ID: 1082086862

View in Genome Browser
Species Human (GRCh38)
Location 11:48057550-48057572
Sequence ACGTGGGTCGAGGCAGGTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 205}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086848_1082086862 20 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086853_1082086862 1 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086851_1082086862 15 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086857_1082086862 -9 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205
1082086856_1082086862 -8 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG 0: 1
1: 0
2: 0
3: 6
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086862 Original CRISPR ACGTGGGTCGAGGCAGGTGG TGG Intronic
900352213 1:2240489-2240511 CCGTGGGTGGTGGCGGGTGGTGG + Intronic
900633258 1:3649831-3649853 GCGTGGGTGGAGGCAGCTTGGGG - Intronic
900725860 1:4216056-4216078 AGGTGTGGAGAGGCAGGTGGAGG - Intergenic
901448137 1:9320392-9320414 ACGTGGGGCAGGGCAGGGGGAGG - Intronic
902179269 1:14675551-14675573 GAGTGGGGAGAGGCAGGTGGGGG - Intronic
902225407 1:14993617-14993639 ACGAGAGTCGAGGCAGCAGGGGG - Intronic
903212910 1:21828723-21828745 CCGTGGGTGGCTGCAGGTGGAGG + Intronic
903974202 1:27138517-27138539 ATGGGGGTAGAGGCAGCTGGTGG + Intronic
906726653 1:48049142-48049164 GTGTGGGTGGAGGCAGCTGGAGG - Intergenic
908672512 1:66563697-66563719 ACTTGGGTGGAGGGGGGTGGGGG - Intronic
909720877 1:78767831-78767853 AGGTGGGTGGAGGTAGCTGGAGG - Intergenic
912521686 1:110250157-110250179 ATGTGGGAGGAGGGAGGTGGGGG - Intronic
915837391 1:159188498-159188520 AGCTGGGGAGAGGCAGGTGGGGG - Intronic
922447163 1:225707282-225707304 ACCTGGCTCGAGGTAGGTGCTGG - Intergenic
923044869 1:230348373-230348395 ACGAGGGAAGAGGCAGGTTGAGG + Intronic
924199092 1:241640640-241640662 AGGTGGGTGCAGGGAGGTGGGGG - Intronic
924580928 1:245323869-245323891 CCGTGGGTGGATGGAGGTGGAGG + Intronic
924580954 1:245323942-245323964 ATGTGGGTGGTGGGAGGTGGAGG + Intronic
1062844132 10:690997-691019 AGGTGGGTCCCGGCTGGTGGGGG - Intergenic
1064997968 10:21313129-21313151 AGGTGGGTAGGGGGAGGTGGAGG - Intergenic
1066126334 10:32346595-32346617 CCGGGGGTCGAGGCTGGGGGAGG + Intronic
1072343865 10:94483121-94483143 ATGTGGTTCAAGGGAGGTGGAGG - Intronic
1072659788 10:97356770-97356792 ACGTGGCTACAGGCAGCTGGCGG + Exonic
1074853011 10:117453974-117453996 TCCTGGGTTGAGGCAGGTGGAGG - Intergenic
1076133592 10:128029821-128029843 AGGTGGGTGGAGGAAGCTGGCGG - Intronic
1076616181 10:131756453-131756475 CCCTGGCTCCAGGCAGGTGGTGG - Intergenic
1077130325 11:968775-968797 AAGTGGGTCGGGGCCGGGGGAGG + Intronic
1077500935 11:2909487-2909509 ACGTGGGGCGTGGCTTGTGGAGG + Intronic
1078079396 11:8193013-8193035 ACGTGGGTCTAGGTAGGGGTCGG + Intergenic
1078083075 11:8217908-8217930 AGGTGGGCCGAGGCAGGGAGAGG - Intergenic
1078083098 11:8217988-8218010 AGGTGGGCCGAGGCAGGGAGAGG - Intergenic
1078896914 11:15604939-15604961 AAGTGGGTGGAGGGAGGTGCTGG - Intergenic
1081715311 11:45245972-45245994 AGGTGGGTCCAGCCAGGTGTGGG + Intronic
1082086862 11:48057550-48057572 ACGTGGGTCGAGGCAGGTGGTGG + Intronic
1083266020 11:61547096-61547118 AGGTGGGTGGGGGCAGGAGGAGG + Intronic
