ID: 1082092434

View in Genome Browser
Species Human (GRCh38)
Location 11:48100994-48101016
Sequence CTCATTGCTGAGAGTGGGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 183}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082092429_1082092434 -9 Left 1082092429 11:48100980-48101002 CCCTCCTGTCATTGCTCATTGCT 0: 1
1: 0
2: 1
3: 19
4: 346
Right 1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 183
1082092428_1082092434 5 Left 1082092428 11:48100966-48100988 CCTTTGCTTCAGCTCCCTCCTGT 0: 1
1: 0
2: 2
3: 43
4: 443
Right 1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 183
1082092426_1082092434 9 Left 1082092426 11:48100962-48100984 CCCTCCTTTGCTTCAGCTCCCTC 0: 1
1: 0
2: 3
3: 72
4: 773
Right 1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 183
1082092427_1082092434 8 Left 1082092427 11:48100963-48100985 CCTCCTTTGCTTCAGCTCCCTCC 0: 1
1: 0
2: 3
3: 61
4: 617
Right 1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 183
1082092430_1082092434 -10 Left 1082092430 11:48100981-48101003 CCTCCTGTCATTGCTCATTGCTG 0: 1
1: 0
2: 2
3: 13
4: 205
Right 1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG 0: 1
1: 0
2: 2
3: 19
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082092434 Original CRISPR CTCATTGCTGAGAGTGGGTA AGG Intronic
901426356 1:9184063-9184085 CTCTGGACTGAGAGTGGGTATGG - Intergenic
903183698 1:21618053-21618075 CTCAGGGCTGAGAGTGCGGATGG + Intronic
903232150 1:21928358-21928380 CTCCTTGCTGAGATTGGAAAGGG - Intronic
905028504 1:34866600-34866622 CTCATTGCGGAGCCTGGGTCGGG - Intronic
905126273 1:35718287-35718309 CCCATTGCTGGGGGTGGGGAGGG - Intronic
905340316 1:37273536-37273558 CTGGATGCTGAGAGTGGGCAAGG - Intergenic
905592324 1:39175006-39175028 CAAATTGCTGGGAGTGGCTAAGG + Intronic
906414791 1:45612644-45612666 CTCATTGGTGTAAGTCGGTAAGG + Intronic
907579241 1:55556981-55557003 CTCATTTCTCAGTGTGGGAAGGG - Intergenic
907944710 1:59124978-59125000 CTAATGACTGAGATTGGGTATGG + Intergenic
912952765 1:114131830-114131852 GTCATTTCTGGGAGTGGGTTTGG - Intronic
913610629 1:120506500-120506522 CTCTTTGCTGAGGCTGGGGAAGG + Intergenic
913984167 1:143550313-143550335 CTCTTTGCTGAGGCTGGGGAAGG - Intergenic
913990637 1:143608472-143608494 CTCATTCCTGAGAGTGGACTGGG + Intergenic
914434603 1:147648752-147648774 CCCATGGCTGAGAGTAGGAAGGG - Intronic
914580561 1:149015739-149015761 CTCTTTGCTGAGGCTGGGGAAGG - Intronic
916299369 1:163256821-163256843 CACAGTGATGAGGGTGGGTAAGG + Intronic
921165914 1:212507006-212507028 CTGAATCCTGAGAGTGGGGAAGG - Intergenic
1062940992 10:1421309-1421331 CTCACAGCTGAGCGTGGGTGGGG - Intronic
1064096338 10:12427234-12427256 CTGATTCCAGAGGGTGGGTAGGG + Intronic
1066763079 10:38775770-38775792 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1073999779 10:109359106-109359128 CTCATTGCTGAGGATGAATAGGG + Intergenic
1075005862 10:118829801-118829823 CTCACTGCTGATAGTGAGGATGG - Intergenic
1076407755 10:130224393-130224415 GCCATTGCTCAGAGTGGGGAGGG + Intergenic
1076497044 10:130904186-130904208 GTCAGTGCTGAGAGTGAGTGGGG + Intergenic
1076500297 10:130931250-130931272 CTCATTCCTGAAATTGGATATGG + Intergenic
