ID: 1082086864

View in Genome Browser
Species Human (GRCh38)
Location 11:48057556-48057578
Sequence GTCGAGGCAGGTGGTGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 931
Summary {0: 1, 1: 0, 2: 1, 3: 52, 4: 877}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086856_1082086864 -2 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086857_1082086864 -3 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086851_1082086864 21 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086848_1082086864 26 Left 1082086848 11:48057507-48057529 CCAGGCCAGTCACGGGCAGCCTT 0: 1
1: 0
2: 0
3: 13
4: 138
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086859_1082086864 -10 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877
1082086853_1082086864 7 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG 0: 1
1: 0
2: 1
3: 52
4: 877

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086864 Original CRISPR GTCGAGGCAGGTGGTGGAGG TGG Intronic
900141675 1:1141468-1141490 GTGGGGGCGGGGGGTGGAGGCGG - Intergenic
900243383 1:1627132-1627154 GGGAAGGCTGGTGGTGGAGGTGG + Exonic
900270937 1:1788311-1788333 GTGGCTGCAGGAGGTGGAGGAGG - Intronic
900283641 1:1888940-1888962 TTCGAGGCTGGGGATGGAGGTGG - Intronic
900953901 1:5875218-5875240 GTCAAGGAAGGGGGTGGTGGTGG - Intronic
900975066 1:6011720-6011742 TCCAAGGCAAGTGGTGGAGGTGG + Intronic
901085301 1:6607796-6607818 GTCGAGGCAGGTGGATCACGAGG - Intronic
901303070 1:8213585-8213607 GGGCAGGCAGGTGGGGGAGGAGG + Intergenic
901304499 1:8222905-8222927 GTGGTGGCGGGTGGTGGGGGGGG + Intergenic
901309993 1:8261951-8261973 GCCGAGGCAGGTGGACGATGAGG - Intergenic
901330240 1:8402099-8402121 GTCGAGGCAGGTGGATCACGAGG - Intronic
901582552 1:10257160-10257182 GTCGAGGCAGGTGGATCAGGAGG - Intronic
901663296 1:10812636-10812658 GTAGTGGCAGGGGGTCGAGGAGG - Intergenic
901809971 1:11761993-11762015 TTCGGGGCAGAGGGTGGAGGAGG + Exonic
902180694 1:14686295-14686317 GTCGAGGCAGGTGGATCATGAGG - Intronic
902431008 1:16363134-16363156 GCCGAGGCAGGTGGAAGATGAGG - Intronic
902646040 1:17798500-17798522 GGAGAGGGAGTTGGTGGAGGGGG + Intronic
902828652 1:18995461-18995483 GTGGAGGGAGGAGGAGGAGGAGG - Intergenic
902939345 1:19788839-19788861 GCCGAGGCAGGTGGATCAGGAGG + Intronic
902941024 1:19800108-19800130 GTCGCGATGGGTGGTGGAGGTGG - Intergenic
903221902 1:21873903-21873925 GGTGAGGCAGGGGGTGGAGAGGG - Exonic
903365269 1:22802097-22802119 GTCCAGGCAGAGAGTGGAGGAGG + Intronic
903420959 1:23217540-23217562 GGCGAGGGAGGAGCTGGAGGAGG - Intergenic
903785983 1:25861682-25861704 GTCAAGGGAGGTGCTGGAGAGGG - Exonic
904016879 1:27428520-27428542 GTTGAAGCAGGTGGAGGGGGAGG + Intronic
904034304 1:27550794-27550816 GGCAGGGCAGGGGGTGGAGGAGG + Exonic
904255963 1:29255092-29255114 GTAGAGGGAGAGGGTGGAGGAGG + Intronic
904262086 1:29293706-29293728 GTCGAGGCAGGTGGATCACGAGG - Intronic
904745704 1:32709483-32709505 GTGGAGGCAGGTGGCTCAGGAGG - Intergenic
904852978 1:33472944-33472966 GTTGAGGGAGGTTTTGGAGGTGG + Intronic
905364030 1:37439118-37439140 GAGGTGGCAGGTGGTGGTGGTGG - Intergenic
906032709 1:42733963-42733985 CACAAGGCAGGTGGTGGAGGAGG + Exonic
906174528 1:43759209-43759231 GCCGAGGCAGGTGGATCAGGAGG + Intronic
907283444 1:53365723-53365745 CACGGGGCAGGTGGTGGTGGTGG - Intergenic
907367175 1:53971669-53971691 GTGGAGTCCGGTGGTGGTGGTGG - Intergenic
907392621 1:54168260-54168282 GGAGAGGGAGGTGGTGGTGGTGG - Intronic
907451813 1:54550277-54550299 GTTGAGTCTGGGGGTGGAGGTGG + Intronic
908372342 1:63495665-63495687 GTGGAGGAAGGTGGGGGTGGGGG + Intronic
908519036 1:64923148-64923170 ATGGAGCTAGGTGGTGGAGGAGG - Intronic
908681646 1:66668421-66668443 GTCGAGGCAGGTGGATCATGAGG - Intronic
909406255 1:75292755-75292777 GAGGAGGCAGGAGGTGAAGGAGG + Intronic
909424817 1:75510906-75510928 GCCGAGGCAGGTGGATGACGAGG + Intronic
910647038 1:89525066-89525088 GCCGACCGAGGTGGTGGAGGAGG + Intronic
910760712 1:90728788-90728810 ATCGAGGGAGGAGGAGGAGGAGG + Intergenic
910850445 1:91645186-91645208 GTCGATGGGGGTGGTGGGGGCGG - Intergenic
912141263 1:106731099-106731121 GTGGAGGAAGGAGGTGGAGGGGG + Intergenic
912171513 1:107106273-107106295 GTAGAAGCAGGAGGTGGAGCGGG - Intergenic
912392169 1:109310871-109310893 CTCGATGCAGGAGCTGGAGGTGG + Exonic
913542680 1:119836861-119836883 GTCGAGGCAGGTGGATCACGTGG + Intergenic
914361768 1:146941937-146941959 CTTGAGCCAGGAGGTGGAGGTGG - Intronic
914489855 1:148145020-148145042 CTTGAGCCAGGAGGTGGAGGTGG + Intronic
914750542 1:150532139-150532161 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
915068338 1:153244632-153244654 GGTGGTGCAGGTGGTGGAGGTGG + Intergenic
915068395 1:153245061-153245083 GTTGGTGCAGCTGGTGGAGGTGG + Intergenic
915173907 1:153998830-153998852 GTCCAGGCAGGAGGTTGAGGTGG - Intronic
915179082 1:154042660-154042682 GCCGAGGCAGGTGGATCAGGAGG - Intronic
915301747 1:154955674-154955696 GTGGAGGGAGGGAGTGGAGGTGG - Intronic
915304171 1:154968519-154968541 GTTGAGGCTGCTGGTGGAGACGG + Exonic
915602494 1:156930947-156930969 GTCCAAGCAAGTGATGGAGGTGG - Intronic
915613740 1:157017471-157017493 GTCGAGGCAGGTGGATCACGAGG + Intronic
915838871 1:159199769-159199791 GGCGTGGTAGGTGCTGGAGGAGG - Exonic
916473165 1:165143333-165143355 GTGGAAGCAGTTGGTGGGGGTGG + Intergenic
917068511 1:171123861-171123883 GCCGAGGCAGGTGGATGACGAGG + Intergenic
917284164 1:173407121-173407143 GGGGAGGCAGGTGGTGCGGGAGG + Intergenic
917951121 1:180037881-180037903 GCCGAGGCAGGTGGTTCACGAGG - Intronic
918238831 1:182604218-182604240 CTCCAGGCAGGTGGTGGGGAAGG + Exonic
918377099 1:183920267-183920289 GCCGAGGCAGGTGGATCAGGAGG - Intronic
919463136 1:197902499-197902521 GCCGTGGCAGCAGGTGGAGGCGG - Intergenic
919763364 1:201111966-201111988 GACGAGGAGGGTGGGGGAGGAGG - Intronic
920098139 1:203499910-203499932 GTGGAGGTAGGTGGTGGAGGTGG - Intronic
920098147 1:203499939-203499961 GTGGAGGTGGGTGGTGGTGGAGG - Intronic
920098154 1:203499958-203499980 GTGGAGGTGGGTGGTAGAGGTGG - Intronic
920098177 1:203500035-203500057 GTGGAGGTAGGTGGTGGTGGTGG - Intronic
920098191 1:203500079-203500101 GTGGAGGTGGGTGGTGGTGGTGG - Intronic
920098196 1:203500092-203500114 GCAGTGGTAGGTGGTGGAGGTGG - Intronic
920098202 1:203500114-203500136 GTGGAGGTAGGTGGTGGTGGTGG - Intronic
920098208 1:203500133-203500155 GTGGAGGTGGGTGGTGGTGGTGG - Intronic
920098215 1:203500152-203500174 GTGGAGGTGGGTGGTGGAGGTGG - Intronic
920098230 1:203500195-203500217 GTGGAGGTGGGTGGTGGTGGTGG - Intronic
920098257 1:203500277-203500299 GTGGAGGTGGGTGGTGGAGGTGG - Intronic
920098264 1:203500296-203500318 GTGGAGGTGGGTGGTGGTGGTGG - Intronic
920098271 1:203500315-203500337 GTGGAGGTGGGTGGTAGAGGTGG - Intronic
920098294 1:203500396-203500418 GTGGAGGCGGGTGATGGTGGTGG - Intronic
920098301 1:203500421-203500443 GTGGAGGTGGGTGGTGGTGGTGG - Intronic
920655028 1:207868612-207868634 GCAGAGACAGGTGGTTGAGGGGG - Intergenic
921070461 1:211654133-211654155 GTCCAGGCAGTGGGAGGAGGGGG + Intergenic
921121053 1:212137955-212137977 GTCGTGGCAGGAGGGGGAGAGGG + Intergenic
921859532 1:220027188-220027210 GTCGAGGCAGGTGGATCACGAGG + Intronic
922267103 1:223993339-223993361 GTCGAGGCAGGTGGATCACGAGG + Intergenic
922723040 1:227908536-227908558 GTCGTGGCTGGTGGAGCAGGGGG - Intergenic
922809172 1:228406499-228406521 GTCGAGGCAGATGGCGCAGGTGG + Exonic
923215347 1:231843661-231843683 TTAGAGGCAGGAGGTGCAGGTGG + Intronic
923594064 1:235346562-235346584 GTCGAGGCAGGTGGATCACGAGG + Intergenic
923724645 1:236495562-236495584 CTCGAGGCAGCAGGTGGAGGAGG - Intergenic
924437613 1:244056658-244056680 GTGGAGGGTGGTGGTGGGGGGGG - Exonic
924601421 1:245493011-245493033 GCCGAGGCAGGTGGATGACGAGG - Intronic
1063458462 10:6201441-6201463 GTCGAGGCGGGAGGGGGAGTGGG + Intronic
1064424422 10:15217863-15217885 GACGAGGCAGGTGGATGATGAGG - Intronic
1064611532 10:17107729-17107751 GTCGAGGCAGGTGGATCACGAGG - Intronic
1065168415 10:23004783-23004805 GTGGTGGCAGGAGGTGGGGGAGG - Intronic
1065188248 10:23189609-23189631 GTGGAGGGAGGAGGAGGAGGAGG + Intergenic
1065320277 10:24502756-24502778 GACGAGGCAGGTGGATGACGAGG + Intronic
1065473977 10:26114086-26114108 GTGGAGGGAGGTTGGGGAGGAGG - Intronic
1065953631 10:30674455-30674477 GTCGAGGCAGGTGGGTCATGAGG - Intergenic
1066507979 10:36065271-36065293 GAAGAGGCAGGTGGTGGAAGAGG - Intergenic
1067033697 10:42898160-42898182 GTAGAGGCGGGAGGCGGAGGCGG - Intergenic
1067112373 10:43409309-43409331 GGCGGGGGAGGCGGTGGAGGCGG + Intergenic
1067174054 10:43930245-43930267 GTCAAGGCAGGTGGTGCACCTGG + Intergenic
