ID: 1082086861

View in Genome Browser
Species Human (GRCh38)
Location 11:48057547-48057569
Sequence CTCACGTGGGTCGAGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 265}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086851_1082086861 12 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265
1082086853_1082086861 -2 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265
1082086848_1082086861 17 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG 0: 1
1: 0
2: 1
3: 14
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086861 Original CRISPR CTCACGTGGGTCGAGGCAGG TGG Intronic
900192893 1:1358892-1358914 CTCACGTGGGGGGAGGCCAGAGG - Intronic
900611741 1:3547172-3547194 CTCGGGTGGGCCGAGGCTGGAGG - Intronic
901448138 1:9320395-9320417 CACACGTGGGGCAGGGCAGGGGG - Intronic
901697185 1:11017142-11017164 CACATTGGGGTCGAGGCAGGAGG - Intronic
905083234 1:35344295-35344317 CTTAGGGAGGTCGAGGCAGGTGG - Intronic
907013716 1:50990521-50990543 CTCCGGGGGGCCGAGGCAGGTGG - Intergenic
907072414 1:51548631-51548653 CTGAGGGAGGTCGAGGCAGGAGG - Intergenic
907423441 1:54362952-54362974 CTCACGGGGGGCGGGGCAGAGGG + Intronic
915560753 1:156686096-156686118 CTCTGGGAGGTCGAGGCAGGCGG - Intergenic
916153071 1:161815432-161815454 CTTTGGTAGGTCGAGGCAGGAGG - Intronic
916602576 1:166307395-166307417 CTCACGTTGATAGAGGCAGTAGG - Intergenic
916956912 1:169847452-169847474 TTTACGTGGTTGGAGGCAGGAGG + Intronic
917483282 1:175431844-175431866 CTCACAGGGGTGGAGGCAGGGGG + Intronic
919724640 1:200873735-200873757 CGCACGTGGGTCGGGCCCGGAGG + Exonic
919815522 1:201436076-201436098 ATCATGTGGGTGGAGGGAGGAGG - Intergenic
919890855 1:201973184-201973206 CTCAAGGGGGCTGAGGCAGGAGG + Intergenic
920289791 1:204912451-204912473 CTCAGGGGGGCTGAGGCAGGTGG + Intronic
1063933667 10:11054956-11054978 CTCCAGGGGGCCGAGGCAGGTGG - Intronic
1064007696 10:11711656-11711678 CTTTCGGAGGTCGAGGCAGGAGG - Intergenic
1064426572 10:15234903-15234925 CTCTGGGGGGCCGAGGCAGGCGG - Intronic
1065450105 10:25848143-25848165 CGCACCTGGGTGGAGGAAGGTGG + Intergenic
1065582060 10:27181829-27181851 CTCTGGTAGGCCGAGGCAGGCGG + Intronic
1065844726 10:29735567-29735589 CTCCCGGGGGTGGAGGCCGGCGG - Intronic
1067699251 10:48556863-48556885 CACATGGGGGTAGAGGCAGGAGG - Intronic
1070071043 10:73090075-73090097 CTCTGGGGGGCCGAGGCAGGAGG - Intronic
1070297231 10:75172737-75172759 CTTTCGGAGGTCGAGGCAGGTGG - Intronic
1071749199 10:88455647-88455669 CTTTCGGAGGTCGAGGCAGGCGG - Intronic
1071882497 10:89914753-89914775 CTCACGTGGCTGTTGGCAGGAGG - Intergenic
1072190475 10:93073397-93073419 CACACGTGGGAGGAGGCAGCTGG + Intergenic
1072655191 10:97324988-97325010 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1073216021 10:101836717-101836739 CTCTGGGAGGTCGAGGCAGGTGG + Intronic
1073225176 10:101912149-101912171 CTTACGGAGGCCGAGGCAGGTGG + Intronic
1075109657 10:119567974-119567996 CTTACGGAGGCCGAGGCAGGTGG - Intergenic