1078798387 11:14617080-14617102 CTGCCTGCTGAGAGTGGGTGTGG + Intronic
1078854788 11:15198169-15198191 CTGATTCTGGAGAGTGGGTAAGG - Intronic
1080569991 11:33547112-33547134 CCCTCTGCTGAGAGTGGGTGAGG + Intronic
1080934929 11:36853150-36853172 CTGATTGCTAAGGATGGGTAAGG + Intergenic
1081383140 11:42441004-42441026 CACAGTGCTGAGATTGGGTCTGG - Intergenic
1082092434 11:48100994-48101016 CTCATTGCTGAGAGTGGGTAAGG + Intronic
1085034388 11:73291368-73291390 CGCCCTGCTGGGAGTGGGTACGG + Intronic
1085459197 11:76682991-76683013 CTCATTTTAGAGAGTGGGCATGG + Intergenic
1085906626 11:80772184-80772206 CTCATTGCTGAGATGAGGAAAGG - Intergenic
1086720250 11:90111824-90111846 CTCACAGCTGAGAGTGAGGATGG - Intergenic
1091603060 12:1929697-1929719 CTCATTTCAGAGTGTGGGGAAGG + Intergenic
1092596264 12:10008360-10008382 CTGATTTCTGAGTGTGGGTAAGG + Intronic
1092701919 12:11241411-11241433 CTCATTGCTGACACTGGAGAAGG + Intergenic
1092708816 12:11312370-11312392 CTCATTGCTGACATTGGAGAAGG - Intergenic
1093063160 12:14628806-14628828 CTCATTGATGGGAGTGATTAAGG + Intronic
1094115426 12:26906800-26906822 CTCATTGGAGAGAGTGAGCATGG - Intronic
1095942030 12:47733617-47733639 CTCAATACTGAGTGTGGGTTGGG + Intergenic
1096912970 12:55002613-55002635 CTCATTGCTCAGAGTGGTTGGGG - Intergenic
1097132021 12:56818621-56818643 GTCATTGCTCAGAGAGGGGAGGG + Intergenic
1097211512 12:57374151-57374173 TTCATTGTTAAGAGTGGGCAGGG - Intronic
1103685734 12:122730643-122730665 GTCATTTCTGAGAGGCGGTAGGG + Exonic
1105013192 12:132769519-132769541 CATATTGCAGAGAGTGGGAACGG + Exonic
1105364547 13:19752990-19753012 CTCACTGCCGAGACTGGGCACGG + Intronic
1105487597 13:20852015-20852037 CTCATTCCTGAGAGAGGCAAGGG + Intronic
1105815744 13:24034696-24034718 CCCATAGCTGCCAGTGGGTACGG + Intronic
1107043017 13:35968804-35968826 CTCTATGCTGGGACTGGGTAAGG - Intronic
1110974378 13:81810341-81810363 CTCATTGATGATAGTAAGTATGG + Intergenic
1115514580 14:34172938-34172960 GCCATAGCTGAGAGTGGGTTGGG - Intronic
1120513643 14:85445095-85445117 CTCATTTCTCAGAGTAGGTGAGG - Intergenic
1122001524 14:98660100-98660122 CTGATTGCTGAAAGTGGGGGTGG - Intergenic
1202934407 14_KI270725v1_random:72018-72040 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1124019698 15:25909264-25909286 CTCTTTTCTGAGACTGGGGATGG + Intergenic
1124788047 15:32700108-32700130 CTTCTAGCTGCGAGTGGGTAGGG + Intergenic
1125722013 15:41849704-41849726 CTCTCAGCTGAGAGTGGGCAGGG + Intronic
1126442830 15:48710322-48710344 TCCATTGCTGACAGTGGGAAAGG + Intergenic
1126573678 15:50177607-50177629 TTCATTGCATAGAGTGGGAAAGG - Intronic
1128457688 15:67841479-67841501 CTCAGTACTGAGAGAGGGGAGGG + Intergenic
1128580318 15:68805394-68805416 CTCATGGCTGGGTGTGGGGAGGG - Intronic
1132113903 15:99121692-99121714 CTCTATGCTGAGTGTGTGTATGG - Intronic
1133908097 16:10039721-10039743 CTCATTGCTGAGGGAGGGAGGGG - Intronic
1134506759 16:14813963-14813985 CTCATTGGAGACACTGGGTAGGG + Intronic
1134573799 16:15314858-15314880 CTCATTGGAGACACTGGGTAGGG - Intergenic
1134728621 16:16441460-16441482 CTCATTGGAGACACTGGGTAGGG + Intergenic
1134938821 16:18270464-18270486 CTCATTGGAGACACTGGGTAGGG - Intergenic