1067380507 10:45768907-45768929 ATCGTGGCAGGTGTTGGAGGAGG + Intronic
1067842939 10:49696489-49696511 GTTGAGGCGGATGCTGGAGGAGG - Intronic
1067888205 10:50109560-50109582 ATCGTGGCAGGTGTTGGAGGAGG + Intronic
1068874786 10:61984545-61984567 GTGGAGGCAGCAGGTGGGGGGGG + Intronic
1068912295 10:62391393-62391415 CTCGGGGGAGGGGGTGGAGGAGG - Intronic
1069028131 10:63566116-63566138 GTCGAGGCAGGTGGATCACGAGG - Intronic
1069362083 10:67654149-67654171 TTAGAAGGAGGTGGTGGAGGTGG - Intronic
1069477059 10:68743981-68744003 GCCGAGGCAGGTGGATGACGAGG - Intronic
1069919483 10:71807817-71807839 GAAGAGGCAGGTGGTGTAAGTGG - Intronic
1070101390 10:73390935-73390957 GTCGAGGCAGGTGGATCACGAGG + Intronic
1070156621 10:73839501-73839523 GCCGAGGCAGGCGGTCGGGGAGG + Intronic
1070297228 10:75172728-75172750 GTCGAGGCAGGTGGATCATGGGG - Intronic
1070639999 10:78161381-78161403 GTGCAGGCAGGTGGTGGGGCAGG - Intergenic
1070655086 10:78265898-78265920 GTCGAGACAGGTAGAGGAGCAGG + Intergenic
1070843793 10:79506183-79506205 GGCCAGGCAAGTGGAGGAGGTGG + Intergenic
1072041931 10:91614762-91614784 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1072306090 10:94108634-94108656 GGGGAAGCAGGGGGTGGAGGGGG - Intronic
1072679629 10:97497958-97497980 GACCAGGCAGGAGGGGGAGGTGG - Intronic
1073004896 10:100315811-100315833 GAGGAGGCAGGGGATGGAGGAGG - Intronic
1073057743 10:100713223-100713245 GTGGAGGCAGGGGGTGGAGTAGG - Intergenic
1073206899 10:101774439-101774461 GTGGAGGCAGGGGGTTCAGGGGG - Intronic
1073216022 10:101836726-101836748 GTCGAGGCAGGTGGATCACGAGG + Intronic
1073249132 10:102111187-102111209 GCCGAGGTAGGGGGTGGAGGGGG - Intronic
1073255770 10:102150077-102150099 GTAGGGGAAGGGGGTGGAGGAGG - Exonic
1073483149 10:103799549-103799571 GGCAAGGGAGGTGGTGGTGGGGG + Intronic
1073563452 10:104516336-104516358 GGGGAGGCAGCTGTTGGAGGAGG - Intergenic
1074666110 10:115727238-115727260 CTCGAAGCAGTTGCTGGAGGGGG - Exonic
1075015253 10:118905876-118905898 CTCCAGGCAGGAGGTGGTGGGGG + Intergenic
1075102841 10:119518301-119518323 GTCCTGGCAGGTGCTGGAGAGGG + Intronic
1075331558 10:121577861-121577883 GAAGAGGCTGGTGGAGGAGGAGG - Intronic
1075801815 10:125159303-125159325 GGCGGGGAAGGTGGGGGAGGCGG + Intronic
1076298011 10:129402648-129402670 GCAGAGGAAGGAGGTGGAGGTGG + Intergenic
1076468660 10:130703340-130703362 GTTGATGCAGGTGGATGAGGGGG - Intergenic
1076795927 10:132798511-132798533 GCCGAGGCAGCTGGATGAGGTGG + Intergenic
1077015990 11:399407-399429 GAGGGGGCAGGTGGAGGAGGGGG - Intronic
1077016019 11:399480-399502 GAGGGGGCAGGTGGAGGAGGGGG - Intronic
1077242464 11:1517780-1517802 GGGGAGGGAGGTGGTGGAGATGG - Intergenic
1077413527 11:2414269-2414291 GTCTGGGCAGGGGATGGAGGAGG - Intronic
1077420701 11:2448599-2448621 GCCAAGGCAGGTGGTGGGGCTGG + Intronic
1077728836 11:4705964-4705986 GTGGGGGCGGGTGGTGGTGGTGG + Intronic
1078237910 11:9503063-9503085 GTCGAGGCAGGTGGATCACGAGG - Intronic
1078590960 11:12640842-12640864 GTGGGGGGAGGTGGTGGGGGGGG - Intergenic
1079105564 11:17570136-17570158 GGCCAGGCAGGTGGTGGTGGTGG + Intronic
1079280075 11:19079420-19079442 GTTGACGCAGGTGGTGGAGAGGG + Intergenic
1079523916 11:21362297-21362319 CTCCAGGCTGGTGGTAGAGGGGG + Intronic
1080544151 11:33299237-33299259 GTCGAGGCAGGTGGATCACGAGG + Intronic
1081226156 11:40525210-40525232 GTCGAGGCAGGTGGATCATGAGG + Intronic
1082086864 11:48057556-48057578 GTCGAGGCAGGTGGTGGAGGTGG + Intronic
1082954686 11:58857429-58857451 GTCTAGGCAGTGGGAGGAGGAGG - Intronic
1082971743 11:59030126-59030148 GTCTAGGCAGTGGGAGGAGGAGG - Intronic
1083431114 11:62613894-62613916 GTCCAGGGAGGAGGAGGAGGAGG - Intronic
1083576486 11:63795659-63795681 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1083631154 11:64096161-64096183 GCCAAGGCAGGTGGTGGAGCCGG - Intronic
1083667537 11:64284150-64284172 GTCCCGGCAGGTGGAGGTGGTGG + Intronic
1083857508 11:65400459-65400481 GGGGAGGCACGTGGGGGAGGAGG - Intronic
1083953146 11:65967704-65967726 GTCCCCGCAGGTGCTGGAGGAGG + Exonic
1084185113 11:67467424-67467446 GTGGAGGGAGGGGGTGCAGGAGG + Intronic
1084213355 11:67633994-67634016 GTCCAGGCAGGTGGAAAAGGGGG - Intronic
1084550906 11:69841081-69841103 TGCCAGGGAGGTGGTGGAGGAGG - Intergenic
1084685603 11:70693121-70693143 GTTGGGGCTGGTGGAGGAGGTGG - Intronic
1085105888 11:73842703-73842725 GCCGAGGCAGGTGGATGATGAGG - Intronic
1085529257 11:77181965-77181987 GCGGAGGGAGATGGTGGAGGAGG + Exonic
1085780501 11:79403810-79403832 GTTGAGGGGGGTGGTGGGGGTGG + Intronic
1086104675 11:83134406-83134428 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1086862983 11:91947183-91947205 GGAGGGGCAGGTGGTGCAGGTGG + Intergenic
1088129275 11:106467578-106467600 GTCCATTCAGGTGGTTGAGGTGG - Intergenic
1088343545 11:108796749-108796771 GTGGAGGGAGGGGTTGGAGGTGG + Intronic
1088401315 11:109424126-109424148 CTGGAGGCTGGCGGTGGAGGCGG - Exonic
1089682990 11:120129821-120129843 GTCCAGGAATGTGGTGGTGGGGG - Intronic
1090414455 11:126531060-126531082 GTCGAGGCAGGTGGATCATGAGG - Intronic
1090659010 11:128867731-128867753 GACCAGGGAGGTGGTGGGGGAGG + Intergenic
1090739125 11:129641298-129641320 GAGGAGGCAGGTGGTGCAGGGGG - Intergenic
1090750481 11:129742675-129742697 GTCGAGGCAGGTGGATCATGAGG - Intergenic
1090963692 11:131580005-131580027 GCCGAGCCAGGAGGTGGAGATGG + Intronic
1091135171 11:133181905-133181927 GTGCAGGCAGATGTTGGAGGAGG - Intronic
1091333340 11:134748412-134748434 GTCCAAGCAGATGGGGGAGGAGG + Intergenic
1091577803 12:1755308-1755330 GTTGAGGCAGGTGGATAAGGAGG - Intronic
1091616843 12:2055879-2055901 GGGGAGGAGGGTGGTGGAGGTGG + Intronic
1092260477 12:6951044-6951066 GTAAAAGCAGCTGGTGGAGGAGG + Intronic
1092282658 12:7109237-7109259 GTGAAGGCCGGTGGGGGAGGAGG + Exonic
1092481263 12:8861178-8861200 GTAGAGGTTGGTCGTGGAGGTGG - Exonic
1092516770 12:9222981-9223003 GTCGAGGCAGGTGGACCATGAGG - Intergenic
1094404758 12:30105593-30105615 CTCCAGGAAGGTGGTGGAGAAGG - Intergenic
1095307729 12:40658073-40658095 GTTGAGGCAGGAGGAGGTGGAGG - Intergenic
1095776479 12:46015942-46015964 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1095951408 12:47783861-47783883 CTCGGAGCAGCTGGTGGAGGAGG - Exonic
1096256936 12:50068776-50068798 GTCAAGGCAGGTGAGGGAGATGG - Intronic
1096418945 12:51439518-51439540 GTGGGGGCAGGTGGTGGGAGTGG + Intronic
1096677094 12:53231901-53231923 GGCGAGGCGGCTGGGGGAGGGGG - Intronic
1097002238 12:55886706-55886728 GCTGAGGCAGGAGGAGGAGGAGG + Intergenic
1097029077 12:56079168-56079190 GTCCGGGCAGCTGGTGGGGGAGG + Intergenic
1098678301 12:73318598-73318620 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1098816551 12:75172321-75172343 TTGGAGGCAGGTGTTGGAGAAGG + Intronic
1098957261 12:76700375-76700397 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1100098990 12:91079330-91079352 GGTGAGGCAGGAGGGGGAGGAGG + Intergenic
1100863604 12:98832591-98832613 TTCCAGGCAGGTGGTTGAGCAGG - Intronic
1100871687 12:98916389-98916411 GTTTAAGGAGGTGGTGGAGGCGG + Intronic
1100879119 12:98996578-98996600 GTCGAGGCAGGTGGATCACGAGG + Intronic
1100990186 12:100243611-100243633 GTGGAGGCAGGCCCTGGAGGAGG - Intronic
1101522183 12:105494204-105494226 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1101784884 12:107874327-107874349 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1101997368 12:109534667-109534689 GTTGAAGCAGGTGGAGGAGGTGG - Exonic
1102139929 12:110606303-110606325 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1102146346 12:110657903-110657925 GTCCAGGCAGATGGGGGAGTTGG - Intronic
1102394247 12:112574200-112574222 GAGGAGGCAGGGGGTGGTGGAGG + Intronic
1102466801 12:113135025-113135047 GTCCAGGCAGATGTTGGAGGTGG - Intronic
1103216518 12:119205820-119205842 GTCGAGGCAGGTGGATCACGAGG + Intronic
1103225240 12:119281869-119281891 GTCGAGGGGGTAGGTGGAGGGGG - Intergenic
1103278036 12:119730581-119730603 GTCTCGCCAGGTGGTGGAGCTGG - Exonic
1103499305 12:121388552-121388574 GACTAAGCAGGTGGTGGGGGTGG + Intronic
1103907922 12:124336824-124336846 GCCGAGGCAGGTGGCGCCGGCGG + Exonic
1104596726 12:130125237-130125259 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1104643358 12:130481139-130481161 GAGGAGGCAGGTGGTGAGGGCGG + Intronic
1104665678 12:130646050-130646072 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665696 12:130646110-130646132 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665703 12:130646134-130646156 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665710 12:130646158-130646180 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665728 12:130646218-130646240 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665745 12:130646278-130646300 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104665778 12:130646386-130646408 GGAGAGGCAGGTGGTGAGGGAGG - Intronic