1075670252 10:124259617-124259639 CTCACGTGGCTGTTGGCAGGAGG + Intergenic
1075697765 10:124448858-124448880 CGCACTTGGGCCCAGGCAGGCGG - Intronic
1076795925 10:132798502-132798524 CTGAGGTGGGCCGAGGCAGCTGG + Intergenic
1077438863 11:2558983-2559005 CTCACCTGGGTCTGAGCAGGAGG - Intronic
1079214583 11:18496845-18496867 CTTTGGTGGGTTGAGGCAGGTGG + Intronic
1079275437 11:19031817-19031839 CTGTCGTGGGTGGGGGCAGGGGG - Intergenic
1079862101 11:25686203-25686225 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1082086861 11:48057547-48057569 CTCACGTGGGTCGAGGCAGGTGG + Intronic
1083372893 11:62195694-62195716 CTCAGGAGGTTGGAGGCAGGAGG + Intergenic
1083393773 11:62374354-62374376 CTCTCTTGGGTCCAGGCAAGAGG - Intronic
1085265308 11:75234519-75234541 CTCAGGTGGCTGGAGGCAGGCGG + Intergenic
1085471817 11:76763380-76763402 CTCACCTGGGTCCGGGCTGGTGG - Intergenic
1086045545 11:82527282-82527304 CTCAGGTGGGGTGAGGCAGTTGG - Intergenic
1088258252 11:107921136-107921158 CTCTGGTGGGCCAAGGCAGGAGG - Intronic
1090202540 11:124866537-124866559 CTCGAGTGGGTCGAGGCAGAGGG - Intronic
1090342610 11:126038406-126038428 CTTAGGGGGGCCGAGGCAGGAGG + Intronic
1091354586 11:134926500-134926522 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091354689 11:134927472-134927494 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091354838 11:134928912-134928934 CTCACCAGTGTTGAGGCAGGTGG + Intergenic
1091543483 12:1483935-1483957 CTCAGGGAGGCCGAGGCAGGTGG - Intronic
1091674037 12:2475054-2475076 CTTTGGTGGGCCGAGGCAGGCGG + Intronic
1094460943 12:30696076-30696098 CTCACCTGGGAAGAGGCGGGAGG - Intergenic
1096248498 12:50011091-50011113 CTCTGGTGGGCCAAGGCAGGTGG + Intronic
1096324182 12:50643753-50643775 CTCAGGGAGGCCGAGGCAGGAGG + Intronic
1097859061 12:64499937-64499959 CTCAGGGAGGCCGAGGCAGGTGG - Intronic
1097873620 12:64623062-64623084 CTCAGGGAGGCCGAGGCAGGCGG - Intronic
1100021864 12:90078641-90078663 CCCACGTGGAGGGAGGCAGGAGG - Intergenic
1101025538 12:100600872-100600894 CTAAGGTGGGTCGAGGCAGGAGG - Intronic
1101152534 12:101896129-101896151 CTTTCGGAGGTCGAGGCAGGTGG - Intronic
1102843742 12:116155068-116155090 CTTACGGAGGTCAAGGCAGGTGG - Intronic
1103134223 12:118493707-118493729 CTTAAGGGGGTCAAGGCAGGAGG - Intergenic
1103382200 12:120502892-120502914 CTTACGTAGGCCGAGGCAGGTGG - Intergenic
1103637695 12:122321487-122321509 CTCACGGGGGCTGAGGCAGGTGG - Intronic
1104738385 12:131154089-131154111 CTGCCGTGGGGCCAGGCAGGAGG - Intergenic
1104857296 12:131908192-131908214 CTCGCGTGGGGCGAGGCGAGGGG - Intronic
1104870426 12:131991307-131991329 TGCACGTGGGTGGAGGCAGCAGG + Intronic
1105816146 13:24038154-24038176 CTTTCGGAGGTCGAGGCAGGCGG - Intronic
1107432924 13:40355962-40355984 CTCACGTGGCAGGAGGCAGAAGG - Intergenic
1109279072 13:60335118-60335140 CTCTGGGAGGTCGAGGCAGGAGG + Intergenic
1109305350 13:60634165-60634187 TTTGCGGGGGTCGAGGCAGGTGG + Intergenic
