ID: 1082086859

View in Genome Browser
Species Human (GRCh38)
Location 11:48057543-48057565
Sequence CTGCCTCGACCCACGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 70}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086859_1082086867 21 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086867 11:48057587-48057609 GTAGCCCCCATAATACTTCTAGG 0: 1
1: 0
2: 0
3: 7
4: 66
1082086859_1082086866 -1 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086859_1082086868 24 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086868 11:48057590-48057612 GCCCCCATAATACTTCTAGGTGG 0: 1
1: 0
2: 0
3: 5
4: 68
1082086859_1082086865 -7 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086865 11:48057559-48057581 GAGGCAGGTGGTGGAGGTGGTGG 0: 1
1: 2
2: 51
3: 461
4: 3450
1082086859_1082086864 -10 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086859 Original CRISPR CTGCCTCGACCCACGTGAGA AGG (reversed) Intronic
900826455 1:4931006-4931028 CTGCCTTCACCCACATGGGAGGG - Intergenic
901292634 1:8136042-8136064 CTGCTTCCACCCTGGTGAGAGGG - Intergenic
907186579 1:52614244-52614266 CTGCCTGGAGCCACATGATAAGG + Intergenic
912793436 1:112675095-112675117 CTGCCACGACCCCCGCGCGAGGG + Intronic
917269414 1:173257081-173257103 GTGCCTTCTCCCACGTGAGAGGG - Intergenic
1063469296 10:6271758-6271780 CACCCTCCACCCACGGGAGAAGG - Intergenic
1066460344 10:35607843-35607865 CTGCCCCGACCCCCGGGAGCCGG + Exonic
1070804629 10:79263909-79263931 CTGCCTACACCCACCTGGGAAGG + Intronic
1074201599 10:111241264-111241286 TTGCCTCCAACCACATGAGAAGG - Intergenic
1074396261 10:113100455-113100477 CTGCAAACACCCACGTGAGAAGG + Intronic
1074753720 10:116609689-116609711 CCGCCTCGACCCAGGGGAGCAGG - Intergenic
1076454218 10:130578287-130578309 CTGCCAGGAGCCAAGTGAGAGGG - Intergenic
1076619882 10:131780255-131780277 CAGCCTTGACCCAGGCGAGATGG - Intergenic
1077425778 11:2475837-2475859 CTGCCACCATCCACGTAAGATGG + Intronic
1077554823 11:3220842-3220864 CAGCCTCGTCACAGGTGAGAAGG - Intergenic
1081119344 11:39246371-39246393 CTGCCTCATCCCACGGCAGAAGG + Intergenic
1082086859 11:48057543-48057565 CTGCCTCGACCCACGTGAGAAGG - Intronic
1100773157 12:97945993-97946015 CTGCCTACACCCATGTCAGATGG - Intergenic
1104927497 12:132321337-132321359 CTGCCAGGACCCAGATGAGACGG - Intronic
1122838901 14:104445006-104445028 CTGCCTCCCTCCACGTCAGAGGG + Intergenic
1128868706 15:71136168-71136190 CTGGATCGTCCCACCTGAGATGG - Intronic
1132568206 16:632755-632777 CTGCCGCGACCGCTGTGAGAAGG + Exonic
1133050098 16:3112669-3112691 CTGCCTCCACCCCGGTGAGAAGG + Exonic
1135529217 16:23238345-23238367 CTGCCATCACCCATGTGAGAAGG - Intergenic
1136450501 16:30351952-30351974 CTCCCTTGCCCCACGTTAGATGG - Exonic
1142220903 16:88854471-88854493 CTGCCTGGACCCAGCAGAGAGGG - Intronic
1142257938 16:89024281-89024303 CTGCCTGGACCCTGGTGAGCTGG - Intergenic
1144947749 17:18978414-18978436 CTGGCTCCACCCACGTGGGCAGG + Exonic
1152023997 17:77796938-77796960 TTGCCTCGTCCCCAGTGAGATGG - Intergenic
1152703659 17:81832333-81832355 CTGCCACCACCCAGGGGAGAGGG - Intronic