1104675874 12:130711879-130711901 ATCGAGCCAGGGCGTGGAGGAGG - Intronic
1104678097 12:130729436-130729458 GTGGGGGAAGGTGGGGGAGGGGG - Intergenic
1105013500 12:132771853-132771875 GGAGAGGCCGGTGGAGGAGGAGG - Exonic
1105087778 13:16229603-16229625 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105087983 13:16233360-16233382 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105088191 13:16237119-16237141 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105088397 13:16240879-16240901 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105088608 13:16244637-16244659 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105088812 13:16248395-16248417 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1105472356 13:20704602-20704624 TTCAAGGGAGGTGGTGGGGGTGG - Intronic
1105592975 13:21811540-21811562 GTCAGGGCAGGAGGAGGAGGAGG + Intergenic
1106102410 13:26706561-26706583 GTCAAGGCAGGGCGTGGAGGAGG - Intergenic
1106382247 13:29251500-29251522 GTCGAGGTAGATGGTGGTGATGG - Intronic
1106956400 13:34942884-34942906 GTCGGGGCCGCTGGCGGAGGCGG + Exonic
1107131719 13:36903357-36903379 GCCGAGGCAGGTGGTTCACGAGG - Intronic
1108063310 13:46553523-46553545 GGCGGGGCGGGTGGTGGCGGCGG + Exonic
1108311801 13:49199558-49199580 GTCGAGGCAGGTGGATCGGGAGG - Intronic
1108607127 13:52050950-52050972 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1108729906 13:53224392-53224414 GCCGAGGCAGGTGGTTCACGAGG + Intergenic
1108747289 13:53408817-53408839 GTCGTGGGAGTGGGTGGAGGGGG + Intergenic
1109225742 13:59692684-59692706 GTTGATGGAGGTGGTGGTGGTGG - Intronic
1110212204 13:72986923-72986945 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1111137402 13:84066249-84066271 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1111537362 13:89620407-89620429 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1111972040 13:94926655-94926677 GTTGAGGCTGGTGCTGCAGGTGG - Intergenic
1113090919 13:106616991-106617013 GTCAAGGCAGGAGGTGGGGGTGG + Intergenic
1113460423 13:110478593-110478615 GCCAAGGCAGGTGGCAGAGGTGG + Intronic
1113944040 13:114033738-114033760 GCCCAGGCAGGTGTGGGAGGTGG + Intronic
1114499924 14:23161181-23161203 GAGGAGCCAGGTGGTGGGGGTGG - Intronic
1114615321 14:24065118-24065140 GTCGGGGGAGGGGGTGGGGGTGG - Exonic
1115542395 14:34433727-34433749 GCCGAGGCAGGTGGATCAGGAGG + Exonic
1115809501 14:37091198-37091220 GTCGAGGCAGGTGGATCATGAGG + Intronic
1116310773 14:43324126-43324148 GCCGAGGCAGGTGGATGACGAGG + Intergenic
1116954952 14:50913869-50913891 GTAGAGACGGGTGGTGGTGGTGG + Intronic
1117390876 14:55261370-55261392 GTAGAGGCAGGTGGTTCATGAGG + Intergenic
1117480501 14:56139224-56139246 GCCAAGGAAGGTGGAGGAGGAGG + Intronic
1117673012 14:58127034-58127056 GTCGAGGCAGGTGGATCACGGGG - Intronic
1118008912 14:61590242-61590264 GTGGAGGCGGGAGGTGGTGGGGG + Intronic
1118911341 14:70064536-70064558 GTCGGGGGTGGTGGTGGCGGCGG + Intronic
1119386240 14:74259618-74259640 GTCGAGCCAAGTGGAGGAAGCGG + Exonic
1119425473 14:74532080-74532102 GTGGCGGGAGGTGGTGGGGGTGG - Intronic
1119600376 14:75971970-75971992 GTCAAGGCAGTGGGAGGAGGGGG - Intronic
1119702202 14:76762790-76762812 TTCGAGGGGGGTGGTGGAGGCGG - Exonic
1119891900 14:78189214-78189236 ATCTAGGCAAGTGGTGGTGGGGG - Intergenic
1121331968 14:93055438-93055460 GGCGAGTGAGGTGGGGGAGGGGG - Intronic
1121667848 14:95686305-95686327 GTCGGGGGAGGAGGGGGAGGAGG - Intergenic
1122236842 14:100335617-100335639 GCCGAGGCAGGTGGGGGGAGTGG - Intronic
1122338055 14:101006797-101006819 GCCGAGGCAGGTGGATGACGAGG + Intergenic
1122693885 14:103543661-103543683 GTACAGGGAGGTGGTGGGGGGGG - Intergenic
1122727009 14:103762765-103762787 GTGGGGGCAGGTGGTGGCGGCGG + Intronic
1122922295 14:104885060-104885082 GGCGATGCCGGGGGTGGAGGTGG + Intronic
1123814247 15:23960790-23960812 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1123833965 15:24169308-24169330 GCCGGGGCAGGGGGTGGAGCGGG - Intergenic
1123956647 15:25342805-25342827 TGAGGGGCAGGTGGTGGAGGGGG - Intronic
1124226816 15:27901974-27901996 GTCCTGGCAGGGGGCGGAGGGGG + Intronic
1124318730 15:28694638-28694660 CTTGAGCCAGGGGGTGGAGGTGG + Intergenic
1124586562 15:31014987-31015009 CTTGAGGCAGGGGGTGGGGGTGG + Intronic
1124822284 15:33058108-33058130 GGCGGGGCTGCTGGTGGAGGAGG + Intronic
1125599474 15:40907408-40907430 GCCCAGCCTGGTGGTGGAGGTGG - Intergenic
1126004813 15:44245957-44245979 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1127099881 15:55553546-55553568 GTGGTGGCAAGTGGTGGTGGTGG - Intronic
1127434473 15:58943325-58943347 GTCGAGGCAGGTGGATCATGAGG + Intronic
1127623029 15:60752616-60752638 CTCGAGGCGGGTGGGGGTGGGGG - Intronic
1128338409 15:66803141-66803163 GGGGAGGCAGGGGGAGGAGGGGG - Intergenic
1128433499 15:67622862-67622884 GTCGAGGCAGGTGGATCATGAGG + Intronic
1128551030 15:68598077-68598099 GATGATCCAGGTGGTGGAGGGGG - Intronic
1128580218 15:68804745-68804767 GTCGAGGCAGGTGGATCACGAGG - Intronic
1128740993 15:70083568-70083590 GTCTGGGAAGGTGGGGGAGGGGG - Intronic
1128888789 15:71312325-71312347 CTCGAGGCAGGGGGTGGAGTGGG + Intronic
1129242231 15:74258483-74258505 GGCAGGGCAGGTGGGGGAGGTGG + Intronic
1129248834 15:74297015-74297037 GAGGAGGCTGTTGGTGGAGGAGG - Intronic
1129676814 15:77636207-77636229 GAGGAGGCAGGAGGTGGAGCTGG + Intronic
1129800492 15:78410161-78410183 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1129867392 15:78919649-78919671 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1130263838 15:82380721-82380743 ACGGAGGAAGGTGGTGGAGGAGG + Intergenic
1130313556 15:82775162-82775184 GTCGAGGCAGGTGGGTCACGAGG + Intronic
1130843182 15:87720983-87721005 TTCGAGGAGGGTGGTGAAGGTGG - Intergenic
1131006763 15:88984831-88984853 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1131386817 15:92014851-92014873 ATTGAGGGAGGTGGAGGAGGAGG + Intronic
1131630620 15:94173376-94173398 GTCGAGGCGGGTGGATGATGAGG + Intergenic
1132302223 15:100783025-100783047 GCCGAGGCAGGTGTTGAAGGAGG + Intergenic
1132635132 16:940421-940443 GACAAGGCAGGTGGTGTGGGAGG + Intronic
1132636073 16:947348-947370 GCAGAGGCAGGTGGTGGAAAAGG + Intronic
1132794493 16:1712741-1712763 GTGGGGGCAGGTGGTCTAGGAGG - Intronic
1132871679 16:2118219-2118241 GTGGGGGCAGGAGGTGGCGGGGG + Exonic
1132884669 16:2177360-2177382 GTGGAGGCGGCTGGCGGAGGTGG - Exonic
1133020146 16:2963564-2963586 GGCGGGGCAGGGGGAGGAGGAGG + Intergenic
1133181023 16:4054799-4054821 GTCGAGGCAGGTGGATCACGAGG - Intronic
1133207499 16:4242121-4242143 GTGGCAGCAGGCGGTGGAGGGGG + Intergenic
1134172884 16:11982661-11982683 GCCGAGGCAGGTGGTTCACGAGG - Intronic
1134228402 16:12410226-12410248 GTCGAGGCAGGTGGATCACGAGG - Intronic
1135294256 16:21265454-21265476 ATAGAGGCTGGTGGTGGAGGTGG - Intronic
1135571345 16:23551683-23551705 GTCGAGGCAGGTGGATCACGAGG + Intronic
1136176046 16:28517543-28517565 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1136500950 16:30669493-30669515 GCCGCAGCAGGTGGTGGTGGAGG - Exonic
1136614969 16:31393134-31393156 GTCCCTGCAGGTTGTGGAGGGGG + Intergenic
1137244894 16:46694494-46694516 GTCCAGGAAGGAGGTGGGGGGGG - Intronic
1137988708 16:53131236-53131258 GTCGAGGCGGGGGGCGGCGGGGG + Intronic
1138283552 16:55790904-55790926 ATCAAGACAGGTGGTGGTGGGGG + Intergenic
1138285450 16:55806083-55806105 ATCAAGACAGGTGGTGGTGGGGG - Intronic
1138520712 16:57569363-57569385 GTTGATGGAGGTGGAGGAGGTGG - Intronic
1139466138 16:67155122-67155144 GTCTGGGCAGGTGGCGGCGGCGG + Exonic
1139536857 16:67581160-67581182 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1139629549 16:68220671-68220693 GTCGAGGCAGGTGGATCACGAGG + Intronic
1140046021 16:71441162-71441184 GTCGAGGACTGTGGGGGAGGCGG - Intergenic
1140363926 16:74367438-74367460 ATGGGGGCTGGTGGTGGAGGAGG - Intergenic
1140499585 16:75422327-75422349 GTCGAGGCAGGTGGATCACGAGG - Intronic
1141609623 16:85174050-85174072 CTCCAGGCAGCTGGTGGAAGAGG - Intronic
1142261630 16:89045151-89045173 GTCGGGGCTGGTGGTGAGGGTGG - Intergenic
1142286487 16:89173502-89173524 GCTGGGGGAGGTGGTGGAGGTGG + Intronic
1142416607 16:89946768-89946790 GACGAGCCAGGAGGTGAAGGTGG + Intergenic
1142697719 17:1643155-1643177 GTCGGGGGAGGGGGCGGAGGCGG - Intronic