1110012660 13:70357298-70357320 CTTGTGTGGGCCGAGGCAGGAGG + Intergenic
1110986267 13:81973800-81973822 CTCCCTTGGGTGGAGGGAGGGGG - Intergenic
1116880310 14:50160900-50160922 CTCCAGAGGGTTGAGGCAGGAGG + Intronic
1117455733 14:55895060-55895082 CTCTCGTAGGCCGAGGCAGAAGG - Intergenic
1118349183 14:64961262-64961284 CTCCTGTGGGTTGTGGCAGGAGG + Intronic
1118873313 14:69761349-69761371 CTCTGGGGGGCCGAGGCAGGTGG + Intronic
1122838898 14:104445002-104445024 CTGACGTGGAGGGAGGCAGGTGG - Intergenic
1123042224 14:105495114-105495136 CTCTGGGAGGTCGAGGCAGGTGG - Intronic
1123107034 14:105846481-105846503 CAGACATGGGTGGAGGCAGGGGG - Intergenic
1123814246 15:23960781-23960803 CTTTGGGGGGTCGAGGCAGGTGG + Intergenic
1126553073 15:49953905-49953927 CTCCCTTGGCTGGAGGCAGGGGG + Intronic
1128336757 15:66791498-66791520 CTCAGGAGGGTGGAGGCAGGAGG + Intergenic
1128337308 15:66795414-66795436 CTCAGGAGGGTGGAGGCAGGAGG - Intergenic
1129596824 15:76971672-76971694 CTCAGGGGGGCTGAGGCAGGAGG - Intergenic
1130020690 15:80228869-80228891 CTTTCGGGGGCCGAGGCAGGTGG - Intergenic
1130177859 15:81593721-81593743 CTCATGTGGGTAGGGGTAGGAGG + Intergenic
1131703583 15:94968249-94968271 TTCACGGGGGCGGAGGCAGGGGG - Intergenic
1132598604 16:764150-764172 CTCAGTTGGGCTGAGGCAGGTGG + Intronic
1133050096 16:3112665-3112687 CTCACCGGGGTGGAGGCAGAGGG - Exonic
1135272458 16:21081160-21081182 CTCTGGGGGGCCGAGGCAGGCGG - Intronic
1136670514 16:31852812-31852834 CTTACGTTGGTAGTGGCAGGAGG - Intergenic
1136988101 16:35131331-35131353 CTCAAGTGGGTGGTGGCATGAGG - Intergenic
1136989496 16:35143398-35143420 CTCTGGGGGGCCGAGGCAGGCGG - Intergenic
1140315948 16:73896965-73896987 CTCAGGGAGGTCAAGGCAGGAGG + Intergenic
1141312434 16:82927468-82927490 CTCACGTGAGTAGAGGCTGCGGG + Intronic
1141822021 16:86452995-86453017 CTCACATGGCTGGAGCCAGGTGG - Intergenic
1142489640 17:269989-270011 CACACATGGGTGGTGGCAGGAGG - Intronic
1143658215 17:8309827-8309849 CTTAGGGGGGCCGAGGCAGGCGG - Intergenic
1144580357 17:16455623-16455645 CTTAGGGAGGTCGAGGCAGGTGG - Intronic
1144724141 17:17493118-17493140 CTCACGGGGGTGGAGGGAGCCGG + Exonic
1145177724 17:20715941-20715963 CTTAGGTGGGCAGAGGCAGGAGG - Intergenic
1146038935 17:29433001-29433023 CTTACGAAGGCCGAGGCAGGAGG - Intronic
1147117474 17:38312287-38312309 CTTACGGAGGCCGAGGCAGGCGG - Intronic
1147711525 17:42469883-42469905 CTCTCCTGGGCCGAGGCGGGTGG - Intronic
1149825274 17:59822566-59822588 CTTTGGTGGGCCGAGGCAGGTGG - Intronic
1149837433 17:59925887-59925909 CTTAGGTGGGCAGAGGCAGGAGG - Intronic
1149898517 17:60450668-60450690 CTCAGGTGGGCTGAGGCAGAAGG + Intronic
1149922190 17:60670303-60670325 CGCACCTGGGCTGAGGCAGGAGG + Intergenic
1150735937 17:67739591-67739613 CTCACCTGGTTCAAGGTAGGTGG - Exonic
1150860399 17:68795517-68795539 ATCACCTGGGTGCAGGCAGGTGG + Intergenic
1152240850 17:79160215-79160237 CAGACGTGGGGCGATGCAGGTGG + Intronic
1154135078 18:11770429-11770451 CTCACATGGGTGGTGGCAGTAGG - Intronic