1083369364 11:62166152-62166174 AAGTGACTCCAGGCAGGTGGCGG - Intergenic
1089385053 11:118061934-118061956 ACTTGGACCGAGGCAGTTGGTGG - Intergenic
1089744812 11:120609216-120609238 ATCTGGGTGCAGGCAGGTGGGGG + Intronic
1089809659 11:121121320-121121342 ATGTGGGTAGGGGCAGGGGGAGG - Intronic
1091357714 11:134950475-134950497 GTGTGGGGCCAGGCAGGTGGTGG + Intergenic
1091998912 12:5017380-5017402 AGGTGGATAGAGGCAGGTGTGGG + Intergenic
1092171428 12:6375950-6375972 GAGTGAGTAGAGGCAGGTGGGGG + Intronic
1092817205 12:12322821-12322843 ACCTGGGTCCGGGGAGGTGGAGG + Intergenic
1096475301 12:51905987-51906009 AGGTGGGGCGGGGCAGGAGGAGG + Intergenic
1096539384 12:52296453-52296475 ACATGGGGCGAGGGAGGTGCAGG + Intronic
1101111837 12:101494096-101494118 AAATGGGGCGAGGCGGGTGGTGG - Intergenic
1103340290 12:120217239-120217261 AGGTGGGTGGAGGCACGGGGAGG + Intronic
1103340305 12:120217281-120217303 AGGTGGGTAGAGGCAAGGGGAGG + Intronic
1103459968 12:121095949-121095971 GCGTGGGTCGTGACAGGTGAGGG + Intergenic
1104842397 12:131831349-131831371 GGGTGGGGCGGGGCAGGTGGGGG + Intronic
1113504751 13:110807706-110807728 ACCTAGGCCCAGGCAGGTGGGGG + Intergenic
1114568722 14:23650789-23650811 GAGTGTGTTGAGGCAGGTGGAGG + Intergenic
1121107939 14:91293203-91293225 AGGTGGGCCGTGGCAGGTGAGGG - Intronic
1121107968 14:91293291-91293313 AGGTGGGCCGTGGCAGGTGAGGG - Intronic
1121108005 14:91293409-91293431 AGGTGGGCCGTGGCAGGTGAGGG - Intronic
1121108037 14:91293523-91293545 AGGTGGGCCGTGGCAGGTGAGGG - Intronic
1121247897 14:92475991-92476013 ACGTGGGTGGGGCCAGATGGGGG + Intronic
1122764209 14:104054291-104054313 CAGTGGGTAGAGGCAGATGGTGG + Intergenic
1124641844 15:31400719-31400741 AGGAGGGTCGAGGGAGGGGGTGG + Intronic
1128084354 15:64875599-64875621 AGGTGGGGGGCGGCAGGTGGGGG + Intronic
1128945443 15:71817045-71817067 CAATGGGTCGAGGTAGGTGGAGG + Intronic
1129872882 15:78952312-78952334 AGGGAGGTAGAGGCAGGTGGCGG - Intergenic
1132117033 15:99145162-99145184 ACGTGGGTCCAGCCAGGATGAGG - Intronic
1133006356 16:2883668-2883690 CCGTGGGACGAGGCCGGCGGGGG - Intronic
1134257999 16:12627107-12627129 ACGTGGATCTAGGAGGGTGGAGG - Intergenic
1135960059 16:26987779-26987801 ACATGGGTCGTGGGAGGTTGAGG + Intergenic
1138489868 16:57370545-57370567 GTGAGGGTGGAGGCAGGTGGTGG + Intergenic
1138531175 16:57635199-57635221 CCATGGCTCTAGGCAGGTGGGGG - Intronic
1139400439 16:66677151-66677173 ACTTGGGACGAGGAAGGTTGAGG + Intronic
1142236300 16:88924140-88924162 CGGTGGGGCGGGGCAGGTGGTGG + Intronic
1142345383 16:89550608-89550630 AGGTGGGTCTTGGCAGGTGCCGG + Exonic
1142489639 17:269986-270008 ACATGGGTGGTGGCAGGAGGAGG - Intronic
1143401115 17:6643547-6643569 ACTTGGGATGAGGCAGGTGGCGG + Exonic
1143621643 17:8084329-8084351 ACATGAGCTGAGGCAGGTGGAGG - Intronic
1145043018 17:19590997-19591019 GCAGGGGTCGAAGCAGGTGGTGG - Intergenic
1145255894 17:21322129-21322151 AGGTGGGCCGAGGTGGGTGGGGG + Intergenic
1146058340 17:29592121-29592143 AGGCGGGCCGAGACAGGTGGCGG - Intronic
1146610374 17:34299617-34299639 ACCTTGGTCCAGGCAGGTAGGGG + Intergenic
1146923946 17:36731437-36731459 CTGTGGGTCTAGGCAGGTGTAGG - Intergenic
1147997346 17:44367871-44367893 ATGTGGCTGGAGGCAGGTGTGGG - Intergenic