1137376138 16:47953477-47953499 CTCTTTGCTAAGAATGGGTGGGG + Intergenic
1137563613 16:49519427-49519449 CACAATGCTGAGAGTTGGTGAGG - Intronic
1137685602 16:50384779-50384801 CTTATTTCTGAGAGTTGCTATGG + Intergenic
1140094136 16:71860618-71860640 CTCATTGTGGACTGTGGGTAGGG + Exonic
1140300246 16:73750254-73750276 CTCATTGCTGAGCTTGGTTTAGG - Intergenic
1140754555 16:78055823-78055845 CTCACTGTTGAGAGTCGGTCTGG + Intronic
1141068821 16:80934943-80934965 CACATTTCTGAGAGTGAATAAGG + Intergenic
1141272092 16:82550177-82550199 CTCTGTGTAGAGAGTGGGTATGG + Intergenic
1147685932 17:42286980-42287002 TCCATTGCTCAGAGTGGGAAAGG + Intergenic
1148824575 17:50382987-50383009 CTCACTGCTGAGAGTCGGTCTGG + Exonic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150659317 17:67061744-67061766 ATCATTTCTGAAAGTGGGCAGGG - Intergenic
1151269616 17:72984059-72984081 CTCATGGCTCAGAGTGGGGCTGG + Intronic
1151671594 17:75574248-75574270 CTCAGTGATGAGAGTGAGTTGGG + Exonic
1161031700 19:2060751-2060773 CTCTTGGCTGTGAGTGGGAAGGG + Intergenic
1161300979 19:3543219-3543241 GTCATCGCTGAGGGTGGGCAGGG - Exonic
1163311892 19:16519902-16519924 CTCAATGCTGAGCGTGGGGTGGG - Intronic
1163727811 19:18932491-18932513 CTGATTGCTGAGCTTGGGGATGG + Intronic
1164207527 19:23070904-23070926 CTCATTCCTGGGAGTGGGGGTGG - Intergenic
1164510977 19:28897034-28897056 CTGGTAGCTGAGAGTGGGTGAGG - Intergenic
925754873 2:7123605-7123627 CTCAGTCCTGAGTGTGGGTTTGG - Intergenic
925976588 2:9146243-9146265 CTCCTTGCTGGGAGTGGGGCAGG + Intergenic
926097946 2:10094675-10094697 CCCGGTGCTGAGCGTGGGTATGG + Intergenic
927311976 2:21641702-21641724 CTCATTTCTGAGAGAGGAAATGG + Intergenic
932070117 2:68611738-68611760 CTCATTGCAGAGAGTGGAGGGGG + Intronic
934306846 2:91832308-91832330 CTCATAGCTGAGAGTGAGGATGG + Intergenic
934326410 2:92020434-92020456 CTCATAGCTGAGAGTGAGGATGG - Intergenic
934464770 2:94251050-94251072 CTCATTGCTGAGAGTGAGGATGG - Intergenic
934774143 2:96926630-96926652 CTCAATGATGAGACTGGGGAGGG - Intronic
936934934 2:117830113-117830135 CTCAATGCTGACAATGGGGATGG - Intronic
938110362 2:128560184-128560206 ATCACTGCTGAGAGTGAGGATGG + Intergenic
941481866 2:166025329-166025351 CTAGTTGCTGAGAGTGGTTCTGG - Intronic
944345481 2:198660283-198660305 CTCAGTGATGAGAGTGTGGATGG + Intergenic
946397786 2:219451883-219451905 CTCAAGGCTGAGAGTGGGAAGGG - Intronic
946428832 2:219613924-219613946 CTCCTTGGTGAGAGAGGGGAGGG + Exonic
947354495 2:229277763-229277785 CTCACTGCTGGGAGGTGGTAGGG + Intergenic
947574211 2:231259607-231259629 GTCATTGTTGAGAGTGGAAAGGG - Intronic
948127540 2:235575834-235575856 CTCTTTACTGAGATTGGGGAGGG + Intronic
948543128 2:238703960-238703982 CTCCTTTCTGAGAATGGGAACGG + Intergenic
1169196652 20:3686676-3686698 TACATTGCTGACAGTGGGGAGGG - Intergenic
1169297467 20:4412492-4412514 CTCAGTGCTTAGAGATGGTATGG - Intergenic
1171217600 20:23363145-23363167 CTCATTGATGAGACTGGAGAAGG + Intronic
1175267771 20:57712962-57712984 CTCACTGCTGGGAGTGGGAGTGG + Intergenic
1178411064 21:32364178-32364200 CTCACTGCAGAGACTGAGTAGGG + Intronic
1179337071 21:40466788-40466810 TGCATTGCTGAGAGTGGACAAGG + Intronic
1180278669 22:10671335-10671357 CTCATAGCTGAGGGTGAGGATGG - Intergenic
