ID: 1082086863

View in Genome Browser
Species Human (GRCh38)
Location 11:48057553-48057575
Sequence TGGGTCGAGGCAGGTGGTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 622
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 572}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086853_1082086863 4 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086848_1082086863 23 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086856_1082086863 -5 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086851_1082086863 18 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572
1082086857_1082086863 -6 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG 0: 1
1: 0
2: 2
3: 47
4: 572

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086863 Original CRISPR TGGGTCGAGGCAGGTGGTGG AGG Intronic
900103533 1:972793-972815 TGGGTCCAGGCAGGGGCGGGTGG + Intronic
900105530 1:979343-979365 GGGGGCGAGGCAGGTGCTTGAGG + Exonic
900110989 1:1005607-1005629 AGGGCAGAGGCAGGCGGTGGAGG - Intergenic
900389361 1:2427333-2427355 TGGGACGAGTCAGGTGCTGGGGG + Intronic
900514481 1:3074787-3074809 TGGGTGGAGGCGGTGGGTGGTGG - Intronic
900725859 1:4216053-4216075 TGTGGAGAGGCAGGTGGAGGTGG - Intergenic
900786687 1:4654432-4654454 GGGGTCGCCGCGGGTGGTGGGGG - Intergenic
901066767 1:6497982-6498004 TGGCACGAGGGAGGTGGCGGGGG - Intronic
901303069 1:8213582-8213604 TGGGGGCAGGCAGGTGGGGGAGG + Intergenic
901659982 1:10793240-10793262 TGGGGGGAGGAAGGGGGTGGTGG + Intronic
901712278 1:11125050-11125072 TGGGGCCAGGCTGGTGATGGGGG - Intronic
901787318 1:11633219-11633241 TGGGACTAGGCTGGTTGTGGTGG + Intergenic
902241872 1:15095021-15095043 TGGGCTGAACCAGGTGGTGGGGG + Intronic
902369587 1:15997451-15997473 GGGATGGAGGCAGCTGGTGGGGG - Intergenic
902400465 1:16154362-16154384 TGGGCAGTGGCAGGTGTTGGGGG - Intronic
904003947 1:27353636-27353658 TGGGACCAGGCAGGTGTTTGGGG + Intronic
904275784 1:29383355-29383377 TGAGCAGAGGCAGGAGGTGGTGG + Intergenic
904355074 1:29933572-29933594 TGGGTCAGGGCAGGTGGGGTGGG + Intergenic
905267537 1:36765070-36765092 TGGGTTGGGGGAGGGGGTGGTGG + Intergenic
905945853 1:41900961-41900983 AGGGTCAAGGCAGGATGTGGGGG + Intronic
905996080 1:42381279-42381301 GGCCTCGGGGCAGGTGGTGGTGG - Intronic
906043467 1:42807891-42807913 TGGGACATGACAGGTGGTGGGGG + Intronic
906204113 1:43978229-43978251 TGGGTTGAGGGTGGAGGTGGGGG - Exonic
906508978 1:46400509-46400531 TGACTGGATGCAGGTGGTGGTGG + Intronic
907936873 1:59049326-59049348 TGGGTGGAGGGAGGTTGTGAAGG + Intergenic
908251163 1:62267094-62267116 GGGGTCGTGGTAGGGGGTGGTGG + Intronic
908788970 1:67762167-67762189 TGGGTTGGGGGCGGTGGTGGTGG - Intronic
910338294 1:86157072-86157094 TGGGTCGGGGAAGGTTGCGGGGG - Intergenic
912141260 1:106731096-106731118 TTGGTGGAGGAAGGAGGTGGAGG + Intergenic
912749832 1:112277536-112277558 AGGGTAGTGGCAGGGGGTGGAGG + Intergenic
913041931 1:115035386-115035408 TGGGCTGAGGAGGGTGGTGGTGG + Intergenic
913568480 1:120097345-120097367 TCTGTTGAGGCAGGTGGTGGGGG - Intergenic
914237670 1:145826933-145826955 AGTGTGGGGGCAGGTGGTGGTGG - Exonic
914289291 1:146258372-146258394 TCTGTTGAGGCAGGTGGTGGGGG - Intergenic
914328182 1:146641403-146641425 AGGGTCAAGGGAGGTGTTGGGGG + Intergenic
914550327 1:148709125-148709147 TCTGTTGAGGCAGGTGGTGGGGG - Intergenic
915249063 1:154575883-154575905 TGAGTGGAGGAAGGTGGTGGTGG - Exonic
915837390 1:159188495-159188517 TGGGGAGAGGCAGGTGGGGGAGG - Intronic
917751526 1:178057896-178057918 TGGGGGGAGGCATGTGGGGGGGG - Intergenic
917878736 1:179312307-179312329 TGGGTCCAGGAAATTGGTGGTGG + Intronic
918052558 1:180987213-180987235 GGTGTGGAGGCAGGTGGTGTGGG - Intronic
918377185 1:183920961-183920983 TGTGTCGAGGGGGGTCGTGGGGG + Intronic
918693442 1:187511580-187511602 AGGGTTGTGGTAGGTGGTGGGGG - Intergenic
919009460 1:191940800-191940822 TGGGTCCTGTCAGGGGGTGGAGG + Intergenic
920098140 1:203499913-203499935 GTGGTGGAGGTAGGTGGTGGAGG - Intronic
920098178 1:203500038-203500060 GTGGTGGAGGTAGGTGGTGGTGG - Intronic
920098203 1:203500117-203500139 GTGGTGGAGGTAGGTGGTGGTGG - Intronic
924437616 1:244056661-244056683 GGGGTGGAGGGTGGTGGTGGGGG - Exonic
924580929 1:245323872-245323894 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580942 1:245323908-245323930 TGGGTGGATGGAGGTGGAGGTGG + Intronic
924580955 1:245323945-245323967 TGGGTGGTGGGAGGTGGAGGTGG + Intronic
924652828 1:245946306-245946328 GCGGTGGAGGAAGGTGGTGGAGG - Intronic
1063022563 10:2144316-2144338 TGGGTCCTGGCAGTTGGTGTCGG - Intergenic
1064740136 10:18424560-18424582 GGGGTTGAGGTAGGAGGTGGGGG - Intronic
1065329063 10:24574711-24574733 CGGGTCCAGGCAGGTAGGGGAGG + Intergenic
1066126335 10:32346598-32346620 GGGGTCGAGGCTGGGGGAGGCGG + Intronic
1067110690 10:43397378-43397400 TGGGCCCAGGCAGGAAGTGGGGG + Intronic
1067816245 10:49479673-49479695 TGGGTGGAGGGAGGATGTGGGGG - Intronic
1070156620 10:73839498-73839520 GGGGCCGAGGCAGGCGGTCGGGG + Intronic
1070635217 10:78120146-78120168 TGGGCAGAGACAGGTAGTGGTGG + Intergenic
1071536410 10:86435589-86435611 TTGGTGGGGGGAGGTGGTGGGGG - Exonic
1072426901 10:95337521-95337543 TGTGTGCAGGCAGGGGGTGGAGG + Intronic
1072528160 10:96293120-96293142 AGGGCAGAGGCAGGTGTTGGAGG - Intergenic
1072592106 10:96835784-96835806 GGTGTGGGGGCAGGTGGTGGTGG + Intronic
1073435360 10:103512909-103512931 CCAGTCAAGGCAGGTGGTGGGGG + Intronic
1075015250 10:118905873-118905895 TGTCTCCAGGCAGGAGGTGGTGG + Intergenic
1075608261 10:123831930-123831952 TGGGTGGAGGCCGGGGGTGGGGG + Intronic
1076474734 10:130744091-130744113 TGGGTGGAGGCTGGGGGTGGAGG + Intergenic