1152804887 17:82350931-82350953 CTGCCGCCACCCCGGTGAGATGG - Intergenic
1163631981 19:18422202-18422224 CAGCCTGGACCCAAGTAAGAAGG + Intronic
1164578587 19:29420494-29420516 GTGCCTGCACCCACTTGAGAGGG - Intergenic
1164589118 19:29496417-29496439 CTGCCTGGACCCATGAGTGATGG - Intergenic
1165244925 19:34493354-34493376 CAGACTCCACCCACGTCAGAGGG - Intronic
1168097921 19:54125958-54125980 GTGCCTGGACCGATGTGAGATGG - Intronic
931651641 2:64473786-64473808 CACCCTCTACCCACCTGAGAGGG - Intergenic
932152809 2:69387923-69387945 CTCCCATGACCCACCTGAGACGG + Intergenic
932201346 2:69830480-69830502 CTGCGGCTACCCACTTGAGAGGG - Intronic
947750652 2:232530261-232530283 CTGCCTGGATCCAGGTGTGAGGG + Intronic
1179410153 21:41156316-41156338 CAGCCTCCACCCACCTGAAAGGG + Intergenic
1181762311 22:25067033-25067055 CTGCCTCGGCCCACGGGTCAGGG + Intronic
1184269665 22:43372041-43372063 CTGCGACCATCCACGTGAGATGG - Intergenic
950195943 3:11009353-11009375 CTGCCTCAACGTACCTGAGAGGG - Intronic
952964736 3:38614148-38614170 CTGCCCCCACCCCCGTGGGAGGG - Intronic
953668010 3:44939969-44939991 GTGCCTCCAGCCACGTGGGATGG - Intronic
956737035 3:72245877-72245899 CTGCCTGGTCCCACCTGTGAAGG - Intergenic
956885516 3:73555259-73555281 CTTCCTCGTCCCAAGTGACATGG - Intronic
967889650 3:194356151-194356173 CCGCCTCTACCCACTTGTGATGG - Intronic
968767332 4:2479573-2479595 CTGCCGCCATCCACGTAAGACGG + Intronic
969059431 4:4423321-4423343 CTGCCTCTGCACACGTGTGATGG - Intronic
972396643 4:38664073-38664095 CTGCCTCCACCCAAGTGGGTGGG + Intergenic
981517841 4:145629732-145629754 CTGCCGCCATCCACGTAAGATGG - Intronic
981917170 4:150047097-150047119 CTGCCTCGAACTAGGTCAGAGGG - Intergenic
983007102 4:162496599-162496621 CAGCCTCTTCCCACGTGAGAAGG + Intergenic
988708120 5:33745263-33745285 CTGCCTCCACCCAAGGCAGATGG + Intronic
999226182 5:150026815-150026837 CTGCCTCGCCCCACGTTAACTGG - Exonic
1013932513 6:115551006-115551028 CTTCCTCCACCCCCGTGACAGGG - Intergenic
1014387009 6:120815669-120815691 GTTCCACGACCCACTTGAGAAGG + Intergenic
1017278692 6:152600245-152600267 TTGCCATGACCCAGGTGAGAAGG + Intronic
1018428085 6:163701102-163701124 CTTCCTCCACCCTCCTGAGAGGG + Intergenic
1021153656 7:17182411-17182433 TTGCCTCCACCCACCTCAGATGG + Intergenic
1024813982 7:53245920-53245942 CTGCTTCCACCCACGGCAGAAGG - Intergenic
1028994544 7:97085795-97085817 CTGCCTCAATCCACATGAGATGG + Intergenic
1035395991 7:158534923-158534945 CTGCCTCGAGCCTCGTCAGCAGG + Intronic
1041633759 8:60118856-60118878 CTGCCATGACCCACATGATATGG - Intergenic
1044356239 8:91225467-91225489 CTGGCAAGACCCACGAGAGAAGG - Intronic
1053528999 9:38859689-38859711 CTGCTTCAAGCCAGGTGAGAGGG - Intergenic
1054201227 9:62084124-62084146 CTGCTTCAAGCCAGGTGAGAGGG - Intergenic
1054637132 9:67504240-67504262 CTGCTTCAAGCCAGGTGAGAGGG + Intergenic
1056643162 9:88388253-88388275 CTGCCGCCAGCCAGGTGAGAGGG + Intergenic
1057278992 9:93697212-93697234 CTGCCCCCACCCACCCGAGACGG - Intergenic
1192450204 X:71240043-71240065 CAGCCTCAACCCAAGTCAGAAGG + Exonic
1201502370 Y:14659190-14659212 CTGCCTCAAACCACCTCAGAGGG + Intronic