1148219164 17:45850011-45850033 ACGGGGCTGGAGGCAGGTGATGG + Intergenic
1150003262 17:61455032-61455054 ACGTGGCCCGAGGCGGGTGCTGG + Intronic
1151495051 17:74453988-74454010 ACCTGGGTTGGGGGAGGTGGGGG + Intergenic
1152426280 17:80220377-80220399 ACCGGGGTCGGGGCAGGGGGCGG - Exonic
1152508974 17:80772438-80772460 AAGGGGGTCCAGGCATGTGGGGG - Intronic
1152508986 17:80772467-80772489 AAGGGGGTCCAGGCATGTGGAGG - Intronic
1152632464 17:81416712-81416734 AGGTGGGCGGAGGCAGGTGCAGG - Intronic
1152897685 17:82922745-82922767 ACTGGGGGCGGGGCAGGTGGGGG - Intronic
1152913087 17:83016641-83016663 AGGAGGGAGGAGGCAGGTGGAGG + Intronic
1157312055 18:46560058-46560080 AAGTGGGTCGTGGGGGGTGGGGG - Intronic
1157961219 18:52155356-52155378 ACGTGGGTGGGGGGAGATGGAGG - Intergenic
1160910219 19:1470626-1470648 AGGTGGGGCGAGGCTGGGGGAGG + Exonic
1162155151 19:8672966-8672988 ACAAGGGTGGAGGCTGGTGGGGG + Intergenic
1162373539 19:10292425-10292447 CCGAGGGGCGGGGCAGGTGGGGG + Intronic
1164534711 19:29076526-29076548 GCCTGGGTCGAGGCAGGGCGGGG - Intergenic
1167904187 19:52644772-52644794 TGGGAGGTCGAGGCAGGTGGAGG + Intronic
1168615031 19:57830519-57830541 ACGTGGTTCGATGGCGGTGGTGG + Exonic
925360459 2:3277217-3277239 GCGTGGGTGGAGACAGGTGCGGG - Intronic
925360467 2:3277243-3277265 GCGTGGGTGGAGACAGGTGTGGG - Intronic
928928013 2:36598015-36598037 GCGGGGGCCGAGGCGGGTGGGGG - Exonic
929101705 2:38321087-38321109 AGGTGGGTTGTGGGAGGTGGAGG + Intronic
932448315 2:71794076-71794098 GCATGGGAGGAGGCAGGTGGTGG + Intergenic
934954841 2:98608697-98608719 ACGTGGGTCGAGGCTGTAGCAGG + Exonic
936789815 2:116138378-116138400 TGGTAGGCCGAGGCAGGTGGGGG + Intergenic
938743176 2:134252154-134252176 AAGTGGTCTGAGGCAGGTGGTGG + Intronic
940454710 2:153882179-153882201 GGGGGGGTCGAGGCAGGGGGAGG + Intronic
945976315 2:216273885-216273907 TCATGGGTGGAGGCAGGAGGTGG + Intronic
948588467 2:239035526-239035548 GGGTGGGGCGGGGCAGGTGGGGG + Intergenic
1175799339 20:61792199-61792221 ACTTAGGGAGAGGCAGGTGGAGG + Intronic
1175822535 20:61918133-61918155 ATGTGGGTGCAGGCAGGTGCTGG + Intronic
1176298821 21:5088844-5088866 ACGGAGGCAGAGGCAGGTGGAGG - Intergenic
1176548559 21:8212131-8212153 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1176550735 21:8219724-8219746 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176550978 21:8221252-8221274 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176556453 21:8256339-8256361 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1176567490 21:8395166-8395188 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1176569777 21:8403519-8403541 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176569887 21:8404251-8404273 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176575392 21:8439381-8439403 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1176577577 21:8446994-8447016 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176577688 21:8447726-8447748 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1176577798 21:8448458-8448480 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1178416926 21:32412213-32412235 ACGTGGCGCGCGGCGGGTGGCGG + Intronic
