ID: 1082086860

View in Genome Browser
Species Human (GRCh38)
Location 11:48057544-48057566
Sequence CTTCTCACGTGGGTCGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086853_1082086860 -5 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1082086851_1082086860 9 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68
1082086848_1082086860 14 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG 0: 1
1: 0
2: 0
3: 4
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086860 Original CRISPR CTTCTCACGTGGGTCGAGGC AGG Intronic
1063469297 10:6271759-6271781 CTTCTCCCGTGGGTGGAGGGTGG + Intergenic
1068233104 10:54196812-54196834 GTTCTCACGTGGTGGGAGGCGGG - Intronic
1075787968 10:125062749-125062771 CTACTCAGGAGGGTTGAGGCAGG + Intronic
1076336557 10:129710406-129710428 CTTCTCTCGAGGGTAGGGGCTGG + Intronic
1082086860 11:48057544-48057566 CTTCTCACGTGGGTCGAGGCAGG + Intronic
1083315273 11:61811065-61811087 CTTCTCACCTAGGCCCAGGCTGG - Exonic
1084785975 11:71441856-71441878 CCTCTCACGTGGGTGCAGACTGG - Intronic
1094082158 12:26548721-26548743 CTGCTCCCTTGGGTGGAGGCAGG - Intronic
1095249188 12:39958658-39958680 CTTCTCAGGTGGGCTGGGGCAGG - Intronic
1102052320 12:109871809-109871831 CTTTTCACGTGGATATAGGCTGG + Intronic
1105437438 13:20390780-20390802 CTTCTCGCGTGGGCCGTGCCTGG - Intergenic
1113397807 13:109964927-109964949 CATCTTACGTGGGTGGTGGCAGG - Intergenic
1120229092 14:81823294-81823316 CATCTTACGTGGATGGAGGCAGG + Intergenic
1127101621 15:55571597-55571619 CATCTCACGTGGATGGTGGCAGG - Intronic
1128336756 15:66791495-66791517 CTACTCAGGAGGGTGGAGGCAGG + Intergenic
1128337309 15:66795417-66795439 CTACTCAGGAGGGTGGAGGCAGG - Intergenic
1129801706 15:78419875-78419897 CTACTCAAGTAGGTTGAGGCAGG - Intergenic
1130225814 15:82057716-82057738 CTCCCCACGTGGGTTTAGGCAGG + Intergenic
1131784375 15:95896068-95896090 AATCTCACGTGGGTCAAGGTTGG + Intergenic
1132481006 16:166082-166104 CTGCTCAGGTCGGTAGAGGCGGG + Exonic
1134061347 16:11201451-11201473 CTGCTCTCGTGGGGTGAGGCTGG + Intergenic
1139528350 16:67529681-67529703 GTTCTAACGTGTGTCCAGGCTGG + Exonic
1140038649 16:71390500-71390522 ATTCTCACGTGGATGGAGGAGGG + Intergenic
1140971782 16:80020424-80020446 CTTCTGATGAGGGTGGAGGCTGG - Intergenic
1144674943 17:17156020-17156042 CTTATCACGGGGGTCCAGGATGG + Intronic
1147928402 17:43960430-43960452 CTACTCAGGTGGGCCGAGGCAGG + Intronic
1149114569 17:53076901-53076923 TTTCTCACTTGGGTGGAGGGTGG + Intergenic
1150003261 17:61455026-61455048 GTTCGCACGTGGCCCGAGGCGGG + Intronic
1150063934 17:62092651-62092673 CTACTCAGGGGGGCCGAGGCAGG + Intergenic
1151748073 17:76022227-76022249 TTTCTCCCCTTGGTCGAGGCAGG - Exonic
1160911913 19:1478568-1478590 CTTCTGACAGGGGTGGAGGCCGG - Intronic
1161799953 19:6412061-6412083 CTTCCCACGTGAGCCAAGGCTGG - Intergenic