1076716877 10:132370529-132370551 TGTGTTGAGACAGGTGGTGTTGG + Intronic
1076795926 10:132798508-132798530 TGGGCCGAGGCAGCTGGATGAGG + Intergenic
1076804515 10:132848545-132848567 TGGGTTGTGGGAGGGGGTGGGGG + Intronic
1076827059 10:132974444-132974466 TGGGGAGAGGCAGGTGCGGGCGG - Intergenic
1076856139 10:133116416-133116438 TGGGTGGTGGCGGGGGGTGGGGG - Intronic
1076912913 10:133401133-133401155 TGGGTCCAGGAGGGAGGTGGGGG + Intronic
1077192061 11:1259696-1259718 TGGGCCGGGGCATGTGCTGGAGG + Intronic
1077217408 11:1400719-1400741 GGGGTGGGGGCAGGTAGTGGAGG + Intronic
1077863123 11:6200376-6200398 TGGGAGGAGGCAGGAGGTAGAGG + Intergenic
1078083063 11:8217865-8217887 TGGGCCGAGGCAGGGAGAGGTGG - Intergenic
1078083081 11:8217925-8217947 TGGGCCGAGGCAGGGAGAGGTGG - Intergenic
1078397494 11:10994050-10994072 TGGGTCTTTGCAGGAGGTGGAGG - Intergenic
1078410153 11:11108004-11108026 AGGATGCAGGCAGGTGGTGGTGG + Intergenic
1078431667 11:11292945-11292967 AGGGGCCAGGGAGGTGGTGGAGG - Intronic
1078882192 11:15463222-15463244 GTGCTTGAGGCAGGTGGTGGAGG + Intergenic
1079105563 11:17570133-17570155 GCGGGCCAGGCAGGTGGTGGTGG + Intronic
1079903087 11:26212046-26212068 TGGGGCCTGTCAGGTGGTGGGGG + Intergenic
1080412346 11:32037650-32037672 TGGGTGTAGGTAGGAGGTGGTGG + Intronic
1080936428 11:36868697-36868719 TGGGTTCAGGCAAGTGGAGGAGG + Intergenic
1080949749 11:37018000-37018022 TGGGGGGAGGCGGGAGGTGGAGG - Intergenic
1081667154 11:44923297-44923319 TGGGTGGCAGCAGGGGGTGGGGG + Intronic
1081753413 11:45528028-45528050 TGGGTGGAGGGTGGAGGTGGTGG - Intergenic
1082085414 11:48045724-48045746 TGGGTCAGGGCAGGTGGTTGTGG + Intronic
1082086863 11:48057553-48057575 TGGGTCGAGGCAGGTGGTGGAGG + Intronic
1082698548 11:56400891-56400913 TTGGTGGGGGCAGCTGGTGGAGG + Intergenic
1082793136 11:57361112-57361134 TGGGTAGAGGCAGATGGAAGTGG - Intronic
1083278191 11:61609270-61609292 TGGGATGAGGCTGGTGCTGGGGG - Intergenic
1083869809 11:65479789-65479811 TGTTTCAAGGCAGGTGGTGGTGG + Intergenic
1083955181 11:65978920-65978942 TGGCTCGAGGCTGGTGGGGTAGG + Intronic
1083992474 11:66255272-66255294 TGGCTCAAGCCAGGAGGTGGAGG - Intergenic
1084208734 11:67611216-67611238 TGGGGCCAGCCAGGTGGTGGGGG + Intronic
1085542975 11:77289482-77289504 GAGGCCGAGGCAGGGGGTGGGGG + Intronic
1085641772 11:78197224-78197246 TGGGGCGGGGGAGGTGGGGGGGG + Intronic
1085780500 11:79403807-79403829 GGGGTTGAGGGGGGTGGTGGGGG + Intronic
1086574323 11:88321436-88321458 TGGGGCCAGTCAGGGGGTGGGGG - Intronic
1086887507 11:92222963-92222985 TGGGTAGAGTCGGCTGGTGGTGG - Intergenic
1087103945 11:94392311-94392333 TGGGTCCTGTCAGGAGGTGGGGG + Intronic
1088999356 11:115038137-115038159 TGTCTGGAGGCAGGTGGTAGAGG - Intergenic
1089196013 11:116694493-116694515 TGGGGGGAGGGAGATGGTGGGGG - Intergenic
1089653612 11:119931555-119931577 TGGATAGAGGAAGGAGGTGGGGG - Intergenic
1089809658 11:121121317-121121339 TGGGTAGGGGCAGGGGGAGGAGG - Intronic
1090051957 11:123387717-123387739 TGGGGCGGGGCGGGTGGGGGCGG - Intergenic
1090202537 11:124866531-124866553 TGGGTCGAGGCAGAGGGATGGGG - Intronic
1090739128 11:129641301-129641323 TGGGAGGAGGCAGGTGGTGCAGG - Intergenic
1091140916 11:133233894-133233916 TTGGTCTGGGCAGGGGGTGGGGG - Intronic
1091205587 11:133818673-133818695 TGGGTGGCGGTGGGTGGTGGTGG - Intergenic
1092218127 12:6696414-6696436 TGGGAGGAGGAAGGTGCTGGTGG - Intronic
1093013178 12:14129698-14129720 GGGGTGGGGGTAGGTGGTGGGGG - Intergenic
1094482876 12:30898794-30898816 TGGGGCGGGGGAGGTGGGGGCGG + Intergenic
1095265640 12:40154002-40154024 TGGGTGGGGGCAGAGGGTGGTGG + Intergenic
1095952772 12:47790640-47790662 TGTGTAGAGGCAGGGGATGGAGG - Intronic
1095969466 12:47891890-47891912 TGGGTGGGGGTGGGTGGTGGTGG - Intronic
1096836897 12:54356912-54356934 TGGGTGGAGGGGGGTGGTGTGGG + Intergenic
1097189903 12:57214662-57214684 AGGGTTGGGGCTGGTGGTGGTGG - Intergenic
1100499543 12:95160597-95160619 TGGGTGGAGGCAGCTGGTCAGGG - Intronic
1101184198 12:102256039-102256061 TGGGGCCTGTCAGGTGGTGGGGG + Intergenic
1102209855 12:111118578-111118600 TGGATTGAGGCTGATGGTGGAGG - Intronic
1102287264 12:111668205-111668227 TGGGTCGGGGCGGGGTGTGGGGG + Intronic
1102640968 12:114366222-114366244 TGGGTGGAGGCAGGAGGTCCTGG + Exonic
1102763909 12:115414405-115414427 TGGGTTAATGCTGGTGGTGGTGG + Intergenic
1102812129 12:115833333-115833355 TGGGATGATGCTGGTGGTGGAGG - Intergenic
1102887689 12:116534135-116534157 AGGGGGGAGGCAGGTGGGGGAGG - Intergenic
1103340293 12:120217242-120217264 TGGGTGGAGGCACGGGGAGGGGG + Intronic
1103340308 12:120217284-120217306 TGGGTAGAGGCAAGGGGAGGGGG + Intronic
1104133453 12:125916377-125916399 TGGAACAAGGCAGGTGGAGGAGG + Intergenic
1104643357 12:130481136-130481158 CGGGAGGAGGCAGGTGGTGAGGG + Intronic
1104806507 12:131592589-131592611 TAGGTTGGGGCAGGTGCTGGGGG + Intergenic
1104931011 12:132339513-132339535 TGGGTGGAGGGAGATGCTGGTGG - Intergenic
1104952109 12:132445806-132445828 GGGGTGGAGGCAGGTGGAGCGGG - Intergenic
1105299307 13:19118166-19118188 TGGGTGGCTGCAGGTGGTGGTGG - Intergenic
1106194784 13:27483811-27483833 TGGGTCCAGGCACCTGCTGGAGG - Intergenic
1106736370 13:32591806-32591828 AGGGTGAAGGTAGGTGGTGGGGG - Intronic
1106927793 13:34631467-34631489 TGGTTAGAGGAAGGTGTTGGGGG - Intergenic
1107300409 13:38960062-38960084 TGGGTCTGGGAAGGTGGAGGAGG + Intergenic
1108297331 13:49037567-49037589 TGGGTTGTGGCAGGGGGTAGGGG - Intronic
1109161572 13:58981989-58982011 TGGGGCCTGGCAGGGGGTGGGGG - Intergenic
1111404864 13:87790733-87790755 TGGGGCCTGTCAGGTGGTGGGGG - Intergenic
1112393191 13:99003717-99003739 TGGCCTGAAGCAGGTGGTGGAGG - Intronic