1179474075 21:41632178-41632200 ACCTGGGAAGAGGCAGGGGGTGG + Intergenic
1179715094 21:43282329-43282351 AGCTGGGTCCAGACAGGTGGGGG - Intergenic
1179858205 21:44173105-44173127 ACGGAGGCAGAGGCAGGTGGAGG + Intergenic
1180737036 22:18024741-18024763 ACGTGTGTCGAGGAAGGGGTTGG - Intergenic
1182557692 22:31137992-31138014 ACCTGGGTGGTGGCAGTTGGTGG + Exonic
1182766211 22:32760073-32760095 ACGTGGGTGCTGGCTGGTGGTGG - Intronic
1184249882 22:43253951-43253973 GGGTGGCTGGAGGCAGGTGGAGG - Intronic
1184345547 22:43910450-43910472 ATGTGAGTCAAAGCAGGTGGTGG - Intergenic
1184362414 22:44026314-44026336 ACGGGCGTGGAGGCAGGAGGAGG + Intronic
1184466092 22:44669395-44669417 GAGTGGGTGGGGGCAGGTGGAGG + Intronic
1184792828 22:46710973-46710995 TCGTGGGTGGAGGCGGGGGGCGG + Intronic
1185076857 22:48687792-48687814 AGGTGGGTCGTGGTATGTGGGGG - Intronic
1185121881 22:48976373-48976395 TCCTGGGTTGAGGCACGTGGAGG - Intergenic
1185259576 22:49854013-49854035 ACGGGGCTCGCGGCAGGCGGCGG - Intronic
1203253443 22_KI270733v1_random:128436-128458 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1203255636 22_KI270733v1_random:136067-136089 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1203255986 22_KI270733v1_random:138219-138241 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1203261497 22_KI270733v1_random:173514-173536 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
949986638 3:9546394-9546416 AGGTGGGAGGAGGCAGGTAGAGG - Intronic
950989403 3:17416742-17416764 ATGTGGGTGGAGGCAGGGGAAGG - Intronic
952165110 3:30739364-30739386 AGGTGGGCACAGGCAGGTGGGGG - Intronic
954873738 3:53787158-53787180 GCGTGGGTAGTGGCAGGTGCAGG - Intronic
961520969 3:127467237-127467259 GCCTGGGTCGAGGCAGTGGGAGG - Intergenic
963810667 3:149773399-149773421 ATGAGGATCGAGGCAGGTGAGGG - Intronic
964790502 3:160449960-160449982 GCGCGGCCCGAGGCAGGTGGCGG + Intronic
967029421 3:185591812-185591834 ACCTGGGCCCAGGGAGGTGGAGG - Intronic
968450500 4:674013-674035 ACGGGGGTCGCGGGAGGAGGGGG + Intronic
968452737 4:682880-682902 ACGTGTGTCCAGGCAGGCCGAGG - Exonic
969316222 4:6382952-6382974 ACCTGGGCCTCGGCAGGTGGGGG - Intronic
969347856 4:6580489-6580511 ACGGGGCAGGAGGCAGGTGGGGG - Intronic
969415156 4:7053109-7053131 AGGCGGGCAGAGGCAGGTGGGGG + Intronic
969683035 4:8653640-8653662 ACTGGGGTCTGGGCAGGTGGTGG + Intergenic
969950481 4:10830413-10830435 ACCTGGGTGGACGTAGGTGGTGG - Intergenic
971351704 4:25862204-25862226 AGGAGGGTCGACGCGGGTGGCGG + Intronic
975666778 4:76741048-76741070 ACGTGGGCCGAGGAAGGCCGTGG - Exonic
977780975 4:100980688-100980710 ACCTGAGTCCAGGCAGGTTGAGG - Intergenic
979436385 4:120697591-120697613 ATGTGAGTCGAGGGAGGTCGAGG - Intronic
981061201 4:140427308-140427330 CCGTGGGTGGACGCAGGAGGTGG - Intronic
981390684 4:144187529-144187551 ACCTGGGTGGAGGCTGCTGGAGG - Intergenic
985525697 5:400382-400404 ACGGAGGTCGGGGCAGGTGAGGG - Intronic
985949220 5:3210639-3210661 AAGGGGGTCGAGGGTGGTGGGGG + Intergenic
985955637 5:3263437-3263459 ACCTGGGTCTAGGGAGGTCGAGG + Intergenic
988708116 5:33745256-33745278 CCTTGGGTGGAGGCAGGAGGAGG - Intronic
989137311 5:38167961-38167983 AACTGAGTCGAGGCGGGTGGGGG + Intergenic
