ID: 1082086857

View in Genome Browser
Species Human (GRCh38)
Location 11:48057536-48057558
Sequence GACCCACGTGAGAAGGCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086857_1082086862 -9 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086857_1082086864 -3 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086857_1082086866 6 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086857_1082086867 28 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086867 11:48057587-48057609 GTAGCCCCCATAATACTTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1082086857_1082086865 0 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086857_1082086863 -6 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086857 Original CRISPR GACCCACGTGAGAAGGCCTC TGG (reversed) Intronic
900517642 1:3090604-3090626 GAGTCAGGTGAGAAGCCCTCGGG - Intronic
900544707 1:3222194-3222216 AACCCACGTGGGCAGCCCTCTGG - Intronic
904644342 1:31954774-31954796 GAGCCACGTGGGCAGGCCACTGG - Intergenic
907242042 1:53086296-53086318 CTCCCAGGTGAGGAGGCCTCAGG + Intergenic
911259957 1:95674016-95674038 GACCCAAGTGGGAAGAACTCAGG - Intergenic
917205251 1:172564547-172564569 AACACAGTTGAGAAGGCCTCAGG - Intronic
917733936 1:177903226-177903248 GACCCACATGATAAGGAATCGGG - Intergenic
918306312 1:183250066-183250088 GACCCACGTGAGCAGACCTGAGG - Exonic
919797491 1:201330082-201330104 GACCCAGCTGAGAAGCCCTCAGG + Exonic
1066013377 10:31214708-31214730 GAAGCAGGTGAGAAGGCCCCTGG - Intergenic
1066059190 10:31707299-31707321 GACTCACCTGAGGAGGCCCCTGG + Intergenic
1066460348 10:35607850-35607872 GACCCCCGGGAGCCGGCCTCCGG + Exonic
1070590316 10:77796309-77796331 GACCCATGTCAGCAGGCTTCTGG + Intronic
1070820040 10:79349118-79349140 GACCCATCTCAGAAGGCCCCAGG - Intronic
1071812767 10:89200989-89201011 GACCTACCAGAGAAAGCCTCTGG - Intergenic
1073515397 10:104071292-104071314 GACTCAGGTGAGAAGGTGTCGGG + Intronic
1074697444 10:116062851-116062873 GACCCTGGTGATAAGGCATCTGG - Intronic
1075256215 10:120927581-120927603 GAGTCAGGTGGGAAGGCCTCTGG - Intergenic
1078169842 11:8921243-8921265 GACCCATGTGAGGAGTCCTTAGG + Intronic
1078447962 11:11419029-11419051 GAGCCACTGGAGAAGGCCACTGG + Intronic
1080667129 11:34345660-34345682 GTAGCAGGTGAGAAGGCCTCAGG - Intronic
1082086857 11:48057536-48057558 GACCCACGTGAGAAGGCCTCTGG - Intronic
1084542764 11:69797703-69797725 GACTCAGGTGAGAAGGTCTTAGG - Intergenic
1085199586 11:74693660-74693682 GATCCACGTGAGGATGACTCTGG - Intergenic
1087989246 11:104727951-104727973 AACCCACGTGGGAAGGCAACAGG - Intergenic
1089229379 11:116958351-116958373 GACCCACGGGAGAAAGGCACAGG + Intronic
1090852651 11:130584115-130584137 GATCCACTGGAGCAGGCCTCAGG - Intergenic
1091727342 12:2855222-2855244 GAGCCACGTGTGAAAGCCCCAGG + Intronic
1097190792 12:57218444-57218466 CACCCATGTGTGAAGGCCTGGGG + Intronic
1106319524 13:28624766-28624788 GACTCACAGCAGAAGGCCTCAGG + Intergenic
1112438619 13:99409036-99409058 CAGCCACGTGAGATGGCTTCCGG - Intergenic
1113472260 13:110555434-110555456 GAGCCACCTGAGAAGGGATCAGG - Intronic
1116258255 14:42586032-42586054 GACCCACCTCACCAGGCCTCAGG + Intergenic
1119203921 14:72779873-72779895 GTCCCAGGACAGAAGGCCTCTGG + Intronic
1121314773 14:92954361-92954383 GAGGCAAGTGAGAAGGCATCAGG + Intronic
1121737238 14:96226978-96227000 GACCCAGGTTAGAGGGACTCAGG - Intronic
1123935204 15:25190750-25190772 GACCCACCAGAGAAGGCATGTGG + Intergenic
1131283486 15:91039567-91039589 GGACCACCTGAGAAGGCCCCCGG + Intergenic
1133741666 16:8656399-8656421 GACCTGCGTGAGTAGACCTCAGG + Intergenic
1135417349 16:22278667-22278689 GACACAGGTAAGAAGGCCTGTGG - Intronic
1138008470 16:53357866-53357888 GACCCAATTGAGCAGGACTCAGG - Intergenic