1157012365 18:43666251-43666273 CTTTGGTAGGTCGAGGCAGGCGG + Intergenic
1157955775 18:52095983-52096005 CTTAGGGAGGTCGAGGCAGGTGG + Intergenic
1158095186 18:53762267-53762289 CTTTCGGGGGCCGAGGCAGGCGG - Intergenic
1158519343 18:58158155-58158177 CTCACATGGCTGGAGGCAAGAGG + Intronic
1158890136 18:61864780-61864802 CTCACGCCTGCCGAGGCAGGTGG + Intronic
1158951791 18:62502009-62502031 CTCTGGGAGGTCGAGGCAGGCGG + Intergenic
1160667993 19:342255-342277 TCCATGTGGGTGGAGGCAGGTGG - Intronic
1160910218 19:1470623-1470645 CGCAGGTGGGGCGAGGCTGGGGG + Exonic
1160955738 19:1691003-1691025 CTGACGAGGGGCGGGGCAGGTGG - Intergenic
1162035212 19:7934737-7934759 CTCCCGAGGGTAGAGGCGGGAGG - Intronic
1162703911 19:12541140-12541162 CTCAAGAGGCTCGAGGGAGGAGG + Intronic
1164221157 19:23195221-23195243 CTCACGCCAGCCGAGGCAGGCGG - Intergenic
1165885543 19:39075740-39075762 CTTTGGTAGGTCGAGGCAGGAGG - Intergenic
1165935018 19:39383855-39383877 CTCCCTTGGGGAGAGGCAGGTGG - Exonic
1166628175 19:44380144-44380166 CTCTGGGGGGTCGAGGCGGGCGG + Intronic
1166710374 19:44933219-44933241 CTTTCGGAGGTCGAGGCAGGAGG + Intergenic
1168037339 19:53730477-53730499 CTTACGTAGGCCAAGGCAGGAGG - Intergenic
1168093713 19:54102532-54102554 CTTAGGTGGGTCGCAGCAGGAGG + Intronic
1168314401 19:55478107-55478129 GTCCAGTGGGTCGAGGCCGGGGG + Intronic
1168636660 19:58002391-58002413 CTCACCTGGCTCGCGGCCGGCGG + Exonic
925466878 2:4113781-4113803 CTCACGTGGGCTGGGACAGGTGG + Intergenic
925926791 2:8676713-8676735 CGCACGTGGTGCGAGGCAGGCGG + Intergenic
926095171 2:10076708-10076730 CTAACGTGGGACGAGGCCAGGGG - Intronic
926714005 2:15909500-15909522 CTCTGGGGGGCCGAGGCAGGTGG + Intergenic
927412685 2:22844958-22844980 CTTTCGGGGGTCGAGGCAGGTGG + Intergenic
929200556 2:39230964-39230986 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
929759646 2:44796504-44796526 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
930743547 2:54858154-54858176 CTCATGTGGCTCTTGGCAGGAGG + Intronic
932152807 2:69387919-69387941 CTCAGGTGGGTCATGGGAGGAGG - Intergenic
937190997 2:120098454-120098476 CTCTCAGGGGCCGAGGCAGGAGG - Intronic
940828842 2:158444672-158444694 CTCAGGAGGGCTGAGGCAGGAGG + Intronic
941672910 2:168314272-168314294 CTCATGTGGCTCTAGGCAGGAGG + Intergenic
943811568 2:192194971-192194993 GTCACGTGGGAAGAGGCAGTCGG + Exonic
945910511 2:215643730-215643752 CTCTGGGAGGTCGAGGCAGGTGG - Intergenic
945919648 2:215742762-215742784 CCCACTTGGGTCAAGGCAGAAGG - Intergenic
946005188 2:216519011-216519033 CTCAGGAGGGCTGAGGCAGGAGG - Intronic
947416704 2:229903925-229903947 CTCAGGAGGGCTGAGGCAGGAGG + Intronic
947611781 2:231529214-231529236 AACACTTTGGTCGAGGCAGGCGG + Intronic
947751797 2:232536465-232536487 CTCACGTGGCTGTTGGCAGGAGG - Intronic
948128661 2:235583947-235583969 CTCTGGGGGGCCGAGGCAGGAGG - Intronic
948884013 2:240874114-240874136 CTCAGGTGGCCCGAGGCGGGAGG + Intronic
1169325948 20:4676709-4676731 CTCACATGGCACGAGGCAGAAGG + Intergenic
