ID: 1082086856

View in Genome Browser
Species Human (GRCh38)
Location 11:48057535-48057557
Sequence ACCCACGTGAGAAGGCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086856_1082086862 -8 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086856_1082086863 -5 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086856_1082086865 1 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086856_1082086864 -2 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086856_1082086866 7 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086856_1082086867 29 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086867 11:48057587-48057609 GTAGCCCCCATAATACTTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086856 Original CRISPR ACCCACGTGAGAAGGCCTCT GGG (reversed) Intronic
900311095 1:2033451-2033473 ACCCACATGAGGACGCCCCTAGG - Intergenic
901207631 1:7505923-7505945 ACCTGGGTGAGGAGGCCTCTCGG - Intronic
903046305 1:20566578-20566600 TCCCAGAGGAGAAGGCCTCTAGG - Intergenic
904035318 1:27555843-27555865 ACCCACCCGTGAAGACCTCTGGG + Intronic
904644341 1:31954773-31954795 AGCCACGTGGGCAGGCCACTGGG - Intergenic
905356570 1:37389017-37389039 GCACATGTGAGAAGGCATCTTGG - Intergenic
907158850 1:52357129-52357151 ACCCAGGTCACAAGGCCCCTCGG + Intronic
907242043 1:53086297-53086319 TCCCAGGTGAGGAGGCCTCAGGG + Intergenic
920938686 1:210459961-210459983 AGCCATGTGAGAAAACCTCTTGG - Intronic
1063178467 10:3573224-3573246 GCTCAAGGGAGAAGGCCTCTTGG - Intergenic
1065306858 10:24377335-24377357 AGCCACGTGAGCAGGACTCAAGG - Intronic
1070710213 10:78675800-78675822 ACCCAAATGAGAAGACTTCTTGG + Intergenic
1081671195 11:44943566-44943588 ACACAAGTGAGAAGGTCCCTGGG + Intronic
1082086856 11:48057535-48057557 ACCCACGTGAGAAGGCCTCTGGG - Intronic
1084309706 11:68309802-68309824 AGCCAGGAGAGAGGGCCTCTTGG - Intergenic
1084361283 11:68669996-68670018 CCCCAGGTGGGAAGGCCTTTTGG - Intergenic
1089119792 11:116125469-116125491 TCCCACCTGAGGAGGACTCTGGG + Intergenic
1091279480 11:134373902-134373924 ACCCAGGTGTGAACGCCTCCAGG + Intronic
1092292349 12:7169215-7169237 ACCCAAGTGGCAAGTCCTCTGGG - Intergenic
1094208222 12:27862915-27862937 AAGCACCTAAGAAGGCCTCTCGG - Intergenic
1096546873 12:52346136-52346158 ACCCAGGTGGAAAGGCCCCTGGG - Intergenic
1096932630 12:55230566-55230588 ACACACATGAGAAGGCCACAAGG + Intergenic
1101351564 12:103934523-103934545 CCCCAAGGGAGAAGGCTTCTTGG + Intronic
1103600467 12:122051315-122051337 ACCCACCTGGGAAGGCCACACGG - Intronic
1105005654 12:132719062-132719084 AGCCACGTTAGAGGGCCCCTTGG + Intronic
1105504908 13:21001587-21001609 ACCCATGAGTGAAGCCCTCTTGG + Intronic
1118221202 14:63855928-63855950 ATACTGGTGAGAAGGCCTCTAGG + Intronic
1119203922 14:72779874-72779896 TCCCAGGACAGAAGGCCTCTGGG + Intronic
1130314261 15:82781733-82781755 AGCCACCTCAGATGGCCTCTTGG - Intronic
1135417348 16:22278666-22278688 ACACAGGTAAGAAGGCCTGTGGG - Intronic
1136598215 16:31266131-31266153 ACCCACCTCGGAGGGCCTCTGGG - Exonic
1137554272 16:49460892-49460914 ACCCACTTTAGAAGCCCCCTTGG - Intergenic
1137737171 16:50733557-50733579 ACACATGTGAAAAGGCCCCTTGG + Intergenic
1140465066 16:75174912-75174934 ACCCAGGTGAGAAGGTGTTTGGG - Intergenic
1140651919 16:77097552-77097574 ACCTCAGTAAGAAGGCCTCTGGG - Intergenic
1141664665 16:85459778-85459800 ACCAAAGAGAGAAAGCCTCTGGG - Intergenic
1151790966 17:76305625-76305647 ACCCACTTGTGAAAGCCTGTAGG + Intronic
1151849172 17:76679863-76679885 GCCCAGATGAGAAGGCCCCTGGG + Intronic
1152129664 17:78468432-78468454 ACCCACGTGAAAAAGTCTCCAGG + Intronic