992112882 5:73512633-73512655 TGGTGGGTCCAGACAGGTGGTGG + Intergenic
995047890 5:107671016-107671038 GCGCGGGTCGGGGCAGGCGGCGG + Intergenic
996828422 5:127712026-127712048 AGGTGGGGAGAGGCAGGTGGGGG - Intergenic
997661336 5:135591520-135591542 AGGTGGGTTGAGGCAGGGAGAGG - Intergenic
998264609 5:140658608-140658630 ACGTGGGTCAAGGCTGGGTGCGG - Intronic
1000010482 5:157226895-157226917 ACCTGGGTGGTGGCGGGTGGGGG - Intronic
1002298077 5:178242217-178242239 AGGTGGGCGGAGGCAGGGGGAGG - Intronic
1003996941 6:11551142-11551164 ATGTGGCTCTTGGCAGGTGGTGG + Intronic
1004982573 6:21042553-21042575 ACTTGAGTGGAGGCAGGTGGTGG - Intronic
1006596584 6:35197346-35197368 ACTTGGGAGGTGGCAGGTGGGGG - Intergenic
1007387177 6:41528016-41528038 ATGGGGGTGGAGGGAGGTGGAGG - Intergenic
1013356498 6:109350122-109350144 ATGAGGCACGAGGCAGGTGGGGG + Intergenic
1019620071 7:1987570-1987592 AGGGGGGGAGAGGCAGGTGGGGG + Intronic
1019812779 7:3176652-3176674 ACAGGGGATGAGGCAGGTGGGGG + Intergenic
1022577691 7:31514119-31514141 AGGTGGGTAGAGGCTGCTGGAGG + Intronic
1022581165 7:31556473-31556495 AGCTGGTTAGAGGCAGGTGGAGG + Intronic
1026509295 7:71015317-71015339 ACGAGGGTTGAGGAAGGTGAAGG + Intergenic
1026844943 7:73693519-73693541 ACCAGGGTCCAGGCAGGCGGAGG + Intronic
1029439599 7:100579691-100579713 ACGCGGGTGGAGCCAGGTTGTGG - Intronic
1036565242 8:9932820-9932842 ACGTGGGTGGTGGCATATGGAGG + Intergenic
1038319584 8:26514499-26514521 CCGGGGCTCGGGGCAGGTGGTGG + Intronic
1039513958 8:38115770-38115792 ACTTGGGTAGAGGCAGGAGAGGG - Intronic
1045568316 8:103343699-103343721 ATGTGGGACGAGGCAGGGAGAGG + Intergenic
1049200209 8:141336394-141336416 ACGTGGGCAGCGGCGGGTGGTGG + Intergenic
1049443327 8:142619019-142619041 ATATGGGTCCAGGCAGCTGGAGG + Intergenic
1049697305 8:143990508-143990530 GCGTGGGGCGAGGCGGGTAGGGG - Intronic
1051148710 9:14058051-14058073 ACGGGGGTGGAGGCAGGGGGAGG + Intergenic
1052694119 9:31854341-31854363 ACGTGCGTCAATGGAGGTGGTGG - Intergenic
1053346938 9:37384950-37384972 AGGTGGGTAGAGGCAGGAGTGGG + Intergenic
1053477940 9:38395686-38395708 AGGTGGGAGAAGGCAGGTGGCGG - Intronic
1055532037 9:77194183-77194205 GCGTGGGTGGATGCTGGTGGAGG + Intronic
1057292265 9:93814261-93814283 AAGGGGGACGAGGAAGGTGGGGG - Intergenic
1058991035 9:110255805-110255827 GCATGGGTGGAGGCAGGCGGGGG + Intronic
1060877248 9:127092226-127092248 ACGTGTGCTGTGGCAGGTGGAGG + Intronic
1061418707 9:130461847-130461869 ACGGGGGACGGGCCAGGTGGAGG + Intronic
1061508484 9:131046283-131046305 ACGTGAGCCCAGGGAGGTGGTGG - Intronic
1062623599 9:137433432-137433454 CCCTGGGTCCAGGCAGGAGGGGG - Exonic
1203774144 EBV:63376-63398 GCCCGGGTCGAGGCAGGTGGGGG + Intergenic
1203469843 Un_GL000220v1:111583-111605 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1203472144 Un_GL000220v1:119918-119940 CCGCGGGCCGAGGCCGGTGGAGG - Intergenic
1203477664 Un_GL000220v1:155555-155577 CCGTGGGTCGGGGGCGGTGGTGG + Intergenic
1190107135 X:47568962-47568984 GTGGGGGTGGAGGCAGGTGGCGG - Intronic
1191736731 X:64395427-64395449 ACCCGGGTTGAGGCAGGAGGCGG - Exonic
1200058763 X:153474776-153474798 ACGCGGCTCGCGGGAGGTGGCGG + Intronic
1200163085 X:154019195-154019217 ACCTGGGGAGAGGAAGGTGGAGG + Exonic