1169348245 20:4846946-4846968 CTCACATGGAGCAAGGCAGGAGG + Intergenic
1170653438 20:18264015-18264037 CTCACATGGCTCTTGGCAGGAGG - Intergenic
1170891235 20:20377563-20377585 CTTCAGGGGGTCGAGGCAGGTGG - Intergenic
1172067223 20:32230142-32230164 CTCAGGGAGGCCGAGGCAGGCGG + Intronic
1174171996 20:48623572-48623594 ATCACCTGGGCCCAGGCAGGTGG + Intergenic
1174640739 20:52041831-52041853 CTTAGGGAGGTCGAGGCAGGAGG + Intergenic
1176721787 21:10399483-10399505 CTTTCGGAGGTCGAGGCAGGAGG - Intergenic
1177869541 21:26554604-26554626 CTCTCCTGGGGAGAGGCAGGTGG + Intronic
1177922860 21:27174686-27174708 CTTTCGGAGGTCGAGGCAGGAGG - Intergenic
1178494671 21:33076589-33076611 CTCACCTGGGGGCAGGCAGGTGG + Intergenic
1179633609 21:42693531-42693553 CTCTGGGGGGCCGAGGCAGGTGG - Intronic
1180302973 22:11052260-11052282 CTTTCGGAGGTCGAGGCAGGAGG - Intergenic
1180681545 22:17630519-17630541 CTCTCGGAGGCCGAGGCAGGTGG - Intronic
1180761149 22:18208924-18208946 CTCTGGGAGGTCGAGGCAGGTGG - Intergenic
1180774518 22:18415695-18415717 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1180803201 22:18643341-18643363 CTTTCGGGGGCCGAGGCAGGTGG + Intergenic
1180807671 22:18726512-18726534 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1181070630 22:20334703-20334725 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1181193615 22:21162645-21162667 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1181215828 22:21329953-21329975 CTCTGGGAGGTCGAGGCAGGTGG - Intergenic
1181378351 22:22478787-22478809 CTCACTTGGGTATTGGCAGGAGG - Intergenic
1182138983 22:27935537-27935559 CTCTGGGGGGCCGAGGCAGGTGG + Intergenic
1182205449 22:28620106-28620128 CTCTGGGAGGTCGAGGCAGGTGG + Intronic
1182465209 22:30511427-30511449 CTCTGGGGGGCCGAGGCAGGCGG + Intergenic
1184325611 22:43781570-43781592 CTTCCGGAGGTCGAGGCAGGAGG - Intronic
1184761374 22:46546741-46546763 CTCATGAGGGAGGAGGCAGGGGG - Intergenic
953341528 3:42138641-42138663 CTCCCGGGGGCTGAGGCAGGAGG + Intronic
953762053 3:45696238-45696260 CTCAGGGAGGACGAGGCAGGCGG - Intronic
953772412 3:45788052-45788074 CTCACGGGGGCTGAGGCAGCAGG - Intronic
954172534 3:48816395-48816417 CTAACTGGGGCCGAGGCAGGCGG + Intronic
954267315 3:49479881-49479903 CTCTGGGGGGCCGAGGCAGGTGG - Intronic
960528177 3:118734098-118734120 CTCAGGGGGGCTGAGGCAGGAGG - Intergenic
960618468 3:119617497-119617519 CTCTCGGAGGTTGAGGCAGGTGG + Intronic
960965159 3:123099579-123099601 CTCAGGTGGAGTGAGGCAGGAGG + Intronic
961672511 3:128544026-128544048 CTCTGGGGGGCCGAGGCAGGTGG - Intergenic
961861662 3:129921255-129921277 CTCTCGGAGGCCGAGGCAGGAGG + Intergenic
963825883 3:149952840-149952862 CTCTGGGAGGTCGAGGCAGGTGG - Intronic
965703593 3:171483521-171483543 GTCAGGTGGGCTGAGGCAGGTGG - Intergenic
967932506 3:194700557-194700579 CTCAGGGGGGCCGTGGCAGGGGG - Intergenic
968425691 4:521834-521856 CTCTCGTGGCTGGCGGCAGGTGG + Exonic