1142968876 17:3597904-3597926 GCCGAGGCAGGTGGATGACGAGG - Intergenic
1143080955 17:4380987-4381009 GCCGAGGCAGGTGGTTCACGAGG + Intergenic
1143085003 17:4409354-4409376 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1143260971 17:5597975-5597997 GGAGAGGCAAGTGGTGGTGGAGG + Intronic
1143283858 17:5774650-5774672 GTGGAGGCTGGGGGTGGAGGTGG - Intronic
1143448643 17:7022988-7023010 GTCGGGGGCGGGGGTGGAGGTGG - Intergenic
1144115796 17:12089144-12089166 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1144188074 17:12815042-12815064 GTAAAAGCAGGTGGTGGGGGAGG - Intronic
1144295488 17:13871259-13871281 GACGAGGCAGGTGGATCAGGAGG - Intergenic
1144961623 17:19047422-19047444 GTAGGGGCAGGTGGAGGTGGTGG - Exonic
1144973537 17:19127102-19127124 GTAGGGGCAGGTGGAGGTGGTGG + Intergenic
1145209563 17:21003279-21003301 CTCGTGGCAGGTGGGGGTGGTGG - Intronic
1145313812 17:21716582-21716604 ATGGAGGCAGAGGGTGGAGGTGG + Intergenic
1145712254 17:26988556-26988578 ATGGAGGCAGAGGGTGGAGGTGG + Intergenic
1145861742 17:28216929-28216951 TTCCAGGCAGGGGGTTGAGGAGG + Intergenic
1145950347 17:28812340-28812362 GTCTAGGCAGGGGGAGGGGGAGG + Intronic
1145987791 17:29058984-29059006 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1146008237 17:29175823-29175845 GCCGAGGCAGGTGGATGACGAGG + Intronic
1146009641 17:29183313-29183335 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1146548743 17:33762150-33762172 CTCCAGGCAGGCTGTGGAGGTGG + Intronic
1146874949 17:36402186-36402208 GTCGAGGCAGGTGGATCACGAGG - Intronic
1147064439 17:37910694-37910716 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1147313149 17:39606740-39606762 GGCGGGGCAGGCGGCGGAGGTGG - Intronic
1147387800 17:40092095-40092117 GGAGAGGCGGGTGGTGGGGGCGG - Intronic
1147973027 17:44229997-44230019 GTTGAGGCTGCTGGTGGAGACGG + Intergenic
1148556984 17:48584732-48584754 GGCGAGACTGGTGGTGGTGGTGG - Intronic
1149498550 17:57134485-57134507 GGAAAGGCAGGGGGTGGAGGTGG - Intergenic
1149754331 17:59174927-59174949 GTGGGGGTAGGTGGAGGAGGTGG - Intronic
1150148694 17:62792590-62792612 GTTGATGGAGGTGGTGGTGGTGG - Intronic
1150273083 17:63879291-63879313 GTCGAGGCAGGTGGATCACGAGG - Intronic
1150366382 17:64589858-64589880 GACCAGGCTGGGGGTGGAGGTGG - Intronic
1150428262 17:65094463-65094485 GTTGAGCCAGTTGGTAGAGGTGG - Intergenic
1150440790 17:65189759-65189781 GTGGAGGAAGGTGGTTGAGGAGG + Intronic
1150832847 17:68539765-68539787 GACAAGGCACGTGGTGGTGGAGG + Intronic
1151012279 17:70514589-70514611 GTCGAGGCGGGTGGTTCATGAGG + Intergenic
1151150887 17:72085427-72085449 GTCAAGGCAGGTGGACCAGGAGG - Intergenic
1151231356 17:72687475-72687497 GTCGAGGCAGGTGGATCAAGAGG - Intronic
1151345130 17:73496775-73496797 GTCGGGGCAGGGAGTGGAGGGGG - Intronic
1151462257 17:74261455-74261477 GTGGGGACAGGTGGTGGGGGTGG - Exonic
1151526096 17:74669462-74669484 GTCGAAGAGGGTGGTGGTGGTGG - Intergenic
1151784825 17:76270393-76270415 GTGGTGGAAGGTGGTGGGGGAGG - Exonic
1152200876 17:78945219-78945241 CTCGAGGGAGGTGGTGTCGGGGG - Intergenic
1152240213 17:79157050-79157072 GGCCAGGGAGGCGGTGGAGGTGG + Intronic
1152268941 17:79312555-79312577 GTGGGGGCAGGTGGTGGGGCTGG + Intronic
1152441710 17:80313739-80313761 GGTGATGCTGGTGGTGGAGGTGG + Intronic
1152442252 17:80315939-80315961 GGTGATGCTGGTGGTGGAGGTGG + Intronic
1152471484 17:80492244-80492266 GGCGGGGCAGGTGGTGGTGCAGG + Intergenic
1152471542 17:80492429-80492451 GGCAGGGCAGGTGGTGCAGGTGG + Intergenic
1152592033 17:81218417-81218439 GCCAAGGCAGGTGGGCGAGGGGG + Intronic
1152755728 17:82086250-82086272 GAAGATGAAGGTGGTGGAGGTGG - Exonic
1152879912 17:82808773-82808795 GACGAGGCAGGTGGAGGGGCTGG + Intronic
1153156646 18:2157747-2157769 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1153214554 18:2807708-2807730 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1153635141 18:7106972-7106994 GTCGAGGAAAGCGGGGGAGGAGG - Intronic
1153712118 18:7810166-7810188 CTCGAGAAAGGTGGTGGGGGCGG - Intronic
1154034055 18:10781234-10781256 GTCGAGGCAGGTGGATCATGAGG + Intronic
1154280254 18:12996165-12996187 GTCCAGGCAGGAAGTGGTGGTGG + Intronic
1154404974 18:14082753-14082775 GTTGAGGCTGGAGGTTGAGGTGG - Intronic
1155043636 18:22085516-22085538 GCCGAGGCAGGTGGTTCATGAGG - Intergenic
1155263180 18:24065078-24065100 GCTGAGTCTGGTGGTGGAGGAGG + Intronic
1155366271 18:25051973-25051995 GTTGGGGCAGGTGGAAGAGGAGG - Intergenic
1156121873 18:33854244-33854266 GTGGAGGTAGAGGGTGGAGGGGG - Intronic
1156470144 18:37372477-37372499 GTCGTGGGATGGGGTGGAGGCGG + Intronic
1156852028 18:41739804-41739826 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1157048000 18:44125751-44125773 GTTGTGGCAGATGGAGGAGGTGG + Intergenic
1157382034 18:47227217-47227239 GGAGGGGCAGGTGGAGGAGGAGG - Intronic
1157658681 18:49419126-49419148 GTCAAGGCAGGTGGATCAGGAGG + Intronic
1157763450 18:50281424-50281446 GGCGAGGCGGGAGGTGCAGGAGG - Exonic
1157801303 18:50623580-50623602 GTCCAGGCAGGTGATGATGGTGG - Intronic
1158748389 18:60227995-60228017 GTCGTGGCAGAAGGTGAAGGGGG + Intergenic
1159812069 18:73027614-73027636 GCGGAAGCAGGAGGTGGAGGTGG - Intergenic
1159985229 18:74833751-74833773 CTCGGGCCAGGTGGTGGTGGTGG + Intronic
1160208697 18:76858806-76858828 GTGGAGGCAGGTGCAGGTGGAGG + Intronic
1160208767 18:76859026-76859048 GTGGAGGCAGGTGCAGGTGGAGG + Intronic
1160277157 18:77447817-77447839 GTCCAGGCAGCTGAGGGAGGTGG + Intergenic
1160329219 18:77977200-77977222 GGGGAGGCCAGTGGTGGAGGAGG - Intergenic
1160845508 19:1164380-1164402 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845539 19:1164496-1164518 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845566 19:1164596-1164618 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160845617 19:1164787-1164809 GTGGAGACAGGAGGAGGAGGAGG + Intronic
1160881667 19:1323558-1323580 CTCGGTGCAGGAGGTGGAGGGGG + Intergenic
1160927523 19:1554100-1554122 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1161184450 19:2907030-2907052 GTCCAGGCGGGGGGTGGGGGCGG + Intronic
1161296502 19:3523092-3523114 GCAGAGGCAGCTGGGGGAGGGGG - Intronic
1161554121 19:4930826-4930848 GTCCAGGCCGGCGCTGGAGGAGG + Exonic
1161706425 19:5824279-5824301 TTCGAGGCAGGCGGTGCAGGGGG - Exonic
1161973409 19:7596192-7596214 GGCGCGGCAGGTGCTGGGGGGGG + Intronic
1162370995 19:10279227-10279249 ATGGAGGCAGGAGGAGGAGGAGG + Intronic
1163256453 19:16158843-16158865 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1163743709 19:19032895-19032917 GGGGAGGCGGGTGGGGGAGGCGG - Intronic
1163789307 19:19297167-19297189 GGCGGGGCAGGTGGTGGCTGGGG + Exonic
1164099860 19:22045067-22045089 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1164103508 19:22081109-22081131 GCCGAGGCAGGTGGATGACGAGG - Intronic
1164479563 19:28601022-28601044 TTGGAGGCAGTTGGTGGAAGAGG + Intergenic
1164883268 19:31754527-31754549 CTCAAGGCAGAAGGTGGAGGGGG + Intergenic
1165063757 19:33217663-33217685 GGCCCGGCAGGTGGAGGAGGCGG - Intronic
1165313009 19:35039967-35039989 GGCGGGGCAGGAGCTGGAGGAGG - Intronic
1165323136 19:35098685-35098707 GGGGAGGCAGGAGGAGGAGGAGG + Intergenic
1165420807 19:35721088-35721110 GTTGGGGCACGTGGTGGAGAGGG - Exonic
1165491378 19:36125276-36125298 GTCCCGGCAGGAGCTGGAGGTGG + Intronic
1165772202 19:38386306-38386328 GCCGAGGGAGGTGATGGAGACGG - Exonic
1165868518 19:38953873-38953895 GTGCAGGTAGGTGGTAGAGGCGG + Intronic
1165885049 19:39071951-39071973 GCCGAGGCAGGTGGTTCACGAGG + Intergenic
1166210833 19:41305745-41305767 TTGTAGGCAGGTGGTGGTGGAGG - Exonic
1166211017 19:41306606-41306628 GCCGAGGCAGGCGCTGGTGGAGG - Exonic
1166538823 19:43592619-43592641 GACGTGGGAGGTGCTGGAGGAGG - Exonic
1166694055 19:44842344-44842366 GCCGAGGCAGGTGGAGCACGAGG + Intergenic
1166784285 19:45358421-45358443 GTCCAGGCAGGAGGTGATGGTGG - Intronic
1166809903 19:45508597-45508619 GTCGAGACAGCTGGTGTGGGGGG + Intronic
1166886165 19:45962179-45962201 GTCCAGGCAGGAGGTGACGGCGG + Intronic
1167000190 19:46741266-46741288 GTGGGGGCAGGAGGTGGAGTTGG + Intronic
1167286577 19:48601803-48601825 GTGGAAGGAGATGGTGGAGGAGG + Intronic
1167420144 19:49397902-49397924 GTCGAGGTAGGTGCTGGTGGTGG - Intronic
1167456965 19:49601520-49601542 GTCGGGGCAGGAGGTGGAGTGGG - Exonic
1167598668 19:50440874-50440896 CGCCAGGGAGGTGGTGGAGGAGG + Exonic
1167723767 19:51197327-51197349 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1167920048 19:52775772-52775794 GTCGAGGCAGGTGGATCACGAGG + Intronic
1168111029 19:54191361-54191383 GAGGATGCTGGTGGTGGAGGTGG + Exonic
