ID: 1082086866

View in Genome Browser
Species Human (GRCh38)
Location 11:48057565-48057587
Sequence GGTGGTGGAGGTGGTGGCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12209
Summary {0: 1, 1: 25, 2: 387, 3: 3398, 4: 8398}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082086851_1082086866 30 Left 1082086851 11:48057512-48057534 CCAGTCACGGGCAGCCTTGGGTA 0: 1
1: 0
2: 0
3: 10
4: 81
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086857_1082086866 6 Left 1082086857 11:48057536-48057558 CCAGAGGCCTTCTCACGTGGGTC 0: 1
1: 0
2: 0
3: 5
4: 87
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086859_1082086866 -1 Left 1082086859 11:48057543-48057565 CCTTCTCACGTGGGTCGAGGCAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086856_1082086866 7 Left 1082086856 11:48057535-48057557 CCCAGAGGCCTTCTCACGTGGGT 0: 1
1: 0
2: 0
3: 1
4: 87
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398
1082086853_1082086866 16 Left 1082086853 11:48057526-48057548 CCTTGGGTACCCAGAGGCCTTCT 0: 1
1: 0
2: 1
3: 16
4: 211
Right 1082086866 11:48057565-48057587 GGTGGTGGAGGTGGTGGCAGCGG 0: 1
1: 25
2: 387
3: 3398
4: 8398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082086866 Original CRISPR GGTGGTGGAGGTGGTGGCAG CGG Intronic
Too many off-targets to display for this crispr