACCCGGG + Intronic
959358915 3:105366552-105366574 AGCCAGAGGCCTTATCACTGGGG + Intergenic
967792477 3:193564146-193564168 ACCCAGAGGCCTTGCCACCCTGG + Intronic
994015004 5:94955296-94955318 AACCAGAGGCCTTGTGACATAGG - Intronic
999297971 5:150472498-150472520 ACCCAGTGGCCTTGTCAGGGGGG - Intergenic
1004059194 6:12175369-12175391 TCCCAAAGGCCCTCTCATGTTGG - Intergenic
1018157978 6:161007158-161007180 ACCCAGAGGTCTTGTTACTTGGG + Intronic
1019745733 7:2699637-2699659 ACCCAGAGCCCCTATCACCTAGG - Intronic
1020361359 7:7329952-7329974 ACACAGAGCCCTTCACACTTTGG - Intergenic
1024757843 7:52557270-52557292 ACACAGAGGCCTTCTCACCATGG + Intergenic
1031117265 7:117681863-117681885 TTCCAGAGGCCTTCTCAAGCAGG - Intronic
1036576135 8:10029355-10029377 GCCCAGAGCCCCTCTCACTTGGG + Intergenic
1037291254 8:17351422-17351444 ACCCAGAGGCCCACTCTCCTTGG + Intronic
1049444913 8:142625443-142625465 ACCCAGAGGCGTGCTCACCAAGG + Intergenic
1049639867 8:143710637-143710659 AGGCAGAGGCCTGCTCACATGGG + Intronic
1049826381 8:144671513-144671535 CCCCAGATGCCTGCTCACCTGGG + Intergenic
1059353247 9:113680783-113680805 ACCAAGAGGCCTTTACACTTAGG + Intergenic
1060554269 9:124500300-124500322 ACCCAGAGCCCTTCTCTGGAGGG - Exonic
1193313411 X:80036206-80036228 ACCCAGAGGCCTGCTGAATTTGG - Intergenic
1194494758 X:94600647-94600669 AACCAGAGGCCTTATCATGCAGG - Intergenic