1168240414 19:55086401-55086423 GCTGGGGCTGGTGGTGGAGGAGG - Exonic
1168507151 19:56945883-56945905 GTCTGGGCTGTTGGTGGAGGGGG + Intergenic
924964394 2:61802-61824 GCCGAGACAGGTAGTGGGGGAGG + Intergenic
925071760 2:974561-974583 GTCGAGGCTGCTGGTGAGGGAGG + Intronic
925610131 2:5695898-5695920 GAAGAGGCAGGGAGTGGAGGAGG - Exonic
926121119 2:10241590-10241612 GGCGAGGCAGGGGCTGGGGGCGG - Intergenic
926225241 2:10962267-10962289 GTCAAGGCACGGGGTGGAGTTGG + Intergenic
926483820 2:13431466-13431488 GTCATGGCAGGAGGTGAAGGAGG + Intergenic
926547211 2:14256301-14256323 GTCGAGGCAGGTGGATCACGAGG - Intergenic
927544189 2:23939015-23939037 GATGAGGGAGGTGGTGGTGGGGG + Intronic
927561526 2:24077051-24077073 GCTGAGGAAAGTGGTGGAGGTGG + Intronic
927747996 2:25640381-25640403 ATGGAGGCGGGGGGTGGAGGGGG + Intronic
927930064 2:27038232-27038254 GTCCAGGCAGGTGGGGTGGGAGG + Exonic
929052518 2:37850087-37850109 GTTGAGGGAAGTGGTGGTGGTGG - Intergenic
929507561 2:42540109-42540131 GTTGAGTCAGGTGAAGGAGGTGG + Intronic
929532119 2:42759924-42759946 GAGGATGCAGGTGGTGGAGCAGG - Intergenic
929776300 2:44933056-44933078 GTTGAGGTAGGAGCTGGAGGAGG - Intergenic
929995724 2:46825339-46825361 CTTGGAGCAGGTGGTGGAGGTGG - Intronic
930122379 2:47770410-47770432 GTCGAGGCAGGTGGATCATGAGG - Intronic
930135665 2:47902166-47902188 GTCGAGGCAGGTGGACCACGAGG - Intronic
930194225 2:48493237-48493259 GCCGAGGCAGGTGGATCAGGAGG - Intronic
930545986 2:52767559-52767581 GTCGAGGCAGGTGGATCACGAGG - Intergenic
930651837 2:53971098-53971120 GTCGGGGGAGGCGGTGGTGGCGG + Intronic
931805301 2:65798081-65798103 GTGGAGGAAAGGGGTGGAGGAGG + Intergenic
931967603 2:67550764-67550786 GTGGGGGCAGGAGGAGGAGGAGG - Intergenic
932010456 2:67972470-67972492 GTTGAGGGCGGTGGAGGAGGAGG - Intergenic
932208166 2:69902305-69902327 GTAGAGGAAGGAGGAGGAGGAGG - Intronic
932336167 2:70932650-70932672 GTTGGGGCAGGTGGTGGATGGGG - Intronic
932805901 2:74783183-74783205 GTCGAGGCAGGTGGATCATGAGG - Intergenic
933295561 2:80487049-80487071 GTCGAGGCGGGTGGATCAGGAGG + Intronic
933331190 2:80895237-80895259 GTCTAGGCAGGAGGGGGAGGAGG - Intergenic
933440807 2:82311246-82311268 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
933512725 2:83261759-83261781 GGCGGGGCAGGGGGTGGTGGTGG + Intergenic
933730934 2:85455851-85455873 GTGGAGGCAGGGTGGGGAGGAGG + Intergenic
934138336 2:89019477-89019499 GTGGAGGGGGGAGGTGGAGGAGG + Intergenic
934625223 2:95842746-95842768 GCCGAGGCAGGTGGATCAGGAGG + Intronic
934650416 2:96088245-96088267 GTGGAGGCAGGGGGAGGTGGTGG + Intergenic
934715949 2:96543630-96543652 GTCGATGGAGCAGGTGGAGGAGG - Intronic
934897588 2:98132279-98132301 GTCCAGGCAGGGAGTGGAGAAGG - Intronic
935654191 2:105407803-105407825 GCCTAGGCTGGTGGTGGTGGTGG - Intronic
935987123 2:108686090-108686112 GTCGAGGCAGGTGGATCACGAGG + Exonic
936546976 2:113400089-113400111 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
936559200 2:113521953-113521975 GCCAAGGCAGGGGGTGGGGGTGG + Intergenic
936686438 2:114832297-114832319 GCCGAGGCAGGTGGATCAGGAGG + Intronic
937435783 2:121879935-121879957 GCCGAGGCAGGTGGATGATGAGG + Intergenic
937854011 2:126659869-126659891 TTCAACGCAGGAGGTGGAGGAGG - Intronic
938263079 2:129909040-129909062 GGTGAGGCAGGGGCTGGAGGTGG - Intergenic
938758666 2:134403705-134403727 TTAGAGTCAGGTGGTGGAGGTGG + Intronic
942031765 2:171970185-171970207 GTCGAGGCAGGTGGATCACGAGG + Intronic
942090794 2:172488852-172488874 GCTGGGGCAGGTGGTGGTGGTGG + Intronic
942383564 2:175418839-175418861 GTCGAGGAAGGCGGGGGTGGAGG - Intergenic
943900713 2:193432457-193432479 GTGGAGGGAGGTGTTGGGGGTGG - Intergenic
944498193 2:200329706-200329728 GGCAAGGCAGGTGGGGAAGGGGG - Intronic
944566041 2:200991934-200991956 GTCGGGGCCGGGGGGGGAGGTGG + Intronic
944706287 2:202292224-202292246 GTCGAGGCAGGTGGATCATGAGG - Intronic
944930938 2:204518450-204518472 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
945031094 2:205664401-205664423 GAGGAGGAAGGTGGTGGTGGTGG - Intergenic
946173144 2:217907183-217907205 GTGATGGCAGGTGGTGGTGGGGG - Intronic
946278290 2:218647187-218647209 GTCGAGGCAGGTGGATCATGAGG + Intronic
946322190 2:218960599-218960621 GTAGAGGCAGGTGAGGAAGGCGG - Exonic
946458066 2:219845258-219845280 GTTGAGGCAGGATGAGGAGGAGG + Intergenic
946671004 2:222104506-222104528 GGTGAGGGAGGTGGAGGAGGTGG - Intergenic
946689598 2:222300374-222300396 GTCAAAGGAGGTGGGGGAGGGGG - Intronic
946794726 2:223338180-223338202 GTGGAGGTTGGGGGTGGAGGTGG + Intergenic
948005003 2:234601018-234601040 GCAGAGGCAGGTTGAGGAGGTGG + Intergenic
948230251 2:236344058-236344080 GTGGGGGGAAGTGGTGGAGGAGG + Intronic
948247383 2:236498231-236498253 GTCGAGGCAGGTGGATCACGAGG + Intronic
948547030 2:238740047-238740069 GCCAGGGCAGGAGGTGGAGGAGG + Intergenic
948577480 2:238964141-238964163 ATGCAGTCAGGTGGTGGAGGGGG - Intergenic
948648988 2:239427158-239427180 GTGGGGGCGGGTGTTGGAGGGGG - Intergenic
948725996 2:239934345-239934367 GGGGAGGCAGGAGGTGGAGTGGG - Intronic
948861996 2:240757186-240757208 GGCGAGGCAGGTGGAGGGGCTGG - Intronic
1168902387 20:1376089-1376111 GGGGTGGCAGATGGTGGAGGGGG - Intronic
1169028698 20:2391435-2391457 GTCGGGGCAGGAGGTTGTGGAGG + Intronic
1169799830 20:9503621-9503643 GTCCATTCAGTTGGTGGAGGAGG - Intergenic
1170155259 20:13263334-13263356 GTGGAAGCAGGGGGTGGTGGGGG - Intronic
1170235446 20:14099043-14099065 GCCGAGGCAGGTGGTTCACGAGG + Intronic
1170878869 20:20277274-20277296 GTTGATGCAGGTGATGGTGGAGG - Exonic
1171141503 20:22747730-22747752 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1171220550 20:23393177-23393199 CTGGAGGCAGGTGATGGAGCTGG - Intronic
1172016586 20:31879086-31879108 GTCGAGGCAGGTGGATCATGAGG + Intronic
1172346652 20:34206812-34206834 GTCGAGGCAGGTGGATCACGAGG - Intronic
1172800648 20:37573956-37573978 GTCCAGGCAGGTGGTGCGGCTGG + Intergenic
1172953639 20:38739366-38739388 GTGGGGGCAGGGGGTGGGGGAGG - Intergenic
1173146977 20:40533423-40533445 GTAGAGGCAAGTGGAGGAGTAGG - Intergenic
1173338188 20:42130300-42130322 ATGGAGGGAGGTGGTGGAGTTGG + Intronic
1173578978 20:44132865-44132887 GTGGAGGGGGGTGGTGGGGGTGG - Intronic
1173613451 20:44387644-44387666 GTGGAGGCAGGCGGGGGGGGGGG + Intronic
1173752329 20:45487325-45487347 GTCGGGGCTGGAGGTGGAGTGGG - Intergenic
1173880255 20:46406498-46406520 GGCGCGGCAGGCGGTGGAGAGGG - Intronic
1173902615 20:46601884-46601906 GAAGTGGCAGGGGGTGGAGGTGG + Intronic
1173998080 20:47355047-47355069 GTAGAAGCTGGTGGTGGTGGTGG - Intronic
1174214092 20:48902978-48903000 GTCTAGCCAGGTGATGGTGGGGG + Intergenic
1174607515 20:51771720-51771742 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1174666337 20:52261421-52261443 GTCCATGATGGTGGTGGAGGGGG + Intergenic
1174805605 20:53601943-53601965 GCCGAGGCAGGTGGATCAGGAGG + Intronic
1175073575 20:56355206-56355228 GTTGAGGCAGGAGGTTGAGGAGG - Intergenic
1175502388 20:59459816-59459838 GTGGAGGCAGCAGGTGGTGGAGG + Intergenic
1175522570 20:59611567-59611589 GTGGAGGAAGGAGGAGGAGGAGG + Intronic
1176005970 20:62862323-62862345 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1176519170 21:7812127-7812149 TCAGAGGCAGGTGCTGGAGGAGG + Intergenic
1176703995 21:10095833-10095855 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1176922404 21:14704046-14704068 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1177472456 21:21576676-21576698 GCCGAGGCAGGTGGACCAGGAGG + Intergenic
1177985720 21:27972497-27972519 CTAGAGGCAGGTGGCGGTGGGGG - Intergenic
1178514066 21:33230758-33230780 GTGGAGGCAGGAGGGGGAAGGGG + Intronic
1178653198 21:34442140-34442162 TCAGAGGCAGGTGCTGGAGGAGG + Intergenic
1179474080 21:41632184-41632206 GAAGAGGCAGGGGGTGGGGGAGG + Intergenic
1179648690 21:42792606-42792628 GCCGAGGCGGGTGGATGAGGAGG + Intergenic
1179650731 21:42806938-42806960 CCAAAGGCAGGTGGTGGAGGTGG - Intergenic
1179879192 21:44286392-44286414 GTGGAGTCAGGTGGTGGTGTAGG - Intronic
1180737035 22:18024735-18024757 GTCGAGGAAGGGGTTGGAGAAGG - Intergenic
1181033165 22:20157859-20157881 GCCGAGGCAGCAGTTGGAGGTGG - Intergenic
1181510144 22:23385373-23385395 GCCGAGGCAGCAGTTGGAGGTGG + Intergenic
1181528138 22:23501822-23501844 GTGGAGGCGGTGGGTGGAGGTGG - Intergenic
1181528143 22:23501835-23501857 GAGGTGGCGGGTGGTGGAGGCGG - Intergenic
1181528193 22:23501987-23502009 GTGGAGGCAGTGGATGGAGGTGG - Intergenic
1181741414 22:24924531-24924553 GTGGAGGTTGTTGGTGGAGGAGG + Exonic
1182205450 22:28620115-28620137 GTCGAGGCAGGTGGATCACGAGG + Intronic
