ID: 1082086858

View in Genome Browser
Species Human (GRCh38)
Location 11:48057540-48057562
Sequence AGGCCTTCTCACGTGGGTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 54
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 51}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086853_1082086858 -9 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1082086848_1082086858 10 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51
1082086851_1082086858 5 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG 0: 1
1: 0
2: 0
3: 2
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086858 Original CRISPR AGGCCTTCTCACGTGGGTCG AGG Intronic
900813820 1:4828146-4828168 ATGCGTTCTCACGTGTGTTGAGG + Intergenic
901853855 1:12031784-12031806 AGGGCTTCTGCCGTGGGACGTGG - Exonic
903404355 1:23083913-23083935 AGGCTTCCTCACTTGGGTGGGGG + Intergenic
922668380 1:227491426-227491448 AGGCCATCTCAGGTGGGTGCAGG + Intergenic
923105437 1:230850447-230850469 GGGCCTTCTCAGGTGGATAGGGG + Intronic
923552548 1:234975736-234975758 ACGCCTTCTCAGGTAGGTCTGGG - Intergenic
1063469294 10:6271755-6271777 GCGCCTTCTCCCGTGGGTGGAGG + Intergenic
1065325746 10:24549517-24549539 AGGCTTTCCCATGGGGGTCGTGG - Intergenic
1066460345 10:35607846-35607868 AGGCCGGCTCCCGGGGGTCGGGG - Exonic
1076336555 10:129710402-129710424 GGGCCTTCTCTCGAGGGTAGGGG + Intronic
1077493230 11:2871701-2871723 AGGGCTCCTCACGGGGGGCGGGG + Intergenic
1082086858 11:48057540-48057562 AGGCCTTCTCACGTGGGTCGAGG + Intronic
1089368440 11:117935362-117935384 AAGCCTTCTCAGATGGTTCGAGG - Intergenic
1090435920 11:126686204-126686226 GGGCTTTCTCACGTGTGGCGCGG + Intronic
1102580178 12:113881430-113881452 AGGCATTCCCACCTGGGTCCTGG - Intronic
1105856816 13:24381757-24381779 AGGCATTCTCATGCGGATCGGGG - Intergenic
1112963980 13:105164548-105164570 GGGCTTTCTGACCTGGGTCGGGG + Intergenic
1113131457 13:107042095-107042117 CTGCCTTCTCAAGTGGGTCCTGG - Intergenic
1113831175 13:113297038-113297060 AGGCCGGGTCACGTGGGTCCAGG + Intergenic
1202941233 14_KI270725v1_random:148624-148646 AGGCTTTATCACATTGGTCGTGG - Intergenic
1135529216 16:23238342-23238364 TGGCCTTCTCACATGGGTGATGG + Intergenic
1143845621 17:9771104-9771126 AGTCCTGCTCTCGTGGGTGGAGG + Intergenic
1144724138 17:17493111-17493133 AGGGCTCCTCACGGGGGTGGAGG + Exonic
1157336119 18:46738768-46738790 AGGCTTTGTCCCCTGGGTCGGGG + Intronic
1167454208 19:49590144-49590166 GGGCCTTCTTACCTGGGGCGGGG + Intronic
925912566 2:8583158-8583180 AGGCCTGGTCAGGTGGGGCGAGG + Intergenic
927152822 2:20205546-20205568 AAGCCTTCTCATGTGGCTCCAGG + Intronic
937293692 2:120797395-120797417 AGGCCTTTTTACCCGGGTCGGGG - Exonic
1170850420 20:19999120-19999142 AGGTCTTCTCACATGGGAAGAGG + Intronic
1171537129 20:25903918-25903940 AGGCTTTATCACATTGGTCGTGG - Intergenic
1171803978 20:29657248-29657270 AGGCTTTATCACATTGGTCGTGG + Intergenic
1171840078 20:30199219-30199241 AGGCTTTATCACTTTGGTCGTGG - Intergenic
1172748073 20:37228762-37228784 AGCCACTCTCACCTGGGTCGGGG - Intronic
1175216664 20:57394890-57394912 AGGCCTTCCCACGTGCGTCTGGG + Intronic
1176581929 21:8538303-8538325 AGGCTTTATCACATTGGTCGTGG + Intergenic
1180264766 22:10515363-10515385 AGGCTTTATCACATTGGTCGTGG + Intergenic
1182051778 22:27317770-27317792 AGGCCCTCTCACCTGGGCAGGGG + Intergenic
1182282427 22:29225205-29225227 CAGCCTTCTCAGGTGGGTCCTGG + Exonic
1182441292 22:30365834-30365856 AGGCCTTGTCACCTGGGGCTGGG + Intronic
1184405890 22:44300602-44300624 AGGGCTTCTCCCGAGGGTCCTGG + Intronic
954636809 3:52075364-52075386 AAGCCCTCTCAAGTGGGTGGTGG - Exonic
961355028 3:126332237-126332259 CTGCCTTCTCAAGTGGGTCCCGG + Intergenic
968299014 3:197599303-197599325 GTGCCTTCCCACGTGGGGCGAGG - Intergenic
968447571 4:659909-659931 AGGCCTACTCACAAGGCTCGTGG - Intronic
1002924790 6:1599152-1599174 AGGCCTCCGCAGGTGGGTCCCGG - Intergenic
1011124714 6:83994854-83994876 AGCTCTTCTCACATGGGTCTGGG + Intergenic
1014387010 6:120815672-120815694 CTGCCTTCTCAAGTGGGTCGTGG - Intergenic
1016779066 6:147938574-147938596 AGGCCTTCCCTTGTGGGTAGTGG - Intergenic
1033333346 7:140433060-140433082 AGGCCTTGTCACCTGGGAAGAGG + Intergenic
1041633758 8:60118853-60118875 AGGCCATATCATGTGGGTCATGG + Intergenic
1056538076 9:87548277-87548299 AGGCCTTCTGACTTTGGTCCTGG - Intronic
1062584961 9:137245078-137245100 AGGCCATCTCAGGTGGGTGTGGG - Exonic
1203611946 Un_KI270749v1:16341-16363 AGGCTTTATCACATTGGTCGTGG + Intergenic
1190060270 X:47206369-47206391 TGGACTTCTCAGGTGGGTCCTGG - Exonic