1180585922 22:16890197-16890219 CTCATAGCTGAGAGTGAGGATGG - Intergenic
1182122352 22:27796393-27796415 CTCAATGTTGAGGGTGGGGAGGG + Intronic
950380952 3:12614355-12614377 CTAAGTGTTGAAAGTGGGTAAGG + Intronic
953600362 3:44357152-44357174 CCCATTGCTTTGAGAGGGTAAGG + Intronic
954692612 3:52403672-52403694 CTCATTGCTGGGGGTGGGTGAGG + Exonic
955930541 3:64052067-64052089 CTCACTGGTGAGGGTGGGTGTGG + Intergenic
962317109 3:134365807-134365829 CTGCTTGCTCAGAGTGAGTAGGG - Exonic
967557896 3:190879556-190879578 ATCATTACAGAGATTGGGTATGG - Intronic
967650305 3:191977590-191977612 TGCATTGCTGAGAATGTGTAAGG + Intergenic
968665042 4:1816386-1816408 GTCATTACTGAGCGTGGGTGGGG + Intronic
968921205 4:3523005-3523027 CTCTTTCCTGAGTGTGGGCAGGG + Intronic
969407092 4:7000767-7000789 CACATAGCTGGGAGTGGGTGAGG - Intronic
971476976 4:27081601-27081623 CTAATTGCTGATACAGGGTAGGG - Intergenic
973362614 4:49178900-49178922 CTCACTGCTGAGAATGGTAAGGG - Intergenic
975210830 4:71698038-71698060 CTCATAGCTAAGAGTGGCCATGG - Intergenic
976591221 4:86851481-86851503 CTCAGTGCTGATAGAGGGGAGGG + Intergenic
985425282 4:189824135-189824157 CTCTTGGCTGATGGTGGGTAAGG + Intergenic
985788173 5:1910845-1910867 CTCCTTTCTGGGAGTGGGTGGGG + Intergenic
986266885 5:6198329-6198351 CACGTTGCAAAGAGTGGGTAAGG + Intergenic
986321813 5:6637595-6637617 TTCACTGCTGATAGTGGGGAAGG - Intronic
987312460 5:16693886-16693908 CTCACTGCTGGGAATGGGGATGG + Intronic
988715058 5:33817544-33817566 ATCATTGCTGAAAATGGGTGAGG - Intronic
989113474 5:37929562-37929584 GTCATTTCTGAGTGTGGGCAGGG + Intergenic
989656897 5:43754393-43754415 CTCATTGTTGAAAATGGGTGGGG + Intergenic
990222414 5:53606768-53606790 CTCAATGTTGAAAGTGGGGACGG - Intronic
994758039 5:103818595-103818617 CTCATTGCTGAGAGTGCGGACGG - Intergenic
994778189 5:104061848-104061870 CTCAGTGCTGTTGGTGGGTATGG - Intergenic
998265853 5:140667258-140667280 GTCATGGCTGAGGGTGGGGAAGG - Intronic
998570791 5:143254819-143254841 CTCATGCCTGAGAGTGGGCGTGG - Intergenic
999676636 5:154010679-154010701 ATCAAAGCTCAGAGTGGGTAGGG - Intronic
999717457 5:154372800-154372822 CCAAATGCTGAGAGGGGGTATGG + Intronic
1002829549 6:806741-806763 TTTCTTGTTGAGAGTGGGTAAGG + Intergenic
1005080219 6:21949579-21949601 CTGATTGCTTAGAGAGGTTATGG - Intergenic
1007249777 6:40487899-40487921 CTCAAGGCTGAGATTGGGAAAGG - Intronic
1008012946 6:46488549-46488571 TTCATTTCTGAGACTGTGTAAGG - Intronic
1008710080 6:54214443-54214465 CTCAGTGCTGACAGTGGTCATGG + Intronic
1009418911 6:63443561-63443583 CTCACTGCTGAGAGTCGGTCTGG - Intergenic
1010515888 6:76772134-76772156 CTCATGGCTGAGACTGGACATGG + Intergenic
1013180990 6:107716922-107716944 CTCACTGCTGAGAATGTGCATGG + Intronic
1013968159 6:115981631-115981653 CTAATTGCTGAAATTGGGTGGGG - Intronic
1015180437 6:130356201-130356223 CTGATTGATGAGAGAGGATAAGG - Intronic
1016052425 6:139544011-139544033 CTCATTGCTGAAAATGGCTAAGG - Intergenic
1017491499 6:154949766-154949788 ATCACTGCTGAGAGTGTGTTGGG + Intronic
1017818568 6:158032434-158032456 CTCCTCCCTGAGAGTGAGTATGG + Intronic
1018682656 6:166276806-166276828 CTCTTGTCTGGGAGTGGGTATGG - Intergenic