1161813080 19:6481832-6481854 TTTCTCACGGGGGTGGGGGCAGG - Intronic
1163686393 19:18714246-18714268 CTTCCCCAGTGGGTCCAGGCGGG + Intronic
926227888 2:10981338-10981360 CTTCTCAGGTGGGCAGAAGCTGG - Intergenic
933804439 2:85987897-85987919 CTTCTCAAGTAGATTGAGGCTGG - Intergenic
938860655 2:135364636-135364658 CTACTCAGGGGGGTTGAGGCAGG + Intronic
946370557 2:219279200-219279222 CTTCTCGCTTGGATGGAGGCGGG + Intergenic
1169144957 20:3246403-3246425 CTACTCGCGGGGGCCGAGGCAGG - Intergenic
1175084219 20:56445343-56445365 CTTGTCACCTGGGCTGAGGCAGG - Intronic
1177972886 21:27812141-27812163 CATCTTACGTGGATGGAGGCAGG + Intergenic
1179416255 21:41200846-41200868 CTTCTCACGGTTGTGGAGGCCGG - Intronic
1182477675 22:30584978-30585000 ATCCGCACGTGGGTCAAGGCTGG - Intronic
1183712244 22:39512012-39512034 CTTCTCACCTGTGTCGAAGGTGG - Exonic
956737036 3:72245878-72245900 CTTCACAGGTGGGACCAGGCAGG + Intergenic
964639573 3:158894238-158894260 CTTCTTACGTGGATGGTGGCAGG + Intergenic
971670372 4:29547616-29547638 CATCTTACGTGGATCGTGGCAGG + Intergenic
990000316 5:50884644-50884666 CTTCTTACGTGGTTGCAGGCAGG - Intergenic
994606937 5:101979682-101979704 CATCTTACGTGGGTGGCGGCAGG - Intergenic
996241085 5:121202729-121202751 CTTCTCACATTGCTGGAGGCTGG - Intergenic
997892083 5:137686265-137686287 CTTCACAGTTGGGTCCAGGCAGG - Intronic
1004113003 6:12738750-12738772 CTACTCAAGTGGGCTGAGGCAGG + Intronic
1007105317 6:39279722-39279744 CTACTCCAGTGGGGCGAGGCGGG - Intergenic
1008142778 6:47851291-47851313 CTTCTGACATGGGTGGAGCCTGG + Intergenic
1011665627 6:89630128-89630150 CTTCTCAGGTAGATTGAGGCGGG + Intronic
1019737090 7:2656014-2656036 CTTCCCAGATGGGGCGAGGCTGG + Intronic
1021902030 7:25295240-25295262 CTTTTCATGTGGGTCAAAGCAGG + Intergenic
1034077202 7:148243542-148243564 CATCTTACGTGGATGGAGGCAGG + Intronic
1035186460 7:157129928-157129950 CTACTCAGGTGGGCTGAGGCAGG - Intergenic
1035395990 7:158534922-158534944 CTGCTGACGAGGCTCGAGGCAGG - Intronic
1036027666 8:4928127-4928149 CGTCCCACGTGGGCAGAGGCTGG - Intronic
1040462447 8:47661965-47661987 CTGCTCAAGTGACTCGAGGCAGG - Intronic
1048769842 8:137883588-137883610 CTTCTTACATGGGTAGTGGCAGG - Intergenic
1057298073 9:93860934-93860956 CAACCCACGTGGGTCGAGCCTGG + Intergenic
1060029579 9:120202783-120202805 CTTCTCACGTGGGAGGCTGCTGG + Intergenic
1060846210 9:126839502-126839524 CTTCTCCCCGGGGTGGAGGCCGG + Intergenic
1060956564 9:127645119-127645141 CTTCTGAAGTGGGTCCAGCCAGG - Intronic
1061482094 9:130902400-130902422 CTTCTGCCGTGGGCCCAGGCTGG - Intergenic
1190060269 X:47206365-47206387 CTTCTCAGGTGGGTCCTGGCTGG - Exonic
1190441801 X:50482120-50482142 CTACTCAAGAGGGTTGAGGCAGG + Intergenic
1192450203 X:71240042-71240064 CTTCTGACTTGGGTTGAGGCTGG - Exonic
1193188157 X:78538197-78538219 CATCTTACGTGGATGGAGGCAGG + Intergenic
1201631790 Y:16077874-16077896 GTTCTCAGGTGTATCGAGGCTGG - Intergenic