1112588056 13:100737208-100737230 TGGGATGGGGCAGGTTGTGGCGG + Intergenic
1113090918 13:106616988-106617010 CTGGTCAAGGCAGGAGGTGGGGG + Intergenic
1113224037 13:108139895-108139917 TGAGTGGAGGGAGCTGGTGGGGG + Intergenic
1113744519 13:112734256-112734278 TGGGATGAGGCAGGTGCAGGGGG + Intronic
1114499925 14:23161184-23161206 TGGGAGGAGCCAGGTGGTGGGGG - Intronic
1114552137 14:23538788-23538810 TGGGTAGAGGCAAGGGCTGGGGG + Intronic
1114615322 14:24065121-24065143 TGAGTCGGGGGAGGGGGTGGGGG - Exonic
1115603996 14:34982390-34982412 GAGCTAGAGGCAGGTGGTGGGGG - Intronic
1115811849 14:37118380-37118402 TGGGAGGAGGCAGGTGGCTGGGG - Intronic
1115813259 14:37133640-37133662 TGGGTTAGGGCAGGTGTTGGTGG - Intronic
1117251429 14:53943343-53943365 TAGCTCGAGGGAGGGGGTGGGGG - Intergenic
1117480500 14:56139221-56139243 TGGGCCAAGGAAGGTGGAGGAGG + Intronic
1117961430 14:61166468-61166490 AGGGTGGAGGCAGGGGGTAGAGG - Intergenic
1118780796 14:69006356-69006378 TGGGTGGAGGGCGGAGGTGGTGG - Intergenic
1118911340 14:70064533-70064555 TGGGTCGGGGGTGGTGGTGGCGG + Intronic
1119425474 14:74532083-74532105 TTGGTGGCGGGAGGTGGTGGGGG - Intronic
1119747551 14:77054985-77055007 TGGGAAGAGGCAGGAGGTGTTGG + Intergenic
1120193568 14:81460871-81460893 AGGGTCGAGCCAGGTGCGGGGGG - Intergenic
1122172232 14:99886395-99886417 TGGCTTGAGCCAGGAGGTGGAGG + Intronic
1122205502 14:100146051-100146073 GGGGGCAAGGCAGGTGGTGTGGG + Exonic
1122693888 14:103543664-103543686 AGGGTACAGGGAGGTGGTGGGGG - Intergenic
1122921211 14:104881029-104881051 TGGTGAGAGGCAGGTGATGGGGG + Intronic
1123107646 14:105850163-105850185 AGGGTGGAGGCAGGTGGCTGGGG - Intergenic
1123994706 15:25710344-25710366 TGGGTCGGGGCAGGAGCAGGAGG + Intronic
1124586561 15:31014984-31015006 TGACTTGAGGCAGGGGGTGGGGG + Intronic
1125433935 15:39626013-39626035 TGGGTCAAGGAAGGTTGTGATGG + Intronic
1125500781 15:40239276-40239298 ACGGTCCAGGCAGGTGGGGGAGG + Intronic
1126109598 15:45167598-45167620 TGGGGAGAGGGTGGTGGTGGTGG + Exonic
1126320730 15:47419940-47419962 TGGTCCAGGGCAGGTGGTGGTGG + Intronic
1127711573 15:61604410-61604432 TGAATCAAGGCAGGTGGCGGTGG - Intergenic
1127997574 15:64162666-64162688 TGGGTCAGGGCAGGGGCTGGGGG + Intronic
1128350653 15:66886236-66886258 TGGGCTGAGGCTGGTGGTGTTGG - Intergenic
1129114690 15:73358709-73358731 TGGGTGTTGGCAGGTGCTGGGGG - Intronic
1129246092 15:74279930-74279952 AGGGTAGGAGCAGGTGGTGGGGG - Intronic
1129740381 15:77986966-77986988 TGGAGCGAGGCAAGTGGTGTGGG + Intronic
1129845371 15:78765631-78765653 TGGAGCGAGGCAAGTGGTGTGGG - Exonic
1130256477 15:82328228-82328250 TGGAGCGAGGCAAGTGGTGTGGG + Intergenic
1130263837 15:82380718-82380740 TGGACGGAGGAAGGTGGTGGAGG + Intergenic
1130598475 15:85261760-85261782 TGGAGCGAGGCAAGTGGTGTGGG - Intergenic
1131551224 15:93358712-93358734 AGGGGCGAGGCAGATGGAGGAGG + Intergenic
1132450577 15:101966016-101966038 TGGGTGGGTGCAGGTGGTCGTGG + Intergenic
1132663657 16:1072369-1072391 TGTGTGGAGGCTGGTGGGGGCGG - Intergenic
1132671645 16:1104365-1104387 TGGGTGGGGGCAGCTGGTGCAGG - Intergenic
1132757099 16:1490899-1490921 TGGGTCGGGGCAGGGTGTGGTGG + Intergenic
1133598632 16:7317656-7317678 TGGCTGGAGGCAGCGGGTGGAGG - Intronic
1135017835 16:18938978-18939000 TTGCTTGAGGCAGGAGGTGGAGG - Intergenic
1135623695 16:23977280-23977302 TGGGGAAAAGCAGGTGGTGGAGG + Intronic
1135970847 16:27070899-27070921 TGGGCTGAGGCAGGGGGAGGAGG - Intergenic
1136284729 16:29234043-29234065 GGGGTGGAGGCAGGAGCTGGGGG + Intergenic
1136473060 16:30494687-30494709 TGGGGAGAGGCAGGTGTTTGGGG - Intronic
1136500617 16:30668192-30668214 TGGGTCCAGGCGGCTGGTGTTGG + Intronic
1136500951 16:30669496-30669518 GGGGCCGCAGCAGGTGGTGGTGG - Exonic
1138301016 16:55929958-55929980 TGGGCCAAGGAAGGTGGTGAGGG - Intronic
1138550311 16:57744152-57744174 AGGGAAGAGGGAGGTGGTGGGGG + Intronic
1138588578 16:57986945-57986967 TGGGGAGAGGCAGAGGGTGGGGG - Intronic
1139636443 16:68261089-68261111 TGAGGGGAGGGAGGTGGTGGAGG + Intergenic
1140005380 16:71069538-71069560 AGGGTCAAGGGAGGTGTTGGGGG - Intronic
1140313730 16:73873057-73873079 TGGGTGGTGGCGGATGGTGGTGG + Intergenic
1141128644 16:81419205-81419227 TGGCTTGAGGCAGGAAGTGGAGG + Intergenic
1141329894 16:83101503-83101525 TGGGTAGAGGCTGGGCGTGGTGG + Intronic
1141899840 16:86983911-86983933 AGGGTGGAGGCTGGGGGTGGAGG + Intergenic
1142065591 16:88060617-88060639 TGCGTGGAGGCACGTGGAGGTGG + Intronic
1142070873 16:88090797-88090819 GGGGTCGGGGGGGGTGGTGGGGG + Intronic
1142089748 16:88203511-88203533 GGGGTGGAGGCAGGAGCTGGGGG + Intergenic
1142105036 16:88298132-88298154 TGGGCTGTGGCAGGGGGTGGGGG - Intergenic
1142147905 16:88500132-88500154 TGGGTGGGGGCTGGTGGTGGGGG - Intronic
1142223670 16:88867099-88867121 AGGGCCGAGGCAGGTTGGGGCGG + Intergenic
1142231330 16:88901542-88901564 TGGGATGCGGCAGGCGGTGGGGG + Exonic
1142431295 16:90029272-90029294 AGGGTCCAGGCAGGTGGGGAGGG + Exonic
1142467888 17:146506-146528 AGGCTCGAGGCAGGAGGTGGGGG - Intergenic
1142489636 17:269983-270005 TGGGTGGTGGCAGGAGGAGGGGG - Intronic
1143165830 17:4896885-4896907 TGGGGAGAGGATGGTGGTGGTGG + Intronic
1143305449 17:5942895-5942917 GAGGTGGAGGCAGGTGGTGAGGG + Intronic
1143400196 17:6638495-6638517 TGGGAGGAGGCAGGCTGTGGGGG - Intronic
1143517153 17:7425625-7425647 TGGGTTGGGGCCGGGGGTGGGGG + Exonic
1143521294 17:7445659-7445681 GGGGACGAGGCAGGGGCTGGGGG + Intronic
1143621642 17:8084326-8084348 TGAGCTGAGGCAGGTGGAGGAGG - Intronic
1143747841 17:9006396-9006418 GGGGCCCAGGCAGGAGGTGGTGG + Intergenic
1143864477 17:9913890-9913912 TGGGTGGAGGCAGGTAGAAGGGG + Exonic