1021733127 7:23616744-23616766 CTCAGTGATGTGACTGGGTATGG + Intronic
1021743334 7:23710726-23710748 CTGTTTGCAGAAAGTGGGTACGG + Intronic
1022533445 7:31081170-31081192 CTCATTGCTAACAGGGGGTTTGG + Intronic
1029421197 7:100472653-100472675 CACATTCCTGAGAGTGGGAATGG + Intronic
1029883783 7:103845474-103845496 CACAATGTTGAGAGTGGGTCGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033261123 7:139844925-139844947 CTCATTGGTGAGAGAGGGCTGGG + Intronic
1036494294 8:9255550-9255572 CTCATTGCTGACAAGGGGCACGG - Intergenic
1039179962 8:34855501-34855523 TTCATTGATGAGAGTGGGCTGGG - Intergenic
1040005412 8:42616747-42616769 CTCACTGTTGAGACTGGGCAGGG + Intergenic
1041797208 8:61758033-61758055 TGCCTTGTTGAGAGTGGGTAAGG - Intergenic
1043201954 8:77381448-77381470 CTCATTGCTGACAGTGGGGCTGG - Intergenic
1043419544 8:80084496-80084518 CTCAGTGCTGAGACTGGGAAGGG + Intronic
1045818905 8:106311804-106311826 TTCAATGCTAAGAATGGGTAGGG - Intronic
1046883527 8:119337239-119337261 CTCTTTGCTGAGCCTGGGGATGG + Intergenic
1048143039 8:131813728-131813750 TTCATTGGTGAGAATGGGAATGG - Intergenic
1048229368 8:132621699-132621721 CTGTCTGCTGAGTGTGGGTAAGG + Intronic
1049031033 8:140037993-140038015 CTAGTTGGAGAGAGTGGGTAAGG - Intronic
1049541962 8:143212705-143212727 TGCATTGCTGAGTGTGGGTGAGG + Intergenic
1051612567 9:18975489-18975511 CTCATTGCCTAGAGTAGGGAGGG - Intronic
1053694853 9:40627809-40627831 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054269988 9:63012310-63012332 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1054306097 9:63427033-63427055 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054404839 9:64751012-64751034 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054438463 9:65236504-65236526 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1054491941 9:65785444-65785466 CTCATAGCTGAGAGTGAGGGTGG + Intergenic
1056673658 9:88654342-88654364 CTCATAGCTGAGAATGGCCATGG + Intergenic
1057530290 9:95839099-95839121 CTCTTTGCTGAGGATGGGCAAGG + Intergenic
1058816762 9:108691570-108691592 CTCACTGCTGGGAGTGTGTTAGG + Intergenic
1061452942 9:130678415-130678437 CTCAGGGCTGAGACTGGGTCCGG + Intronic
1061802328 9:133119447-133119469 CTCAGTGCTGAGGCTGGGCAAGG + Intronic
1202777298 9_KI270717v1_random:1415-1437 CTCATAGCTGAGAGTGAGGGTGG - Intergenic
1203691743 Un_GL000214v1:48587-48609 CACATTGCTGAGAATGGTAAGGG - Intergenic
1203644552 Un_KI270751v1:55604-55626 CACATTGCTGAGAATGGTAAGGG + Intergenic
1186732550 X:12425618-12425640 GTCACAGCTGAGGGTGGGTAGGG + Intronic
1187291564 X:17959283-17959305 CTTATTGTTGAGAATGGCTATGG + Intergenic
1191138921 X:57094976-57094998 GCCATTGCTGAGATTGAGTAGGG + Intergenic
1193509326 X:82380367-82380389 TTCAGTGCTGAGAGTGGGGTGGG + Intergenic
1194914900 X:99694018-99694040 CTCAATGAGGAGAGTGGATATGG + Intergenic
1198611172 X:138402333-138402355 TTAATTGCTGAGTGTGGGTAAGG + Intergenic
1198729372 X:139711829-139711851 CTTAATGCTGAGAATGGGGAGGG + Intergenic
1199409091 X:147498948-147498970 CTTTTAGCTGAGAGTGTGTATGG - Intergenic
1199783334 X:151082796-151082818 CACATAGCTGAGACTGGGAAAGG - Intergenic
1201192652 Y:11459762-11459784 CTCATAGCTGAGAGTGAGGATGG - Intergenic