1154030951 18:10753974-10753996 ACACACTTCAGAAGGCCCCTAGG - Intronic
1154169202 18:12038601-12038623 ACCCAGGTGACACGGACTCTGGG - Intergenic
1162221741 19:9183183-9183205 ACCCACGGGAGCAGGCAGCTGGG - Intergenic
1165070888 19:33254277-33254299 ATCCAGGTGAGAAGGCCGCGTGG - Intergenic
1165244922 19:34493346-34493368 ACCCACGTCAGAGGGGCTCCAGG - Intronic
1168151649 19:54452262-54452284 GCACAGGTGAGAAGGCCTCATGG + Exonic
925010787 2:484409-484431 ACGCAGGTGAGAAGTCCTCCTGG - Intergenic
933758570 2:85659648-85659670 AGCCAAGTGAGACGGGCTCTGGG - Intronic
937710304 2:124973150-124973172 CACCCTGTGAGAAGGCCTCTTGG - Intergenic
939932996 2:148256435-148256457 AGCCACGTGGCAAGACCTCTGGG - Intronic
941104683 2:161339810-161339832 GCCCAGATGAGAAGGCCACTGGG + Intronic
942514229 2:176735106-176735128 TCCCACGTGAGAAGACCTTTCGG - Intergenic
943041991 2:182814664-182814686 ACCTTTGTGAGAAGGCTTCTAGG + Intergenic
945254223 2:207790636-207790658 ACCCTCTTCAGAAAGCCTCTAGG + Intergenic
945302773 2:208229781-208229803 ACCCTCTTGACAAAGCCTCTTGG - Intergenic
946838989 2:223801225-223801247 TCCCACTTGATAAGGACTCTAGG + Intronic
948007233 2:234619815-234619837 ACACATGTGAAAAGTCCTCTAGG - Intergenic
1173261837 20:41443374-41443396 TTCCAGGTGAGAAGGCATCTTGG + Intronic
1184661054 22:45965692-45965714 ACCCAGAACAGAAGGCCTCTGGG + Intronic
1185110958 22:48899872-48899894 CTCCACTCGAGAAGGCCTCTGGG - Intergenic
949541732 3:5037862-5037884 ACCCATGGGCGAATGCCTCTAGG + Intergenic
951018510 3:17756463-17756485 AGCCACGTGAAGAGGCCTCCTGG - Intronic
954419418 3:50410710-50410732 ACCCCTGTGACCAGGCCTCTTGG + Intronic
963008552 3:140748909-140748931 ACTCAGGAGAGAAAGCCTCTAGG + Intergenic
964432816 3:156623755-156623777 AGCCACGTGGCAAGACCTCTGGG + Intergenic
966155929 3:176916607-176916629 ACCCAGGTAACAAGGCTTCTTGG - Intergenic
969411266 4:7029923-7029945 TGCCACCTGAGAAGGCCTCAAGG - Intronic
969570598 4:8006065-8006087 ACACACCTGACATGGCCTCTGGG + Intronic
983822326 4:172211298-172211320 ACCCTCCTGAGAAGGCCTAGGGG - Intronic
1003521043 6:6858783-6858805 AACCACGTGAGACGGTCTTTCGG - Intergenic
1018157979 6:161007159-161007181 ACCCAAGTAACAAGACCTCTGGG - Intronic
1018936836 6:168279276-168279298 ACTCACGCGACGAGGCCTCTGGG - Intergenic
1022334381 7:29408500-29408522 CAACACGTGAGAAGTCCTCTGGG + Intronic
1023658770 7:42452528-42452550 ACCCACCGCAGAAGGTCTCTGGG + Intergenic
1023989141 7:45117762-45117784 GTGCAGGTGAGAAGGCCTCTGGG + Intergenic
1035546020 8:483067-483089 AGCCAGGTGAGCAGGACTCTTGG + Intergenic
1036576136 8:10029356-10029378 GCCCAAGTGAGAGGGGCTCTGGG - Intergenic
1036669288 8:10770142-10770164 ACCCAGGCAAGAAGCCCTCTTGG + Intronic
1038376409 8:27044533-27044555 TCCCACCTGTGAAGGTCTCTAGG + Intergenic
1039951799 8:42178841-42178863 ACCCAGGGGAGAATGCCCCTGGG - Intronic
1044595816 8:93957223-93957245 CCCCACCTGTGAAGACCTCTAGG - Intergenic
1045366931 8:101485094-101485116 ACCCAAGTGGGAAGTCCTCCTGG + Intergenic
1047215291 8:122871205-122871227 ACCTACCTGAGAAGGCTTTTAGG + Intronic
1047280008 8:123437340-123437362 CCCCATCTGAGAAGGCATCTTGG - Intronic
1049589585 8:143451032-143451054 AACCACCAGAGAAGGCCTGTGGG + Intronic
1049826382 8:144671514-144671536 GCCCAGGTGAGCAGGCATCTGGG - Intergenic
1062104366 9:134745433-134745455 GCCCACGTGAGAAAGACTCCTGG - Intronic
1185650451 X:1644035-1644057 ACACAGGTGAGAAGGCCACATGG + Intergenic
1190114645 X:47618844-47618866 ACCCATTAGAGAAGGCCTCAGGG + Intronic
1198050790 X:132951447-132951469 ATCCTTTTGAGAAGGCCTCTGGG - Intronic