1145255895 17:21322132-21322154 TGGGCCGAGGTGGGTGGGGGAGG + Intergenic
1145919317 17:28598791-28598813 TGGGTCGAGCCCGGGGTTGGGGG - Intronic
1146581313 17:34040450-34040472 GGGGACGAGGAAGGTGGGGGGGG + Intronic
1146610378 17:34299620-34299642 TTGGTCCAGGCAGGTAGGGGGGG + Intergenic
1147168728 17:38606166-38606188 TGGGACGAAGCAGGTGGCGCGGG - Intergenic
1147282992 17:39378009-39378031 TGGGGGGCGGTAGGTGGTGGAGG - Intronic
1147537722 17:41331821-41331843 AGGGTGGTGGCAGGTGGGGGTGG - Intergenic
1147638763 17:41980955-41980977 GTGCTAGAGGCAGGTGGTGGTGG - Intronic
1147938728 17:44029828-44029850 TAGGTGGAGCCAGGTGGTGCAGG - Intergenic
1147971774 17:44222019-44222041 AGGGTCGAGGCGGGTGTGGGGGG + Intergenic
1149571325 17:57674268-57674290 TGGGGAGGGGCGGGTGGTGGGGG + Intronic
1149591611 17:57834030-57834052 TGGATGGAGGGTGGTGGTGGTGG + Intergenic
1149737739 17:59012245-59012267 TGGGTGGTGGGTGGTGGTGGTGG - Intronic
1150108441 17:62478686-62478708 GGGGACGAGGAAGGTGGGGGGGG - Intronic
1150176358 17:63060968-63060990 GAGGTGGAGGCAGGAGGTGGAGG + Intronic
1150643926 17:66966301-66966323 CGGGTGGAGGGAGTTGGTGGGGG + Intronic
1150741215 17:67780314-67780336 TGGGTGGAGGCAGGGCGAGGTGG - Intergenic
1151347910 17:73514561-73514583 TGGGTGGAGGAAGGGGGTGATGG + Intronic
1151462258 17:74261458-74261480 TGGGTGGGGACAGGTGGTGGGGG - Exonic
1151499176 17:74478009-74478031 TGGGTAGAGCCAGATCGTGGAGG - Intronic
1151560724 17:74868143-74868165 TGGAGAGAGGCAGGAGGTGGGGG - Intronic
1151719443 17:75847062-75847084 TGGCTCGGGGCAGCTGGTGCTGG + Intronic
1151942289 17:77300396-77300418 TGTGTCTAGGCAGGGGGTGGGGG + Intronic
1151983560 17:77528307-77528329 TGGGAGGAGGCAGGTGGGGAGGG + Intergenic
1152024559 17:77800291-77800313 TGGGGCGGGGCGGGGGGTGGGGG + Intergenic
1152274581 17:79348861-79348883 TGGGTTTAGGCCGGGGGTGGTGG - Intronic
1152601194 17:81263122-81263144 TGGGAGGTGGCAGGTGGTGGGGG - Intronic
1152632540 17:81417024-81417046 AGGGTCAGGGCAGGGGGTGGGGG + Intronic
1153555709 18:6311077-6311099 TTGATTGAGGCAGGTTGTGGGGG - Intronic
1153635142 18:7106975-7106997 TGGGTCGAGGAAAGCGGGGGAGG - Intronic
1153945937 18:10017477-10017499 TGGGGAGAGGCTGGTGCTGGGGG + Intergenic
1153995138 18:10434147-10434169 TGGGTTGGGGGGGGTGGTGGCGG - Intergenic
1154166327 18:12017285-12017307 TGGCTCCAGGCAGCTGGGGGTGG - Intronic
1156504631 18:37581653-37581675 TGGATGGAGGCAGGTGGTATTGG + Intergenic
1157220205 18:45824108-45824130 TGGGTGGGGGCAGGTGAAGGAGG + Intergenic
1157312054 18:46560055-46560077 TGGGTCGTGGGGGGTGGGGGTGG - Intronic
1157319364 18:46622523-46622545 TGTCTCTAGGCAGGGGGTGGTGG + Intronic
1157403492 18:47405065-47405087 TGGGTAGGGGCAGCTGGCGGAGG + Intergenic
1158519176 18:58156595-58156617 TGGGGCGTGGGAGGCGGTGGGGG - Intronic
1159040503 18:63319769-63319791 TGGGGAGAAGGAGGTGGTGGGGG + Exonic
1159985228 18:74833748-74833770 TGACTCGGGCCAGGTGGTGGTGG + Intronic
1160578720 18:79871651-79871673 TGGGTGGAGACTGGTGGTGTGGG - Intronic
1160838024 19:1133551-1133573 TGGGTCGTGGCAAGGGGTGTGGG - Intronic
1160942136 19:1625387-1625409 GGGGTCGAGGCAGGGGCCGGCGG - Intronic
1160970287 19:1764867-1764889 TGGGGCAGGGCAGCTGGTGGCGG + Intronic
1161490036 19:4556631-4556653 TGGAACGAGGCTGGGGGTGGTGG + Intronic
1161706428 19:5824282-5824304 GGGTTCGAGGCAGGCGGTGCAGG - Exonic
1161978964 19:7620771-7620793 GGGGTCCAGGCAGGTGGGAGGGG - Intronic
1162018971 19:7860187-7860209 GTGGGCGAGGCAGGGGGTGGGGG - Intronic
1162064423 19:8116634-8116656 TGGGGCGGGGCGGGTGGAGGAGG - Intronic
1162070620 19:8149920-8149942 TTGCTCGAGGGAGGGGGTGGCGG - Intronic
1162373540 19:10292428-10292450 AGGGGCGGGGCAGGTGGGGGCGG + Intronic
1163440241 19:17319121-17319143 TGGGTCATTGCATGTGGTGGGGG + Intronic
1163441420 19:17324196-17324218 TGGGGCAGGGGAGGTGGTGGGGG + Intronic
1163591590 19:18197024-18197046 TGGGCCGAGGCCGCTGTTGGGGG - Exonic
1163669410 19:18618517-18618539 TGGGCCGAGGGAGGGGGTGAAGG + Intronic
1163845411 19:19635695-19635717 TGGCACGAGGCAGCTGGTGAAGG - Exonic
1164196634 19:22972041-22972063 TGGGTCTAGGCCGGGTGTGGTGG + Intergenic
1164424473 19:28128706-28128728 TGGGGCCAGGGTGGTGGTGGTGG - Intergenic
1164800858 19:31075247-31075269 TGGGTGGTGGGAGGTGGCGGGGG + Intergenic
1164941854 19:32256955-32256977 TGGGGGCAGGCAGGTGGTGAAGG + Intergenic
1165092990 19:33396358-33396380 TGGGCCGGGGCAGGTGCTGCTGG + Intronic
1165451114 19:35883700-35883722 TGAGTCCAGGCAGGAGGTGGAGG + Intergenic
1165661765 19:37587005-37587027 TGGGTCCAGGAGGATGGTGGGGG - Intronic
1165901104 19:39169769-39169791 TGGGCTGGGGGAGGTGGTGGTGG - Intronic
1165934930 19:39383514-39383536 TGGGTCCCGTCAGATGGTGGAGG - Exonic
1165998936 19:39866083-39866105 TTGGTCAAGGCTGGGGGTGGGGG - Intronic
1166210834 19:41305748-41305770 TAGTTGTAGGCAGGTGGTGGTGG - Exonic
1166211018 19:41306609-41306631 GGGGCCGAGGCAGGCGCTGGTGG - Exonic
1166784286 19:45358424-45358446 TGGGTCCAGGCAGGAGGTGATGG - Intronic
1167013599 19:46825067-46825089 GGCGCCAAGGCAGGTGGTGGTGG - Intergenic
1167157893 19:47750452-47750474 TGGGCCGAGGCAGGTGAGGAGGG + Intronic
1167276511 19:48543410-48543432 TGGCCCGAGGCAGGAGGAGGAGG + Intergenic
1167420145 19:49397905-49397927 CGGGTCGAGGTAGGTGCTGGTGG - Intronic
1167455887 19:49596628-49596650 TGGGCCGTGGGAGGTGGGGGCGG - Exonic
1167468120 19:49660904-49660926 TAGGTCAGGGGAGGTGGTGGGGG - Intronic
1167658982 19:50784778-50784800 GAGGTAGAGGCAGGGGGTGGGGG + Intergenic
1168144870 19:54415421-54415443 GGGGGGGAGGCAGGGGGTGGGGG - Intronic
1168240895 19:55088411-55088433 AGGGCCGTGGCAGGAGGTGGGGG - Intergenic
924964393 2:61799-61821 GGGGCCGAGACAGGTAGTGGGGG + Intergenic