1182471845 22:30553733-30553755 GTATAGGCAGGTGTGGGAGGTGG + Intergenic
1182551088 22:31101060-31101082 AACGGGGCAGGTGGTAGAGGCGG - Intronic
1183076491 22:35430742-35430764 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1183239909 22:36650031-36650053 GTCCAGGCAGGAGTTGGTGGTGG - Intronic
1183254884 22:36756031-36756053 GTGGTGGCAGGGGGTGGGGGAGG + Intergenic
1183367038 22:37412451-37412473 GTGGATGGAGGTGCTGGAGGAGG - Intronic
1183370004 22:37427071-37427093 CGCGAGGGAGGTGGTGGTGGTGG - Intronic
1183414853 22:37676211-37676233 GTCCAGGCTGGTGGCGGGGGGGG + Intronic
1183472904 22:38019036-38019058 GTGGAGGGAGGGGGTGGAAGAGG + Intronic
1183520057 22:38291638-38291660 CTCCAGGCAGGTGGTGGGTGGGG + Exonic
1183741663 22:39672136-39672158 GTGGAGGAAGGTTGTGGAGCAGG + Intronic
1183868599 22:40723629-40723651 GTTGTGGGAGGTGTTGGAGGAGG + Intergenic
1184034889 22:41913683-41913705 GGAGAGGCAGGAGGTGGAAGAGG + Intronic
1184236752 22:43187141-43187163 GGCGGGGCAGGGGGCGGAGGCGG - Intergenic
1184248201 22:43246202-43246224 GTAGAGGCAGGAAGTGAAGGAGG - Intronic
1184289710 22:43492020-43492042 GATGATGGAGGTGGTGGAGGTGG + Intronic
1184291292 22:43499319-43499341 GACGTGGGAGGTGGTGGTGGTGG + Intronic
1184291610 22:43500444-43500466 GGTGACGGAGGTGGTGGAGGTGG + Intronic
1184302265 22:43568634-43568656 CACAAGGCAGGTGCTGGAGGAGG + Intronic
1184362415 22:44026320-44026342 GTGGAGGCAGGAGGAGGAGCAGG + Intronic
1184634701 22:45817851-45817873 GTGGAGGCAGTTGGTGGCGGTGG - Intronic
1184754292 22:46507628-46507650 GGCGAGGCAGGAGGAGGAGGCGG - Intronic
1185411157 22:50683756-50683778 GGAGAGGGGGGTGGTGGAGGGGG + Intergenic
1185411162 22:50683769-50683791 GTGGAGGGGGGTGGTGGAGAGGG + Intergenic
1185411171 22:50683784-50683806 GGAGAGGGGGGTGGTGGAGGGGG + Intergenic
1185411177 22:50683797-50683819 GTGGAGGGGGATGGTGGAGGGGG + Intergenic
1185411189 22:50683824-50683846 GTGGAGGGGGGTGGTGGAGAGGG + Intergenic
949898015 3:8784681-8784703 GGCCAGGCAGGTGGGAGAGGGGG + Intronic
950496599 3:13337734-13337756 GGCCAGGCAGATGGAGGAGGTGG + Intronic
950553594 3:13682233-13682255 GTCCGGGCAGGAGGTGGTGGTGG + Intergenic
950590180 3:13931433-13931455 GCCAAGGGAGGTGATGGAGGTGG - Intergenic
950590225 3:13931724-13931746 GCAGAAACAGGTGGTGGAGGTGG - Intergenic
950710234 3:14808933-14808955 GTTGAGGGAGGTGGTAGAGTTGG - Intergenic
951107434 3:18761492-18761514 ATAGAGGTAGGTGGTGGGGGTGG + Intergenic
952398008 3:32938201-32938223 GTGGAGGCAGGAGGTGGCTGTGG - Intergenic
952470668 3:33647798-33647820 GCCGAGGCAGGTGGGTGACGAGG + Intronic
952644088 3:35635514-35635536 GTTGAAGCAGGTCCTGGAGGGGG + Intergenic
954104118 3:48399886-48399908 GGCAAGTCTGGTGGTGGAGGAGG + Intronic
954118537 3:48481012-48481034 TTCGACCCAGGTGGTGCAGGCGG + Intronic
954812390 3:53256082-53256104 GGCGGGGCAGGGGGAGGAGGCGG + Intergenic
954848279 3:53578507-53578529 GTCGAGTGAGGGCGTGGAGGAGG + Intronic
955687679 3:61562562-61562584 GTCGAGGAAGGTGGAGGCAGGGG + Intronic
955716372 3:61834578-61834600 GCCGAGGCAGGTGGATCAGGAGG + Intronic
958733905 3:97988567-97988589 GTGGTGGTAGGTGATGGAGGTGG + Intronic
958733998 3:97988943-97988965 GTGGTGGTAGGTGGTGGTGGGGG + Intronic
959082033 3:101812442-101812464 GTAGAGGCAGGTAGTGGTAGAGG - Intronic
959114146 3:102156012-102156034 GAGTAGGGAGGTGGTGGAGGGGG + Intronic
960924000 3:122779273-122779295 GTCGAGGCAGGTGGATCACGAGG - Intronic
961161468 3:124730371-124730393 GACGAGGCAGGCGGAAGAGGCGG + Exonic
961428619 3:126864582-126864604 GGAGAAGGAGGTGGTGGAGGTGG - Intronic
961428626 3:126864606-126864628 GGAGAAGGAGGTGGTGGAGGTGG - Intronic
961511488 3:127406553-127406575 GCCGAGGCAGGCTGGGGAGGAGG - Intergenic
961829304 3:129615324-129615346 GATGAGGCAGGAGGTGCAGGAGG - Intergenic
961919198 3:130408274-130408296 GTGGTGGCAGGGGGTGGGGGCGG + Intronic
962789878 3:138801634-138801656 GCCGAGGCAGGTGGATCAGGAGG + Intronic
963059414 3:141212758-141212780 GTGAAGGCAGGTGCTGGATGAGG + Intergenic
963269146 3:143268497-143268519 GTCGAGGCAGGTGGATCACGAGG + Intronic
964434929 3:156641414-156641436 CTCAAGGCAGGTGGGTGAGGTGG - Intergenic
964789892 3:160443872-160443894 GTCGAGGCAGGTGGATCATGAGG - Intronic
966212682 3:177469406-177469428 TTTGAGGCTGGTGGTGGTGGGGG + Intergenic
967835723 3:193960768-193960790 GTAGGGGGAGGTGGTGCAGGAGG + Intergenic
968048168 3:195635484-195635506 GTCGGGGCAGGGGATGGGGGCGG - Intergenic
968079102 3:195834383-195834405 GTCGAGGCAGGTGGATCATGAGG - Intergenic
968099236 3:195954136-195954158 GTCGGGGCAGGGGATGGGGGCGG + Intergenic
968306443 3:197654437-197654459 GTCGGGGCAGGGGATGGGGGCGG + Intergenic
968610496 4:1554705-1554727 GTCGAGGCTGGTGGGGGCCGTGG - Intergenic
968731242 4:2270378-2270400 ATCGGGGCGGGTGATGGAGGTGG - Exonic
968812513 4:2806321-2806343 GGCGAGGCAGGGTGGGGAGGAGG + Intronic
968949596 4:3683697-3683719 ATCGGGGCGGGTGGAGGAGGTGG - Intergenic
969228342 4:5813440-5813462 GCCGAGGCAGGTGGACGATGAGG - Exonic
969282383 4:6179449-6179471 GTAGAGGAAGGAGGTGGTGGTGG - Intronic
969291174 4:6241130-6241152 GTAGAGGCTGGAGGTGGAGCTGG + Intergenic
969534545 4:7747788-7747810 GGAGAGACAGGTGGTGCAGGAGG + Intergenic
970641316 4:18069476-18069498 GTGGAGGGAGGTAGGGGAGGTGG - Intergenic
972126112 4:35768033-35768055 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
972404495 4:38733431-38733453 GGCGATGATGGTGGTGGAGGTGG + Intergenic
974457283 4:62144659-62144681 ATCATGGCAGGTGGTGGAGCAGG - Intergenic
976095818 4:81507126-81507148 GTGGAGGGAGCTGGAGGAGGTGG - Intronic
977143638 4:93407840-93407862 GGAGAAGCAGGAGGTGGAGGAGG - Intronic
977934387 4:102784756-102784778 GTGGGGGGAGGAGGTGGAGGAGG - Intergenic
978310236 4:107379272-107379294 TCAGAGGCAGGTGGTGTAGGGGG + Intergenic
979345991 4:119587616-119587638 GTCGAGGCAGGTGGATCATGAGG - Intronic
979675667 4:123408070-123408092 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
980110826 4:128635248-128635270 CGTGAGGCAGGTGGTGGATGAGG - Intergenic
980950334 4:139369503-139369525 GCCGAGGCAGGTGGATCAGGAGG + Intronic
981528845 4:145733325-145733347 GACGAGGCGGGCGGTGGTGGGGG - Intronic
981813401 4:148801329-148801351 GTGGAGGCGGGTGGTGGGTGGGG + Intergenic
981930363 4:150182987-150183009 GTGTTGGCAGGTGGTGGGGGCGG - Intronic
982220022 4:153116298-153116320 GTGGAGGGAAGTGGGGGAGGTGG - Intergenic
982547085 4:156747563-156747585 GTCAAGGCAGGTGGATCAGGAGG + Intergenic
982884430 4:160760560-160760582 ATTGAGGTAGGGGGTGGAGGAGG - Intergenic
983297078 4:165879726-165879748 GTCTAGGGAAGTGGTGGGGGTGG + Intronic
983453403 4:167933825-167933847 GCCGAGGCAGGTGGATGACGAGG - Intergenic
984580050 4:181501187-181501209 GTGGTGGCGGGTGGTGGAGAAGG + Intergenic
985396066 4:189545596-189545618 TTGGAGGCAGGTTGTAGAGGTGG + Intergenic
985657011 5:1137533-1137555 GTCCAGGCAGGTTGAGGAGGAGG - Intergenic
985667768 5:1191120-1191142 GCAGAGGCAGGAGGTGGAAGAGG + Intergenic
986308779 5:6535928-6535950 ATGGAGGCAGGATGTGGAGGTGG - Intergenic
986930066 5:12806597-12806619 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
986977297 5:13409455-13409477 AATGAGGCAGGTGGAGGAGGTGG - Intergenic
987554667 5:19431500-19431522 GTCGAGGCAGGTGGATCACGAGG - Intergenic
988470074 5:31529499-31529521 GTCGAGGCAGGTGGATCACGAGG + Intronic
989046052 5:37274811-37274833 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
989236199 5:39151202-39151224 GCAGAGGTAAGTGGTGGAGGTGG - Intronic
989484062 5:41967784-41967806 GAAGAGGCAGGTGGAGAAGGAGG + Intergenic
989594362 5:43142536-43142558 GTCGAGGCAGGTGGATCACGAGG - Intronic
990219110 5:53567081-53567103 GTCGAGGCAGGTGGATCACGAGG - Intronic
992112885 5:73512639-73512661 GTCCAGACAGGTGGTGGCTGGGG + Intergenic
992187255 5:74256271-74256293 ATGGAGCCAGGTGGAGGAGGGGG - Intergenic
992455887 5:76915069-76915091 GTCGAGGCAGGTGGATCACGAGG + Intronic
993830841 5:92756006-92756028 ATGGAGTCAGGTGGTGGATGGGG - Intergenic
994573303 5:101541583-101541605 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
994717337 5:103337409-103337431 GTCAAGGTAGGTGGTAGAGGTGG + Intergenic
994756116 5:103795752-103795774 GCCGAGGCAGGTGGTTCATGAGG + Intergenic
995052023 5:107717690-107717712 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
995198129 5:109396657-109396679 GTCGAGGCAGGTGGATCACGAGG - Intronic
995404316 5:111777000-111777022 GAGGAGGAAGGAGGTGGAGGAGG + Intronic
995404323 5:111777022-111777044 GAGGAGGAAGGAGGTGGAGGAGG + Intronic
995609061 5:113889649-113889671 GTCCAGGAGGGTGGTGGAGGTGG - Intergenic
995777292 5:115737615-115737637 GTCAAGGCAGGAGGGGGATGTGG - Intergenic