968633169 4:1662949-1662971 CTCTGGGGGGCCGAGGCAGGCGG + Intronic
970443020 4:16100369-16100391 CTTTGGTAGGTCGAGGCAGGTGG + Intergenic
971099253 4:23444911-23444933 CTCATGTGGGCTGAGGCAAGAGG + Intergenic
972979517 4:44678630-44678652 CCCTCGTGGGTCGGGGCTGGGGG + Exonic
975444303 4:74445043-74445065 CGGCCGTGGGTGGAGGCAGGCGG - Intergenic
980232812 4:130065772-130065794 CTTAGGGAGGTCGAGGCAGGTGG + Intergenic
982791366 4:159595331-159595353 TTCACCTGGGTGCAGGCAGGCGG - Intergenic
982940529 4:161547146-161547168 CTCACGTGGCTATTGGCAGGAGG - Intronic
983007101 4:162496595-162496617 CTCACGTGGGAAGAGGCTGTAGG - Intergenic
983725382 4:170916846-170916868 CTCATGTGGGTTGAGTCAGATGG + Intergenic
985018360 4:185661029-185661051 CTTAGGGAGGTCGAGGCAGGTGG + Intronic
987336176 5:16899752-16899774 CTCTGGGAGGTCGAGGCAGGTGG + Intronic
988708118 5:33745259-33745281 CTGCCTTGGGTGGAGGCAGGAGG - Intronic
989173859 5:38500986-38501008 CTCATGTGGCTAAAGGCAGGAGG - Intronic
992164357 5:74034568-74034590 GTCACTTGGGGCAAGGCAGGGGG - Intergenic
994698454 5:103102666-103102688 CTCTGGGAGGTCGAGGCAGGTGG + Intronic
995840787 5:116441485-116441507 CTCATTTGGGTCAAGGCATGGGG - Intergenic
996574498 5:124966748-124966770 TTCACCTGGGTGCAGGCAGGCGG + Intergenic
997524315 5:134542683-134542705 CTCTGGGGGGCCGAGGCAGGCGG - Intronic
997804653 5:136905217-136905239 CTCAGGGAGGTGGAGGCAGGAGG - Intergenic
999186715 5:149716099-149716121 CTCTGGGAGGTCGAGGCAGGTGG - Intergenic
1000362489 5:160460979-160461001 ATCTCGTGGGCTGAGGCAGGAGG - Intergenic
1001953372 5:175831452-175831474 CTCACCTGCGTCAGGGCAGGAGG - Intronic
1002066514 5:176654663-176654685 CTCTCTTGGGTCGGGGAAGGGGG + Intronic
1003116910 6:3289312-3289334 CAGCCGTGGGTGGAGGCAGGTGG - Intronic
1003750446 6:9049283-9049305 CTTTGGAGGGTCGAGGCAGGCGG - Intergenic
1004480847 6:16018035-16018057 CTTGGGTGGGGCGAGGCAGGTGG + Intergenic
1004982574 6:21042556-21042578 CTGACTTGAGTGGAGGCAGGTGG - Intronic
1005965888 6:30726291-30726313 CTCTGGGGGGCCGAGGCAGGAGG + Intergenic
1007260195 6:40558062-40558084 TTCACGTGCGTGGAGTCAGGAGG - Intronic
1007456291 6:41979877-41979899 CTCTAGGGGGCCGAGGCAGGGGG - Intronic
1013496747 6:110705281-110705303 CTTACGGAGGCCGAGGCAGGTGG - Intronic
1015167984 6:130220241-130220263 CTCTGGGGGGCCGAGGCAGGTGG - Intronic
1015499901 6:133921063-133921085 CTCTGGGAGGTCGAGGCAGGCGG + Intergenic
1015773780 6:136793216-136793238 CCCACGTTGCGCGAGGCAGGAGG + Intergenic
1015955926 6:138598055-138598077 CTCTCGGAGGCCGAGGCAGGAGG + Intronic
1017033988 6:150250849-150250871 CTCACGGGGATCAGGGCAGGAGG - Intergenic
1017592128 6:155989415-155989437 CTCAGGTGGGTTGGGGCAGGTGG - Intergenic
1019721003 7:2571124-2571146 CTCAAGGGGGCTGAGGCAGGAGG - Intronic
1021986577 7:26103059-26103081 CTCAGGGAGGGCGAGGCAGGTGG - Intergenic
1024181266 7:46897532-46897554 CCCACCTGGGTCTAGGCTGGAGG + Intergenic
1024961684 7:54982919-54982941 CTACCTTGGGTTGAGGCAGGGGG - Intergenic