925100839 2:1244025-1244047 TGGGGCCAGGGTGGTGGTGGGGG + Intronic
925173724 2:1767945-1767967 GGGGTAGAGGGAGGTGGGGGAGG + Intergenic
925586996 2:5474704-5474726 TGGGGCGAGGCAGGTGGATGTGG - Intergenic
925587000 2:5474722-5474744 TGGGGCGAGGCAGGTGGGTGGGG - Intergenic
925587018 2:5474769-5474791 TGGGGTGAGGCAGGTGGATGTGG - Intergenic
925587022 2:5474787-5474809 TGGGGCGAGGCAGGTGGGTGGGG - Intergenic
925587038 2:5474834-5474856 TGGGGCGAGGCAGGTGGATGTGG - Intergenic
926121120 2:10241593-10241615 TGCGGCGAGGCAGGGGCTGGGGG - Intergenic
926167642 2:10531353-10531375 AAGGTCGGGGCAGGAGGTGGGGG + Intergenic
927142944 2:20142054-20142076 TGGGTAGAGGGAGGGGCTGGGGG - Intergenic
928407848 2:31028528-31028550 TGGGGAAGGGCAGGTGGTGGCGG - Intronic
929426776 2:41851832-41851854 TGGGTGGAGGAAGGTTTTGGTGG + Intergenic
929982539 2:46695388-46695410 AGGGTGGAGGCAGGTGGTTTGGG - Intergenic
932304353 2:70691269-70691291 TGGGAAGAGGCAGGCTGTGGTGG + Intronic
932850129 2:75176696-75176718 TGTGATGAGGCAGGTGGTGCAGG - Intronic
932892815 2:75611337-75611359 TGGTTGGAGGATGGTGGTGGGGG - Intergenic
934055372 2:88247153-88247175 TGGGTTAAGGAGGGTGGTGGAGG - Intergenic
934116524 2:88802213-88802235 TGAGTCAGGGCAGGAGGTGGAGG + Intergenic
934684690 2:96312182-96312204 TCCGTAGAGGCAGGAGGTGGGGG + Intergenic
935499193 2:103817934-103817956 TGGGGCGGGGCAGGTGGTGTTGG - Intergenic
935707099 2:105866477-105866499 TGGATGGTGGCAGGAGGTGGGGG + Intronic
936145576 2:109978511-109978533 TTGGGCGGGGCAGGAGGTGGAGG - Intergenic
936199110 2:110392967-110392989 TTGGGCGGGGCAGGAGGTGGAGG + Intergenic
936462814 2:112724691-112724713 TGGGGAGAGGCAGGCTGTGGTGG + Intronic
937058431 2:118960892-118960914 TGGGGCCAGTCAGGGGGTGGGGG - Intronic
937332298 2:121039048-121039070 TGGGTCCTGGCAGGTGGGCGGGG + Intergenic
937457214 2:122052847-122052869 TGGGGCCTGTCAGGTGGTGGGGG - Intergenic
937963593 2:127483566-127483588 TTGGTCGGGGCGGGGGGTGGTGG + Intronic
937978210 2:127594153-127594175 TTGGGGGAGGCAGGTTGTGGTGG - Intronic
940454711 2:153882182-153882204 GGGGTCGAGGCAGGGGGAGGTGG + Intronic
941050043 2:160722503-160722525 TGGGGCCAGTCAGGGGGTGGGGG - Intergenic
942361778 2:175180886-175180908 GGGGCGGAGGAAGGTGGTGGGGG - Intronic
942383565 2:175418842-175418864 TGAGTCGAGGAAGGCGGGGGTGG - Intergenic
943007541 2:182403821-182403843 TGGGTCCTGTCAGGGGGTGGGGG + Intronic
945976316 2:216273888-216273910 TGGGTGGAGGCAGGAGGTGGTGG + Intronic
946053095 2:216880343-216880365 GGGGTAGAGGAAGGTGGAGGTGG + Intergenic
946173147 2:217907186-217907208 TGAGTGATGGCAGGTGGTGGTGG - Intronic
948042206 2:234911541-234911563 TGGGGCAAGGCAGATGCTGGGGG + Intergenic
948547029 2:238740044-238740066 TGGGCCAGGGCAGGAGGTGGAGG + Intergenic
948908964 2:240993610-240993632 TGGGGCGAGGCCGGTGGAGGGGG - Intergenic
949007524 2:241658211-241658233 TGGGAGGAGGAAGGTGGTGTGGG + Intronic
949022455 2:241749195-241749217 TGGGGTGTGGGAGGTGGTGGTGG - Intronic
1168805298 20:669134-669156 TGGGTGGGGGCACGGGGTGGTGG + Intronic
1169355170 20:4899345-4899367 TGGGTAGGGGAAGGTGGCGGTGG + Intronic
1169891034 20:10452241-10452263 TGGATCCAGGCAGGGCGTGGTGG + Intronic
1170305892 20:14937236-14937258 TGAGTGGAGGCAGTTGGTGAAGG + Intronic
1170915878 20:20625008-20625030 TGGGTAGAGACAGGTGAAGGTGG - Intronic
1171364771 20:24616393-24616415 TGGGAGGATGCAGGTGGAGGAGG - Intronic
1173404492 20:42752975-42752997 GGGGTCGGGGCAGGGGGTGAGGG + Intronic
1173613448 20:44387641-44387663 GGGGTGGAGGCAGGCGGGGGGGG + Intronic
1173795228 20:45855130-45855152 TGGGTTGGGGCAGGAAGTGGGGG + Intronic
1174035839 20:47667803-47667825 CAGCTGGAGGCAGGTGGTGGCGG + Intronic
1174137124 20:48387278-48387300 TGGGTGGGGACTGGTGGTGGTGG - Intergenic
1174938023 20:54893556-54893578 TGGGTATGTGCAGGTGGTGGTGG + Intergenic
1175127753 20:56764964-56764986 TGGGTGGGGGGCGGTGGTGGTGG + Intergenic
1175502387 20:59459813-59459835 GGGGTGGAGGCAGCAGGTGGTGG + Intergenic
1175889382 20:62309614-62309636 TGGGAGGGGGCAGGGGGTGGAGG + Intronic
1175944468 20:62552305-62552327 TGGGTGGGGGCGGGGGGTGGGGG - Intronic
1178484429 21:33009048-33009070 TCGGGGGAGGGAGGTGGTGGGGG - Intergenic
1178549884 21:33527879-33527901 TGGCTCTAGGCAGGTGGAAGTGG + Intronic
1178876722 21:36419725-36419747 TGGGGAGAGGGAGGAGGTGGAGG + Intergenic
1179281028 21:39934436-39934458 TGGGCTGAGGCATGTGTTGGAGG + Intergenic
1179474079 21:41632181-41632203 TGGGAAGAGGCAGGGGGTGGGGG + Intergenic
1179556680 21:42183004-42183026 GGGCTGGAGGCAGGTGCTGGAGG - Intergenic
1179629709 21:42668893-42668915 TGGGACGTGGCGGGGGGTGGAGG - Intronic
1181023904 22:20117055-20117077 TGGGGCGAAGCCGGGGGTGGCGG - Exonic
1181359538 22:22323783-22323805 ATGGTGGAGGGAGGTGGTGGAGG + Intergenic
1181369618 22:22405527-22405549 ATGGTGGAGGGAGGTGGTGGAGG + Intergenic
1181672352 22:24431626-24431648 TGTCCCCAGGCAGGTGGTGGCGG + Intronic
1181719626 22:24763817-24763839 AGGGCCGAGGCAGGAGATGGTGG - Intronic
1182549755 22:31094308-31094330 AGGGGCGAGGCAGGGGGAGGTGG + Intronic
1183299899 22:37053715-37053737 TGGGTGGAGGCAGGAGAGGGGGG + Intronic
1183300966 22:37059010-37059032 TGGGGCTAGGCTGGAGGTGGTGG + Intronic
1183414850 22:37676208-37676230 TGTGTCCAGGCTGGTGGCGGGGG + Intronic
1183677804 22:39309539-39309561 TGGGAACAGGGAGGTGGTGGCGG - Intergenic
1183858810 22:40654112-40654134 TGGGGGGAAGCAGGAGGTGGTGG + Intergenic
1184040587 22:41940849-41940871 TGGGTCGAGGCTGCTGCAGGAGG - Intronic
1184266670 22:43350780-43350802 GAGGTCGAGGCGGGTGGTCGAGG + Intergenic
1184452413 22:44590985-44591007 TGGGCCAAGGCAGGTGGAGACGG + Intergenic