995794443 5:115926747-115926769 GTCGAGGCAGGTGGATCATGAGG + Intergenic
995916386 5:117250339-117250361 GCCGAGGCAGGTGGATGACGAGG - Intergenic
996330347 5:122321436-122321458 GTCGAGGGAGGCTGAGGAGGTGG - Intronic
996729251 5:126701472-126701494 ATCCAGGCTGGTGGTGGTGGTGG + Intergenic
997309670 5:132869376-132869398 GTCGAGGCAGGTGGATCACGAGG - Intergenic
997592834 5:135086240-135086262 GACGGGGCAGGAAGTGGAGGTGG - Intronic
997640106 5:135443443-135443465 GTGGAGGCAGGGGATAGAGGTGG - Intergenic
998165200 5:139838747-139838769 GCAGAGGCGGGTGGTGCAGGAGG - Exonic
998405480 5:141872130-141872152 GTCCATGCAGGTGGAGGGGGGGG - Intronic
998501699 5:142638314-142638336 GTCGTAGCAGGTGGAGGTGGTGG - Intronic
999432631 5:151537263-151537285 GACGATGGTGGTGGTGGAGGAGG + Intronic
999862909 5:155667723-155667745 GTGGAGGCTGGTGGTTGATGAGG - Intergenic
999968713 5:156837458-156837480 CTCGAACCAGGAGGTGGAGGTGG - Intergenic
1000001242 5:157141312-157141334 GTCGAGGCAGGTGGAACACGAGG - Intronic
1001172573 5:169434439-169434461 GGCGGGGTAGGGGGTGGAGGTGG + Intergenic
1001540533 5:172534662-172534684 GCAGGGGCAGGGGGTGGAGGTGG - Intergenic
1001980631 5:176035253-176035275 CCAGAGGCAGGTTGTGGAGGTGG - Intergenic
1001999670 5:176190663-176190685 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1002236830 5:177808812-177808834 CCAGAGGCAGGTTGTGGAGGTGG + Intergenic
1002532023 5:179852929-179852951 GCAGAGGCCGTTGGTGGAGGTGG - Intronic
1002533564 5:179863813-179863835 GGAGAGCCAGGTGGTGGTGGAGG - Exonic
1002822123 6:735658-735680 GTCGAGGCAGGTGGATCATGAGG - Intergenic
1003033244 6:2620842-2620864 GTAGAGGCCCGAGGTGGAGGGGG + Intergenic
1003431941 6:6047138-6047160 GCCCAGGGAGGTGGTGGTGGAGG + Intergenic
1004728201 6:18331530-18331552 GCCGAGGCAGGTGGATGACGAGG - Intergenic
1005086665 6:22014284-22014306 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1005359302 6:25015795-25015817 GTAGAGGGAGGTGGAGAAGGAGG + Intronic
1006613612 6:35310449-35310471 CTGGTGGCAGGTGGAGGAGGGGG + Exonic
1006716194 6:36122253-36122275 GGACAGGCAGGTTGTGGAGGTGG + Intergenic
1006817500 6:36862357-36862379 GTTGAGGCAGGCTGTGGAGGAGG - Intronic
1006901805 6:37507699-37507721 TTGGAGGTAGGTGGTGGTGGGGG + Intergenic
1006901835 6:37507765-37507787 GTGGGGGTAGGTGGTGGTGGGGG + Intergenic
1006901896 6:37507906-37507928 GTGGGGGTAGGTGGTGGTGGTGG + Intergenic
1007115914 6:39343138-39343160 GACGGGGCTGGGGGTGGAGGGGG + Intronic
1007426305 6:41748507-41748529 GTTGGGGGAGGTGGGGGAGGGGG - Intronic
1007476574 6:42123513-42123535 GGAGAGGGAGGTGGAGGAGGAGG + Intronic
1007520160 6:42445787-42445809 AAAGAGGCAGGTGGAGGAGGAGG - Intronic
1008285647 6:49646280-49646302 GAAGGGGTAGGTGGTGGAGGAGG + Intergenic
1009886260 6:69627606-69627628 GTAGAGCCAGGTTGTGGAGATGG - Intergenic
1009959803 6:70504871-70504893 GCTGAGGCAGGTGGTAGAGGTGG + Intronic
1010155088 6:72783183-72783205 GTAGAGAGAGATGGTGGAGGGGG + Intronic
1011662560 6:89606853-89606875 GTGGGGGCAGGTGGGGGCGGGGG + Intronic
1011855029 6:91679214-91679236 GTCCAGGATGCTGGTGGAGGGGG + Intergenic
1012509945 6:99991571-99991593 GCCGAGGCAGGTGGATCAGGAGG + Intronic
1012598694 6:101069444-101069466 ATCCAGGCAGTTGGTGGTGGGGG - Intergenic
1012868288 6:104644103-104644125 ATGGGGGCAGTTGGTGGAGGTGG - Intergenic
1013590173 6:111613116-111613138 GGCTTGGCAGGAGGTGGAGGAGG - Intergenic
1014294354 6:119600652-119600674 GTCGAGGCAGGTGGATCATGAGG - Intergenic
1014358617 6:120445516-120445538 GGGGATGCAGGGGGTGGAGGAGG + Intergenic
1014592494 6:123291328-123291350 GCCGAGGCAGGTGGATCAGGAGG + Intronic
1015510139 6:134030292-134030314 GTTGGGGCAGAGGGTGGAGGTGG + Intronic
1015539438 6:134299031-134299053 GTCGAGGCAGGTGGATCACGAGG - Intronic
1017278868 6:152602140-152602162 GTGGTGGCAGTGGGTGGAGGTGG - Intronic
1017564835 6:155672312-155672334 GTGGAAGGAGGTGGGGGAGGAGG + Intergenic
1017814886 6:158009518-158009540 GTCGAGGAAGGGGGCTGAGGAGG + Intronic
1018471234 6:164100399-164100421 GTCCAGGCTGGGGGTGAAGGGGG - Intergenic
1018699605 6:166416162-166416184 GGCGAGGGTGATGGTGGAGGTGG - Intronic
1018709172 6:166485686-166485708 GTCTGGGGAGGTGGGGGAGGCGG - Intronic
1018724638 6:166602369-166602391 GTAGGGGCAGGTGTTGGGGGAGG - Intronic
1019034406 6:169042312-169042334 TTGCAGGCAGGTGGTGGAGATGG + Intergenic
1019080046 6:169424329-169424351 GTCAAAGCAGGAGGAGGAGGCGG + Intergenic
1019650340 7:2153921-2153943 GCCGAGGCAGGTGGATCAGGAGG + Intronic
1019780341 7:2936123-2936145 GTCGAGGCAGGTGGATCACGAGG - Intronic
1019817764 7:3213701-3213723 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1019913021 7:4113041-4113063 GCCAAGGCAGGCGGTGGCGGGGG - Intronic
1019975015 7:4574246-4574268 GTCAAGGCAGGTGGATGACGAGG - Intergenic
1020081284 7:5287189-5287211 GCCGAGGCAGGAGTTGGAGTTGG + Intronic
1020085639 7:5308858-5308880 ATGGAGGTAGGTGGTGGTGGTGG - Exonic
1020236804 7:6362187-6362209 GCCGAGGCAGGTGGGTCAGGAGG + Intergenic
1020278380 7:6637698-6637720 GTCCGGGCAGGAGGCGGAGGGGG + Intronic
1020535155 7:9388271-9388293 GTAGAGGCAGGTGGATGATGAGG - Intergenic
1022101965 7:27174167-27174189 GGCGAGGCAGGCGGCGGTGGTGG - Exonic
1022383815 7:29884170-29884192 GTTGGGGGAGGTGGCGGAGGTGG - Exonic
1022522340 7:31016400-31016422 GCAGAGGCAGGTGGCGGGGGGGG - Intergenic
1022718319 7:32919006-32919028 GCCGAGGCAGGTGGATGACGAGG + Intergenic
1022798173 7:33749373-33749395 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1022983775 7:35629336-35629358 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1023158026 7:37271171-37271193 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1023736988 7:43244088-43244110 GTGGATGCAGGTGGTGGGGAGGG - Intronic
1024185674 7:46945873-46945895 GTCCAGGCAGAGGGAGGAGGAGG + Intergenic
1024235146 7:47392189-47392211 GTCCTGGCAGGTGGTGGCTGCGG - Intronic
1024550900 7:50561662-50561684 GTGGGGGGAGGGGGTGGAGGTGG - Intronic
1024645729 7:51368919-51368941 GGAGAGGCAGGTGCTGGAGAGGG + Intergenic
1025208670 7:57008306-57008328 ATGGAGGTAGGTGGTGGTGGTGG + Intergenic
1025663277 7:63568572-63568594 ATGGAGGTAGGTGGTGGTGGTGG - Intergenic
1025829666 7:65038323-65038345 GCGGAGGGAGGCGGTGGAGGCGG + Intergenic
1027192624 7:76005917-76005939 GAGGAGGGAGGAGGTGGAGGAGG + Intronic
1028902172 7:96113796-96113818 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1029196797 7:98811029-98811051 GTGGTGGTGGGTGGTGGAGGTGG + Intergenic
1029424773 7:100488708-100488730 GTGGAGGCCGGTGCTGAAGGAGG - Exonic
1029559818 7:101295187-101295209 GCCGAGGCAGGTGGATGATGAGG - Intergenic
1030005270 7:105112398-105112420 GACGAAGAAGGAGGTGGAGGAGG - Exonic
1030172600 7:106618968-106618990 GTCAAGTCAGGTGGGAGAGGAGG - Intergenic
1030302429 7:107987834-107987856 TTCCAGGCAGTGGGTGGAGGCGG + Intronic
1030348445 7:108457467-108457489 TTGGAGGCTGGGGGTGGAGGAGG - Intergenic
1030528866 7:110687200-110687222 GTAGAATGAGGTGGTGGAGGTGG - Intronic
1031870010 7:127081196-127081218 GTGGAGGCAGGTGGGGGAAATGG - Intronic
1032172990 7:129601325-129601347 GTGGAGGTTGGAGGTGGAGGTGG - Intergenic
1032670327 7:134076281-134076303 GCCGAGGCAGGTGGATGACGAGG + Intergenic
1032877845 7:136056830-136056852 GGTGAGGCAGGTTGGGGAGGAGG + Intergenic
1033519631 7:142147608-142147630 GTGGAGGTGGGAGGTGGAGGTGG + Intronic
1034167184 7:149034504-149034526 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1034422114 7:150995766-150995788 GTCGGGGCAGAGGGAGGAGGGGG - Intronic
1034957493 7:155344086-155344108 GTCGAGGCAGGTGGATCATGAGG + Intergenic
1035035419 7:155891295-155891317 GTTGCTGGAGGTGGTGGAGGTGG + Intergenic
1035035657 7:155892353-155892375 GGTGATGGAGGTGGTGGAGGTGG + Intergenic
1035108396 7:156460711-156460733 GTCCAGGCAGGTGGTGGTTGGGG + Intergenic
1035562170 8:613925-613947 GAGGAGGCAGGTGGTGATGGAGG + Intergenic
1035622116 8:1042747-1042769 GTGGATGTAGGTGGTGGATGTGG + Intergenic
1035630189 8:1101517-1101539 GCCGGGGCTGGGGGTGGAGGGGG + Intergenic
1036724174 8:11204487-11204509 GTTGAGGTTGGTGGTGGTGGTGG + Intergenic
1037670683 8:21012868-21012890 GTCAAGGCAGGCGGTGGTGATGG - Intergenic
1037674638 8:21043126-21043148 GTGGTGGAAGGTGGGGGAGGTGG - Intergenic
1037674805 8:21043504-21043526 GTGGTGGAAGGTGGGGGAGGTGG - Intergenic
1037767532 8:21781322-21781344 GTCGTGGGTGGTGGTGGAAGTGG - Intronic
1037917061 8:22779067-22779089 GGCGGGGGAGGTGGGGGAGGAGG + Intronic
1038036052 8:23687937-23687959 GTGGAGGCAGGTGGGGTGGGTGG - Intergenic
1038319371 8:26513732-26513754 GGCCAGGCAGGTGGAGGAGAGGG + Intronic
1038327221 8:26580167-26580189 GTGGAGGCAGGAGGTGAAGGGGG + Intronic