1139044098 16:63035317-63035339 CACCAACGTGAGTAGGCCTCAGG + Intergenic
1139431332 16:66912474-66912496 GACGCAGGGGAGAAGGCCTTGGG - Intronic
1139448461 16:67013252-67013274 GACCCATGTGAGAAAGCATGAGG - Intergenic
1140651920 16:77097553-77097575 GACCTCAGTAAGAAGGCCTCTGG - Intergenic
1141664666 16:85459779-85459801 GACCAAAGAGAGAAAGCCTCTGG - Intergenic
1142153127 16:88521432-88521454 TCCCCAGGTGAGAAAGCCTCAGG + Intronic
1148243245 17:46013463-46013485 GACACACATGAGGAGGCCTGTGG - Intronic
1151849171 17:76679862-76679884 GGCCCAGATGAGAAGGCCCCTGG + Intronic
1152118103 17:78401128-78401150 GACGCAGGTGAGGAGGACTCAGG + Intronic
1153843914 18:9031605-9031627 AATCCAGGTCAGAAGGCCTCAGG - Intergenic
1154169203 18:12038602-12038624 GACCCAGGTGACACGGACTCTGG - Intergenic
1161083886 19:2325067-2325089 GACCCAGGTGCAAAGGCTTCGGG + Intronic
1161997830 19:7724941-7724963 GAGCCACCTCACAAGGCCTCGGG - Intergenic
1167321351 19:48799019-48799041 GACCCAGGAGAGCAGGGCTCGGG + Intronic
927105337 2:19819023-19819045 GACCCAAGTGAGAAGCCATTTGG - Intergenic
929542646 2:42834229-42834251 GGCCCACCTGGGAAGTCCTCCGG + Intergenic
934574268 2:95390573-95390595 GACCCAGGTGAGAGGGCCAGAGG - Intergenic
935659870 2:105457124-105457146 GTGCCATGTGAGAAGGCTTCTGG + Intergenic
941104682 2:161339809-161339831 GGCCCAGATGAGAAGGCCACTGG + Intronic
948285933 2:236785229-236785251 GACCCACGTGGCAAGGACTGAGG + Intergenic
949031180 2:241798216-241798238 GGCCCACATGAGGAGGCCTGAGG - Intronic
1171511334 20:25686862-25686884 GACAAACTTGAGAAGGCCACAGG + Exonic
1174237082 20:49102956-49102978 GACCCACTTAAGAGGGACTCGGG - Intergenic
1176873951 21:14107459-14107481 GACTCATATGAGGAGGCCTCAGG + Intergenic
1180945970 22:19693703-19693725 GACCCACGTAAGGAGACCTAAGG - Intergenic
1182282425 22:29225201-29225223 GACCCACCTGAGAAGGCTGTGGG - Exonic
1182761236 22:32723865-32723887 GTGCCACGTGAGGGGGCCTCAGG + Intronic
1184149986 22:42632133-42632155 GACCCACTTAACAAGACCTCAGG - Intronic
1184661053 22:45965691-45965713 GACCCAGAACAGAAGGCCTCTGG + Intronic
1185110959 22:48899873-48899895 GCTCCACTCGAGAAGGCCTCTGG - Intergenic
950361789 3:12454619-12454641 GACCCAGGGGAGAAGGACACAGG + Intergenic
960947151 3:122974560-122974582 CATCCACCTGAGAAGTCCTCAGG - Intronic
971197408 4:24482764-24482786 GACCCCAGTGAGATGGCATCGGG + Intergenic
979440030 4:120740658-120740680 GACCCACATGAGATGGCCATGGG - Intronic
983822327 4:172211299-172211321 AACCCTCCTGAGAAGGCCTAGGG - Intronic
1002315923 5:178343152-178343174 GACCCACGTGGGAAACACTCAGG + Intronic
1006440935 6:34053314-34053336 GTCCCACAGGAGAAGGCCTTAGG - Intronic
1011294324 6:85810060-85810082 GACCCACGTGGGCAGGCCACTGG + Intergenic
1017436113 6:154417397-154417419 GAAGCACATCAGAAGGCCTCAGG - Intronic
1017714755 6:157201124-157201146 GGCTGACGTGAGAAGGCCACTGG - Exonic
1022506183 7:30909883-30909905 GACCCACATGAGGAGCTCTCTGG - Intergenic
1023879746 7:44311746-44311768 GACCCAGGCCTGAAGGCCTCTGG - Intronic
1030092145 7:105867158-105867180 CACACAGGTCAGAAGGCCTCAGG + Intronic
1032477889 7:132224781-132224803 GCCCCAAGTAAGAAGGCATCCGG - Intronic
1034943673 7:155248415-155248437 GAGCCAGGTGAGATGCCCTCAGG - Intergenic
1046751723 8:117933862-117933884 GACCCCTGTGAGCAGGCGTCTGG - Intronic
1053308912 9:37002931-37002953 GAGCCACGAGCGCAGGCCTCGGG + Intronic
1061405692 9:130391972-130391994 GACCCTGGTGAGCAGGCCTGGGG + Intronic
1187403506 X:18983388-18983410 GACCCACCTGGGAAGCCCTTAGG - Intronic
1190114644 X:47618843-47618865 GACCCATTAGAGAAGGCCTCAGG + Intronic
1198256067 X:134925564-134925586 GTCCCACTTGAGAAGCCCTTCGG + Intergenic
1199634533 X:149802974-149802996 CTGCCAGGTGAGAAGGCCTCAGG - Intergenic