1184729740 22:46365886-46365908 TGGGTGGGGGAAGGTGGTGGGGG + Intronic
1184729754 22:46365916-46365938 TGGGTGGGGGAAGGTGGTGGGGG + Intronic
1184920098 22:47600024-47600046 TGGGTGGGGTCAGGTGGCGGAGG + Intergenic
1185277651 22:49956770-49956792 TGGGTGGCAGCAGGTGCTGGTGG + Intergenic
950010872 3:9722903-9722925 TGGGTTTAGCCAGGTGGTGATGG - Intronic
950183426 3:10930715-10930737 TTGGAGAAGGCAGGTGGTGGAGG + Intronic
950482069 3:13250504-13250526 GGGGTGGAGGGTGGTGGTGGGGG - Intergenic
951107433 3:18761489-18761511 TAGATAGAGGTAGGTGGTGGGGG + Intergenic
952150310 3:30581756-30581778 TGGGTCTATGCAGTTTGTGGAGG - Intergenic
953118368 3:40015042-40015064 TGGGGCAAGGCAGTTAGTGGAGG + Intronic
953420336 3:42749201-42749223 CGGGGCGTGGCAGGGGGTGGAGG - Intronic
953431774 3:42845982-42846004 TGGGTGGAGGCTGAGGGTGGGGG + Intronic
953633338 3:44639444-44639466 TGTGTGCAGGCAGGGGGTGGGGG + Intronic
953787520 3:45922173-45922195 TGGGAGGAGGCATATGGTGGAGG + Intronic
954053127 3:47999101-47999123 GGGGTGGAGGGAGGTGGTGGTGG + Intronic
954131217 3:48561959-48561981 TGGGTCGAGGCTGGGGATGCAGG + Exonic
956159306 3:66332223-66332245 TGGCTGGAGGCAGGCTGTGGTGG - Intronic
957376946 3:79370839-79370861 TGGGACCAGTCAGGGGGTGGGGG - Intronic
957489969 3:80910962-80910984 TGGGTCCTGTCAGGAGGTGGGGG + Intergenic
958733916 3:97988603-97988625 TGGGTGGTGGGTGGTGGTGGTGG + Intronic
958733963 3:97988810-97988832 TGGGTGGCGGTAAGTGGTGGTGG + Intronic
958734114 3:97989443-97989465 TGGGTGGTGGGTGGTGGTGGTGG + Intronic
961411683 3:126726816-126726838 TGTGTGGAGGGAAGTGGTGGGGG + Intronic
961511489 3:127406556-127406578 TGGGCCGAGGCAGGCTGGGGAGG - Intergenic
961724180 3:128915207-128915229 TGGATCGAGACAGGTGGAGCTGG - Exonic
961919197 3:130408271-130408293 GGGGTGGTGGCAGGGGGTGGGGG + Intronic
962629790 3:137264218-137264240 TGGGTGGAGGCTGGGGGTGTGGG - Intergenic
966212679 3:177469403-177469425 AGGTTTGAGGCTGGTGGTGGTGG + Intergenic
966943963 3:184764599-184764621 TGGCTTGAGGGTGGTGGTGGTGG - Intergenic
967158820 3:186717834-186717856 TGGGTGGTGGGTGGTGGTGGTGG - Intronic
967158910 3:186718097-186718119 TGGGTGGTGGTTGGTGGTGGTGG - Intronic
967158988 3:186718313-186718335 TGGGTGGTGGTGGGTGGTGGTGG - Intronic
967159001 3:186718346-186718368 TGGGTGGTGGTGGGTGGTGGTGG - Intronic
968048169 3:195635487-195635509 GGGGTCGGGGCAGGGGATGGGGG - Intergenic
968099235 3:195954133-195954155 GGGGTCGGGGCAGGGGATGGGGG + Intergenic
968306442 3:197654434-197654456 GGGGTCGGGGCAGGGGATGGGGG + Intergenic
969479769 4:7441670-7441692 TGGGCTGGGGCAGGAGGTGGAGG - Intronic
969673228 4:8601202-8601224 CCGGTCGTGGGAGGTGGTGGAGG + Exonic
969683038 4:8653643-8653665 GGGGTCTGGGCAGGTGGTGGGGG + Intergenic
972778651 4:42266240-42266262 TGGGGAGTGGAAGGTGGTGGGGG - Intergenic
973737668 4:53888668-53888690 TGGGTCCAGGTGTGTGGTGGGGG + Intronic
974474691 4:62363270-62363292 GGGGTTGAGGTAGGGGGTGGGGG - Intergenic
976009988 4:80475360-80475382 TTGGTCCAGGGAGGTGGTGGAGG + Intronic
976107921 4:81639554-81639576 TGGGTGGCAGCAGGGGGTGGGGG + Intronic
976157096 4:82157948-82157970 TGGGGCTAGTCAGGGGGTGGTGG + Intergenic
976890980 4:90047355-90047377 TAGGTTGAGGCAGGTGGGGCTGG + Intergenic
976948400 4:90798861-90798883 TGGGGGGAGGCAGTGGGTGGTGG + Intronic
978339524 4:107707380-107707402 TGGGTCTGGCCTGGTGGTGGAGG + Intronic
979167173 4:117549527-117549549 TGTGTCCAGGCCAGTGGTGGAGG - Intergenic
979660103 4:123243585-123243607 TGGGGCCTGTCAGGTGGTGGGGG + Intronic
980152236 4:129061640-129061662 TGGGTCCAGTCTGGTGGTGGGGG + Intronic
981420037 4:144538921-144538943 TGAGTGGAGGCAGGTGATGGTGG - Intergenic
982184701 4:152783783-152783805 TTGGTGGAGGCAGTTGGTAGGGG + Intronic
982507111 4:156233333-156233355 TGGGTCCTGCCAGGGGGTGGGGG - Intergenic
982807464 4:159784184-159784206 TGTGTCAAGGCAGGGGGTGGGGG - Intergenic
983427892 4:167609936-167609958 AGGGTCTAGGCAGGTGGCTGAGG + Intergenic
983851423 4:172585409-172585431 TGGGGCGTGTCAGGAGGTGGAGG - Intronic
984324956 4:178241025-178241047 TGGGGAGGGGCAAGTGGTGGTGG + Intergenic
985673405 5:1218025-1218047 CGGGAGGAGGCAGGAGGTGGTGG - Intronic
985843491 5:2327174-2327196 TGGGTAGGGGCAGCTGATGGTGG + Intergenic
985949221 5:3210642-3210664 GGGGTCGAGGGTGGTGGGGGAGG + Intergenic
986235530 5:5906175-5906197 TGAGTCCAAGAAGGTGGTGGTGG - Intergenic
986308780 5:6535931-6535953 TGGATGGAGGCAGGATGTGGAGG - Intergenic
986880131 5:12159482-12159504 TGGGGCCAGGCAGGGGTTGGGGG + Intergenic
988135505 5:27165586-27165608 TGGGGCCTGTCAGGTGGTGGGGG - Intergenic
988300906 5:29425117-29425139 TGGCTCGAGGCTGGTGCAGGAGG - Intergenic
988813353 5:34806608-34806630 GGGGTCGGGGAAGGGGGTGGAGG + Intronic
989436484 5:41419108-41419130 TTGGCAGAGGCAGGGGGTGGGGG + Intronic
992276684 5:75128246-75128268 TGGGGCCTGGCAGGGGGTGGGGG + Intronic
992786298 5:80173665-80173687 TGGGTGGAGGTGGGTGGGGGAGG - Intronic
996729250 5:126701469-126701491 TGCATCCAGGCTGGTGGTGGTGG + Intergenic
996763991 5:127017102-127017124 TGGGGCCTGTCAGGTGGTGGGGG + Intronic
998501700 5:142638317-142638339 GGGGTCGTAGCAGGTGGAGGTGG - Intronic
998976326 5:147652861-147652883 TGGGGCCTGTCAGGTGGTGGGGG - Intronic
999085208 5:148882182-148882204 TGCGTCCAGGCAGCTGGTGAAGG - Intergenic
1000017443 5:157290503-157290525 TGGGGGTAGGCGGGTGGTGGTGG - Intronic
1000438115 5:161238491-161238513 TGGATGGGGGGAGGTGGTGGAGG + Intergenic
1001056274 5:168452814-168452836 TGGAACGAGGCGGGTGGTTGAGG - Intronic
1001289247 5:170444878-170444900 TGGGCTGAGGCAGCTGGAGGGGG - Intronic
1001483681 5:172105172-172105194 TGGGAAGAGCCAGGGGGTGGGGG - Intronic