1038425821 8:27463188-27463210 GGAGAGGGAGGTGGTGGTGGAGG - Exonic
1039620830 8:38996176-38996198 GTCGAGGCGGGTGGACGTGGAGG - Intronic
1039688476 8:39835448-39835470 GCCGAGGCAGGTGGATCAGGAGG + Intronic
1039793965 8:40896843-40896865 GTGGAGGCTGGTGGAGGGGGTGG - Intronic
1040976014 8:53195334-53195356 GGTGAGGCAGGAGGTGGAGGTGG - Intergenic
1041851258 8:62395352-62395374 ACCGAGGGAGGTGGTGGTGGGGG + Intronic
1042003816 8:64157753-64157775 CTGGAGGCAGATGGTGGAAGTGG - Intergenic
1042197305 8:66242237-66242259 GCTGAGGCAGGAGGCGGAGGTGG - Intergenic
1042902559 8:73744002-73744024 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1043069439 8:75620389-75620411 GTACAGTCAGGTTGTGGAGGAGG - Intergenic
1044251458 8:90007541-90007563 GGCAGGGCAGGTGGTGGGGGTGG + Intronic
1044549739 8:93498455-93498477 GTGGAGGCAGGTGGGGTGGGGGG - Intergenic
1044678502 8:94753636-94753658 GTCGAGGCAGGTGGATCACGAGG + Intronic
1047141319 8:122142744-122142766 GTGGAGGCAGATTCTGGAGGTGG + Intergenic
1048430022 8:134361606-134361628 GTCAAGCCGGATGGTGGAGGAGG - Intergenic
1048858343 8:138703225-138703247 GTAGTGGCAGTTGCTGGAGGGGG + Intronic
1049681960 8:143923091-143923113 GATGAAGCAGGTGGCGGAGGAGG - Exonic
1049745837 8:144262919-144262941 GGCGCAGCAGGTGGTAGAGGCGG + Exonic
1049893654 9:94244-94266 GCCAAGGCAGGGGGTGGGGGTGG - Intergenic
1051165937 9:14261955-14261977 TGCAAGGCAGGAGGTGGAGGGGG + Intronic
1051392157 9:16576968-16576990 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1051504080 9:17808836-17808858 GAGGAGGCTGGAGGTGGAGGGGG + Intergenic
1052005394 9:23341758-23341780 GGTGAGGAGGGTGGTGGAGGTGG + Intergenic
1052763605 9:32618058-32618080 GTGGAGACAGCTGGGGGAGGGGG + Intergenic
1052884070 9:33626155-33626177 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1052930876 9:34054529-34054551 GTCGAGGCAGGTGGATCATGAGG - Intergenic
1053087408 9:35237548-35237570 GTGGAGGCAGGTGGTGATAGTGG + Intronic
1053451962 9:38201186-38201208 CTGGAGGCAGGAGGTAGAGGTGG - Intergenic
1053524324 9:38813269-38813291 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1053641263 9:40082854-40082876 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1053734875 9:41094312-41094334 GCCAAGGCAGGGGGTGGGGGTGG - Intergenic
1053764875 9:41382609-41382631 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1054196558 9:62037678-62037700 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1054276264 9:63075639-63075661 TTCGAGGCCTGTGGTGGAGAAGG - Intergenic
1054322004 9:63679146-63679168 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1054398568 9:64689292-64689314 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1054543487 9:66293766-66293788 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1054641848 9:67551007-67551029 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1054693507 9:68337085-68337107 GCCAAGGCAGGGGGTGGGGGTGG + Intronic
1055030524 9:71768595-71768617 CTCGGGGCAGGAGGAGGAGGAGG - Exonic
1055571380 9:77620612-77620634 GTCGAGGCAGGTGGATCACGAGG + Intronic
1055744199 9:79424861-79424883 GTCGAGGCAGGTGGATCATGAGG - Intergenic
1055781191 9:79823435-79823457 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1056828813 9:89897218-89897240 GTAGAGGCAGGTCGTGGTAGTGG - Intergenic
1056898617 9:90577122-90577144 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1057135058 9:92681714-92681736 GAAGGGGCAGGTGGTGGAGGGGG + Intergenic
1057448735 9:95137756-95137778 GTGGAGGCAGGCAGGGGAGGAGG + Intronic
1057687386 9:97247519-97247541 GCCGAGGCAGGTGGTTCACGAGG - Intergenic
1058039868 9:100291978-100292000 GTCTAGGCAGGTAATGGTGGTGG - Intronic
1058642333 9:107099735-107099757 GGTGGGGCAAGTGGTGGAGGAGG - Intergenic
1058707874 9:107652204-107652226 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1059233813 9:112745310-112745332 GTCGAGGCAGGTGGATCACGAGG + Intergenic
1059387321 9:113974735-113974757 GACCAGGCAGGGGGTGCAGGGGG - Intronic
1060561502 9:124548843-124548865 TTCGTGGCGGGTGGTGGGGGTGG - Intronic
1060741349 9:126099581-126099603 GGCCAGGCAGGCAGTGGAGGAGG + Intergenic
1060835421 9:126752055-126752077 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1061145953 9:128798560-128798582 GTCTAGGCAAGAGGTGGTGGGGG + Intronic
1061247984 9:129411095-129411117 GGCGATGCTGGTGGTGGTGGTGG - Intergenic
1061255890 9:129454072-129454094 GTGGGTGGAGGTGGTGGAGGTGG + Intergenic
1061255898 9:129454094-129454116 GTGGGTGGAGGTGGTGGAGGTGG + Intergenic
1061255918 9:129454148-129454170 GTGGGTGGAGGTGGTGGAGGTGG + Intergenic
1061255941 9:129454209-129454231 GTGGGTGGAGGTGGTGGAGGTGG + Intergenic
1061255978 9:129454311-129454333 GTGGGTGGAGGTGGTGGAGGTGG + Intergenic
1061255985 9:129454330-129454352 GTGGTGGTGGGTGGTGGAGGTGG + Intergenic
1061256076 9:129454577-129454599 GTGGAGGTGGGTGGAGGAGGTGG + Intergenic
1061334626 9:129923971-129923993 GCAGAGGCAGGAGGGGGAGGGGG + Exonic
1061406416 9:130395103-130395125 TTCAAGGTAGGTGGTGGGGGTGG + Intronic
1061559239 9:131392329-131392351 GTCGAGGCAGGTGGATCATGCGG - Intergenic
1061791424 9:133061251-133061273 GTCGTGTGAGGTTGTGGAGGAGG - Intergenic
1062212921 9:135374181-135374203 GTGGAAGTAGGTGGAGGAGGGGG - Intergenic
1062322100 9:135995104-135995126 GTGGAGACAGACGGTGGAGGGGG - Intergenic
1062534321 9:137014866-137014888 GCAGTTGCAGGTGGTGGAGGTGG - Intronic
1062556029 9:137113817-137113839 GTCGGGGCAGGGGAGGGAGGGGG + Intronic
1062606124 9:137349635-137349657 GTGGGGGCCGCTGGTGGAGGGGG - Intronic
1202789032 9_KI270719v1_random:65928-65950 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1203353489 Un_KI270442v1:106063-106085 TTCGAGGCCTGTGGTGGAGAAGG + Intergenic
1203611517 Un_KI270749v1:10866-10888 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1185489112 X:507279-507301 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1185598044 X:1320127-1320149 GCCGAGGCAGGTGGATGACGAGG - Intergenic
1185927214 X:4160925-4160947 GCGGAGGCAGGTGGTGAGGGAGG + Intergenic
1185979904 X:4766942-4766964 GCCGAGGCAGGTGGAGCACGAGG - Intergenic
1186115756 X:6303690-6303712 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1187016629 X:15335405-15335427 ATCGTGGCGGGTGGTGGAGGGGG - Intronic
1187337464 X:18393699-18393721 GCCGAGGCAGGTGGATCAGGAGG - Intergenic
1187881471 X:23851425-23851447 GCCGAGGCAGGTGGATGACGAGG - Intronic
1188474630 X:30578237-30578259 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1188786125 X:34348891-34348913 GGAGAGACAGGAGGTGGAGGTGG - Intergenic
1189188008 X:39070512-39070534 CTCGAAGCAGGGGGTGGAGGGGG + Intergenic
1189333965 X:40158663-40158685 GCCGAGGCAGCTGGGGGTGGGGG + Intronic
1189594899 X:42553746-42553768 GTCGAGGCAGGTGGATCACGAGG - Intergenic
1189992255 X:46606612-46606634 GGCGAGGCAGGTGCTGGGTGGGG - Exonic
1190016203 X:46829362-46829384 GCCGAGGCAGGTGGTTCACGCGG - Intergenic
1190050489 X:47145492-47145514 GTCGACGCTGGTCGTGGGGGCGG + Intronic
1190261757 X:48802046-48802068 GTCTGGGCAGGGGGTGGAGCTGG + Exonic
1190354286 X:49589933-49589955 GGCGAGGCAGGCGGTGAAGAAGG + Intronic
1190759054 X:53424593-53424615 GCCGAGGCAGGTGGATCAGGAGG - Intronic
1190915610 X:54809178-54809200 GTCGTTGGGGGTGGTGGAGGGGG + Intronic
1190981201 X:55457949-55457971 GGTGGGGCAGGTGGTGGTGGTGG + Intergenic
1190987497 X:55515231-55515253 GGTGGGGCAGGTGGTGGTGGTGG - Intergenic
1191740662 X:64433103-64433125 GTTGAGGCTGCTGGTGGAGATGG - Intergenic
1192722694 X:73716398-73716420 GTCTTGGGAGGTGGTGGGGGGGG - Intergenic
1193381433 X:80820544-80820566 GCCGAGGCAGGTGGATCAGGAGG + Intergenic
1193513085 X:82430571-82430593 GGCGGGGCGGGGGGTGGAGGGGG - Intergenic
1193886468 X:86988051-86988073 GTCATGGCAGAAGGTGGAGGGGG + Intergenic
1194688910 X:96957897-96957919 GGCGCGGGTGGTGGTGGAGGCGG - Exonic
1194765408 X:97842632-97842654 GGAGAGGAAGGTGGTGTAGGAGG - Intergenic
1196177775 X:112659274-112659296 GTAGAGACAGGGTGTGGAGGAGG - Intronic
1196507822 X:116469292-116469314 AGCGAGGAAGGTGGTGGTGGAGG - Intergenic
1198328639 X:135600340-135600362 GTCCTGTCAGGTGGTGGGGGAGG - Intergenic
1198395218 X:136212912-136212934 GGTGAGGAAGGTGGTGGAGGCGG - Intergenic
1199671988 X:150155351-150155373 GAAGAGGCAGGTGGAGAAGGGGG - Intergenic
1199772412 X:150983500-150983522 GTAGAGGCAGGGGGAGGCGGCGG - Intronic
1200310412 X:155071530-155071552 GGCGGTGCAGGTGGTGCAGGCGG + Exonic
1200974330 Y:9192458-9192480 GCCGAGGCAGGTGGCTCAGGAGG + Intergenic
1201966273 Y:19740039-19740061 GTCGAGGCAGGTGGATCATGGGG + Intronic