1025152162 7:56566508-56566530 CTCTCGGAGGCCGAGGCAGGTGG + Intergenic
1026039838 7:66858970-66858992 CTTCAGTGGGTCGAGGCAGGTGG - Intergenic
1026844942 7:73693516-73693538 GTCACCAGGGTCCAGGCAGGCGG + Intronic
1026952967 7:74359921-74359943 CTCTTGTGGGTTGAGGCGGGAGG + Intronic
1027408132 7:77884651-77884673 CTCTGGTAGGCCGAGGCAGGTGG + Intronic
1027610588 7:80355361-80355383 CTTTGGAGGGTCGAGGCAGGAGG + Intergenic
1029584446 7:101461539-101461561 CTCTGGGAGGTCGAGGCAGGTGG - Intronic
1032342839 7:131091818-131091840 CTCAGGGAGGTTGAGGCAGGAGG - Intergenic
1033152258 7:138925574-138925596 CTCTGGTAGGCCGAGGCAGGAGG + Intronic
1036503041 8:9330838-9330860 GTCATGTGGGGTGAGGCAGGTGG - Intergenic
1036609167 8:10334883-10334905 ATCACGTGGGCCGAGGCAGCGGG - Intronic
1037832543 8:22197939-22197961 CTCAGGAAGGCCGAGGCAGGAGG + Intronic
1039396955 8:37234517-37234539 CTCTGGGAGGTCGAGGCAGGTGG + Intergenic
1040772700 8:50998191-50998213 CTCACATGGGTGGAGGAAGGTGG - Intergenic
1041503928 8:58573049-58573071 CTCTGGGAGGTCGAGGCAGGTGG - Intronic
1046328862 8:112686727-112686749 CTTACGGAGGCCGAGGCAGGTGG - Intronic
1046809281 8:118515333-118515355 CTTACGTGGCTGGAGCCAGGAGG - Intronic
1049396430 8:142403138-142403160 CTCACGGCGGGCGAGGCGGGCGG + Exonic
1049791512 8:144474654-144474676 CTCTCGTGGGGCCAGGAAGGGGG + Exonic
1051757869 9:20423852-20423874 CTCGCGAGGGGTGAGGCAGGAGG + Intronic
1052949049 9:34193200-34193222 CTCAGGGGGGCTGAGGCAGGAGG + Intronic
1054760901 9:69003132-69003154 CTAACGTGGGCAGAGGGAGGCGG + Intronic
1055544191 9:77349885-77349907 CTTTCGGAGGTCGAGGCAGGTGG - Intronic
1057135983 9:92688232-92688254 CTCAGGGAGGCCGAGGCAGGTGG - Intergenic
1057169412 9:92952140-92952162 CTCATGTGAGTCAATGCAGGGGG + Intronic
1057278996 9:93697216-93697238 CTCGGGTGGGTGGGGGCAGGGGG + Intergenic
1057292268 9:93814264-93814286 CTCAAGGGGGACGAGGAAGGTGG - Intergenic
1057826665 9:98377207-98377229 CTCAGATGGGTAGTGGCAGGAGG + Intronic
1060097880 9:120809520-120809542 CTCAGGGAGGCCGAGGCAGGAGG - Intergenic
1060633055 9:125177129-125177151 CTTTGGGGGGTCGAGGCAGGCGG + Intronic
1060956563 9:127645116-127645138 CTGAAGTGGGTCCAGCCAGGAGG - Intronic
1061116286 9:128614683-128614705 TTCACTTGAGTCCAGGCAGGAGG + Intronic
1061559240 9:131392338-131392360 CTTTGGTAGGTCGAGGCAGGTGG - Intergenic
1062468720 9:136692747-136692769 CTCCTGTGGGCAGAGGCAGGCGG + Intergenic
1062682224 9:137788077-137788099 CTCTCGTGGGGCCAGGAAGGGGG + Intronic
1185544911 X:935699-935721 CTCTGGGGGGCCGAGGCAGGTGG + Intergenic
1185635397 X:1548296-1548318 CTTTCGGAGGTCGAGGCAGGTGG + Intergenic
1195716150 X:107820224-107820246 CTCACATGGTTGGAAGCAGGAGG - Intergenic
1197833647 X:130672264-130672286 CTCAGGTGGGTGCAGGCAGAAGG - Intronic
1199986544 X:152956493-152956515 CTCTCGGAGGCCGAGGCAGGCGG + Intronic
1200057428 X:153469005-153469027 CTCACGAGGGTCCAGGCTAGGGG + Intronic
1200246567 X:154529716-154529738 CCTACTTGGGTGGAGGCAGGAGG - Intergenic