1002292798 5:178211206-178211228 AGGGTCGAGGGAGGCGGGGGGGG + Intronic
1002371185 5:178756078-178756100 TGGGGTGGGGCTGGTGGTGGTGG + Intergenic
1003174941 6:3747333-3747355 GGCGTGGAGGCAGGTGCTGGGGG - Intronic
1004013841 6:11714384-11714406 CTGGTGGAGGGAGGTGGTGGAGG - Exonic
1004779863 6:18896292-18896314 TGGCTTGAGCCAGGAGGTGGAGG + Intergenic
1005048765 6:21665494-21665516 CGTGTCGCGGCAGGGGGTGGAGG + Intergenic
1006596583 6:35197343-35197365 TGGGAGGTGGCAGGTGGGGGAGG - Intergenic
1006675375 6:35758810-35758832 TGGGTTGAGCCAGGAGGTCGAGG + Intergenic
1006901802 6:37507696-37507718 AGGTTGGAGGTAGGTGGTGGTGG + Intergenic
1006901832 6:37507762-37507784 GGGGTGGGGGTAGGTGGTGGTGG + Intergenic
1006901848 6:37507790-37507812 GGGGTAGGGGTAGGTGGTGGGGG + Intergenic
1006901887 6:37507884-37507906 TGGGTGAGGGTAGGTGGTGGTGG + Intergenic
1006901907 6:37507932-37507954 GGGGTCGGGGTAGGTGGTGCTGG + Intergenic
1007311646 6:40951205-40951227 TGAGTGGAGGGAGGTGGTTGGGG - Intergenic
1008551833 6:52639977-52639999 TGGGTCAAGGTAGGTGGGGATGG + Intergenic
1008846126 6:55966440-55966462 AGGGTGGAGGTGGGTGGTGGAGG - Intergenic
1010931050 6:81803668-81803690 TGGGGCGAGGCAAGTGGTGATGG - Intergenic
1011252565 6:85388248-85388270 TGGTTCAAGGCTGGTTGTGGTGG - Intergenic
1012440354 6:99256584-99256606 TGCTTGGAGGCAGGTGGTGTGGG - Intergenic
1013059183 6:106615195-106615217 TGGGAAGAAACAGGTGGTGGTGG + Intronic
1013312923 6:108914444-108914466 CAGGTGGTGGCAGGTGGTGGTGG - Intronic
1013365325 6:109433342-109433364 TGGGTCCTGGCAGGGTGTGGTGG - Intronic
1014060445 6:117065340-117065362 TGGGGGGAGGGAGGGGGTGGCGG - Intergenic
1014136323 6:117894212-117894234 TGAGTAGAGGGAGGAGGTGGTGG + Intergenic
1015497579 6:133896700-133896722 TGGGTGAAATCAGGTGGTGGTGG + Intergenic
1016675979 6:146768804-146768826 TGGGTAGTGGCAGGTGTTGGTGG + Intronic
1016827775 6:148404579-148404601 GGGGGTGGGGCAGGTGGTGGGGG - Intronic
1017041230 6:150310099-150310121 TGGGTGGGGGCGGGTGGAGGTGG - Intergenic
1017278140 6:152594016-152594038 GGGGCGGAGGCAGGGGGTGGGGG - Intronic
1017521808 6:155209187-155209209 TGGGGAGAGGCAGTTGGTGAGGG - Intronic
1017916224 6:158833832-158833854 TGGATCGTGGCTGGCGGTGGTGG - Intergenic
1018666262 6:166141204-166141226 GAGGAAGAGGCAGGTGGTGGGGG - Intergenic
1018722502 6:166583446-166583468 TGGGAAGAAGCAGCTGGTGGTGG + Intronic
1019257474 7:61379-61401 TGGGGCCAGGCACGTGGGGGAGG - Intergenic
1019576865 7:1741796-1741818 TGGGTGGAGGCAGGTGTGGGTGG - Intronic
1019578887 7:1750424-1750446 TTGGGCGAGGAAGGAGGTGGAGG + Intergenic
1019618125 7:1975803-1975825 TGGGTCCCGGGAGGTGCTGGGGG - Intronic
1019743852 7:2688679-2688701 TGGGGCGAGCCAGGTGGGTGCGG + Intronic
1020964991 7:14854441-14854463 GGGGTGGAGGCAGGTGGTTATGG + Intronic
1022508621 7:30921826-30921848 TGGGTCTAGGCAGGTATTAGGGG + Intronic
1022577694 7:31514122-31514144 TGGGTAGAGGCTGCTGGAGGGGG + Intronic
1022714457 7:32886195-32886217 TGGGTAGAGGCCGGACGTGGTGG - Intronic
1023411657 7:39894307-39894329 TGGAAGGAGGCAGGTGGGGGAGG - Intergenic
1023561143 7:41474482-41474504 TGTGTGGAGACAGGGGGTGGGGG - Intergenic
1023730253 7:43185015-43185037 TGGGGCCTGGCAGGGGGTGGGGG - Intronic
1024735800 7:52303022-52303044 TGGGGGCAGGGAGGTGGTGGTGG + Intergenic
1025057967 7:55780359-55780381 GGGGCCGAGGCAGGTGGGAGAGG - Intergenic
1025211214 7:57020423-57020445 TGGGGCAGGGCCGGTGGTGGAGG - Intergenic
1025660741 7:63556424-63556446 TGGGGCAGGGCCGGTGGTGGAGG + Intergenic
1026000895 7:66558355-66558377 TGGGCCTAGGCAGGGGGTGCAGG - Intergenic
1026105746 7:67419365-67419387 TGGGTAGGGGTGGGTGGTGGGGG + Intergenic
1026844947 7:73693522-73693544 AGGGTCCAGGCAGGCGGAGGGGG + Intronic
1027532512 7:79353804-79353826 TGGGTGCTGGCAGGGGGTGGTGG + Intronic
1027971074 7:85082856-85082878 TGTATATAGGCAGGTGGTGGAGG + Intronic
1028634530 7:92972273-92972295 TGGGTGGAGGTTGGGGGTGGCGG + Intergenic
1029613938 7:101644668-101644690 TGGCTGGGCGCAGGTGGTGGGGG + Intergenic
1030528867 7:110687203-110687225 TGGGTAGAATGAGGTGGTGGAGG - Intronic
1032403797 7:131641586-131641608 AGAGCGGAGGCAGGTGGTGGTGG - Intergenic
1032716759 7:134515372-134515394 TGTGTCGGGGCGGGGGGTGGGGG + Intergenic
1033120745 7:138664828-138664850 AGGGTCGAGGGCGGGGGTGGGGG - Intronic
1034414982 7:150959573-150959595 TGGGGCCAGCCAGCTGGTGGGGG + Exonic
1034422117 7:150995769-150995791 TGGGTCGGGGCAGAGGGAGGAGG - Intronic
1035125983 7:156607909-156607931 TGGGCCGAGGGTGGTCGTGGGGG - Intergenic
1035484695 7:159213647-159213669 TGGGTGGAGGCAGATACTGGTGG + Intergenic
1035688956 8:1547403-1547425 TGGGTGGAGGCAGGGGGAGAGGG + Intronic
1036509318 8:9385975-9385997 TGGGTTGGGGCTGGTTGTGGAGG + Intergenic
1036784524 8:11677171-11677193 TGGGGAGAGGGAGGTGGGGGAGG + Intronic
1037374316 8:18211583-18211605 TGGGGCCAGGCAGGTGGTGGGGG - Intronic
1037773090 8:21814514-21814536 TGGGTGGAGGGATGAGGTGGTGG - Intergenic
1037833788 8:22204433-22204455 TGAGTCGGGGCAGGGCGTGGTGG + Intronic
1038328328 8:26588999-26589021 TGGCGAGAGGCAGGAGGTGGGGG - Intronic
1038494111 8:27989784-27989806 TGGGTGGAGGCATTGGGTGGAGG - Intronic
1039475445 8:37837256-37837278 TGGGTTGAGGCGGGTGGGTGAGG + Intronic
1039714682 8:40094712-40094734 TAGGTGGGGGAAGGTGGTGGTGG - Intergenic
1039939401 8:42076421-42076443 GAGGTCGAGGCAGGGGGTTGGGG - Intergenic
1040666450 8:49639690-49639712 TGGGTGGATGCAGGTGACGGCGG - Intergenic
1041276010 8:56157887-56157909 TGGGTGGGGGCTGGGGGTGGGGG + Intergenic
1042090202 8:65151332-65151354 TGGGTAGAGGAGAGTGGTGGTGG + Intergenic
1042575580 8:70215216-70215238 TGGGTGGAGGGTGGTGGAGGGGG - Intronic
1042946727 8:74162470-74162492 TGGGTTCTGTCAGGTGGTGGGGG + Intergenic
1044549742 8:93498458-93498480 TTGGTGGAGGCAGGTGGGGTGGG - Intergenic
1045964983 8:108014682-108014704 TGGGGCCTGTCAGGTGGTGGGGG + Intronic
1048038509 8:130701465-130701487 TGGTTTCAGGCAGGTAGTGGAGG + Intergenic
1049504887 8:142991034-142991056 TGGGTGGAGGCTGTTGGTGGTGG - Intergenic
1049504921 8:142991140-142991162 TGGGTGGAGGCTGTGGGTGGTGG - Intergenic
1049504925 8:142991153-142991175 TGGGTGGAGGCTGTGGGTGGAGG - Intergenic
1049504932 8:142991173-142991195 TGGGTGGAGGCTGTGGGTGGTGG - Intergenic
1049504939 8:142991193-142991215 TGGGTGGAGGCTGTGGGTGGTGG - Intergenic
1049504953 8:142991235-142991257 TGGGTGGAGGCTGTGGGTGGAGG - Intergenic
1049654558 8:143791963-143791985 TGGGTCAGGGCAGGTCGGGGGGG - Intronic
1049833109 8:144714430-144714452 TGGGTGCAGGAAGGTGGTGAAGG + Intergenic
1050361674 9:4836541-4836563 TGGGTGGGAGCAGGTGTTGGAGG + Intronic
1050502751 9:6315645-6315667 TGGCTCTGGGCTGGTGGTGGGGG - Intergenic
1050515985 9:6445001-6445023 TGGGTTGAGGCCGGTCATGGTGG + Intronic
1050888787 9:10797161-10797183 TGGGGCCTGTCAGGTGGTGGGGG - Intergenic
1051200040 9:14607318-14607340 TGGCTTGAGCCAGGAGGTGGAGG + Intergenic
1051294631 9:15582770-15582792 TGGGGCCTGGCAGGAGGTGGGGG + Intronic
1051302824 9:15671511-15671533 TGGGGCCTGGCAGGGGGTGGGGG - Intronic
1052005393 9:23341755-23341777 TGGGGTGAGGAGGGTGGTGGAGG + Intergenic
1053287968 9:36862077-36862099 TGTGTGGAGGCAGCTGGTAGAGG + Intronic
1053322825 9:37115560-37115582 TTGGTCTAGGCAGGGCGTGGTGG + Intergenic
1053447840 9:38166559-38166581 TGGGGCGGGGGTGGTGGTGGTGG + Intergenic
1054447832 9:65386317-65386339 GGGGTCCAGGCATGTGGCGGTGG - Intergenic
1054946900 9:70805220-70805242 TGGGGTGGGGGAGGTGGTGGTGG + Intronic
1057151516 9:92800109-92800131 TGGGGCCTGTCAGGTGGTGGGGG + Intergenic
1057229125 9:93308331-93308353 TGGGGCCAGGCTGCTGGTGGAGG - Exonic
1057374630 9:94508709-94508731 TGGTTCGAGGCTGGGGGTTGGGG + Intergenic
1057818827 9:98315736-98315758 AGGGTCCAGCCTGGTGGTGGTGG + Intronic
1057826669 9:98377213-98377235 TGGGTAGTGGCAGGAGGGGGTGG + Intronic
1058218590 9:102266780-102266802 AGGGTAGTGGCAGGGGGTGGGGG - Intergenic
1059336985 9:113575139-113575161 GGCATCCAGGCAGGTGGTGGTGG + Intronic
1059365097 9:113780800-113780822 TGGGGCAGGGCGGGTGGTGGAGG - Intergenic
1060389737 9:123268058-123268080 GGGCTCGGGGCAGGTGTTGGAGG - Intronic
1060549363 9:124477796-124477818 GGGGGCGGGGCAGGTGGGGGAGG - Intronic
1060662754 9:125414054-125414076 TGGGCCCAGGAAGGAGGTGGTGG + Intergenic
1060755721 9:126211863-126211885 TGGGTGGATGGAAGTGGTGGTGG + Intergenic
1060826755 9:126692152-126692174 TGGGTAGGGACAGATGGTGGTGG - Intronic
1061116287 9:128614689-128614711 TGAGTCCAGGCAGGAGGTTGAGG + Intronic
1061329193 9:129881548-129881570 TTTGTAGAAGCAGGTGGTGGTGG + Exonic
1061406289 9:130394594-130394616 TGGGGCGAGGCTGGGGGTTGGGG + Intronic
1061406415 9:130395100-130395122 GGGTTCAAGGTAGGTGGTGGGGG + Intronic
1061412952 9:130431003-130431025 TGGGTAGAGGGGGGTGGGGGTGG + Intronic
1062100142 9:134723696-134723718 TGGGGCGAGGCAGGGGCAGGTGG + Intronic
1062243548 9:135552188-135552210 AGGGTCGAGGCTGGTGGTCCAGG + Intergenic
1062265493 9:135684909-135684931 CGGGGCGAGGCAGGTGCTGTTGG + Intergenic
1062361453 9:136190218-136190240 TGGGATGAGGCAGGGGGAGGGGG - Intergenic
1062398238 9:136361211-136361233 TGGGGCGAGGTGGGAGGTGGAGG - Intronic
1062471463 9:136707447-136707469 TGGGATGAGGTAGGTGGAGGTGG + Intergenic
1062513915 9:136922704-136922726 TGGGCCTGGGCACGTGGTGGAGG + Intronic
1062513930 9:136922743-136922765 TGGGCCTGGGCATGTGGTGGAGG + Intronic
1062533350 9:137011150-137011172 TGGGGCGGGGAAGGCGGTGGGGG - Intronic
1062556026 9:137113814-137113836 TGGGTCGGGGCAGGGGAGGGAGG + Intronic
1062623597 9:137433429-137433451 TGGGTCCAGGCAGGAGGGGGAGG - Intronic
1062627640 9:137450468-137450490 AGGGAAGAGGCATGTGGTGGGGG - Intronic
1062655946 9:137604828-137604850 TTGGGCGATGCAGGTGTTGGGGG + Intergenic
1203774348 EBV:64501-64523 CGCGTAGAGGCAGGTGGTTGAGG - Intergenic
1185618174 X:1435920-1435942 TGGAACCAGGCAGGTAGTGGTGG - Intronic
1185722765 X:2395330-2395352 TGGGGCCAGCCAGGGGGTGGAGG + Intronic
1185927213 X:4160922-4160944 TTGGCGGAGGCAGGTGGTGAGGG + Intergenic
1187016632 X:15335408-15335430 GGGATCGTGGCGGGTGGTGGAGG - Intronic
1189383722 X:40520010-40520032 AGGGTCAAGGCAGGAGGAGGGGG + Intergenic
1189579152 X:42387424-42387446 TGGGTAGTGGCAGGTGGAGAGGG + Intergenic
1190307371 X:49092426-49092448 TTGGTCCAAGCAGGTGGTGGGGG - Intronic
1190320715 X:49177752-49177774 TGGGTGTAGACATGTGGTGGTGG + Intronic
1190981200 X:55457946-55457968 TTGGGTGGGGCAGGTGGTGGTGG + Intergenic
1190987498 X:55515234-55515256 TTGGGTGGGGCAGGTGGTGGTGG - Intergenic
1191850354 X:65581525-65581547 TGGGGCGGGGCGGGGGGTGGTGG + Intergenic
1192183532 X:68930800-68930822 TGGGGTGGGGCAGGGGGTGGGGG + Intergenic
1192543552 X:71994781-71994803 TGGGGCGAGACTGGTGATGGGGG + Intergenic
1192623052 X:72699268-72699290 GAGGCCGAGGCAGGTGGAGGGGG + Intronic
1193679614 X:84502243-84502265 TGGGGCGAGGTTGGGGGTGGGGG - Intronic
1195476374 X:105290372-105290394 TGGGTGTAGGTAGGAGGTGGTGG + Intronic
1196373147 X:115001098-115001120 GGGGGTGGGGCAGGTGGTGGTGG + Intergenic
1198219106 X:134583719-134583741 GGGGTGGAGGGAGGTGGGGGCGG - Intronic
1198328640 X:135600343-135600365 TGGGTCCTGTCAGGTGGTGGGGG - Intergenic
1199236412 X:145499196-145499218 TGAGTCAAGGCAGATGGTGACGG + Intergenic
1199978732 X:152909268-152909290 TGGGTGGCAGCAGGGGGTGGGGG - Intergenic
1200225208 X:154413287-154413309 TGGGCAGAGGCAGGTGGGGCCGG - Intronic