ID: 1082095635

View in Genome Browser
Species Human (GRCh38)
Location 11:48127149-48127171
Sequence CTTGTGCAAGGCATCATGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 169}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082095635_1082095643 -9 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095643 11:48127163-48127185 TTGCACAAGGTCAGCCTCCTGGG 0: 1
1: 0
2: 2
3: 28
4: 200
1082095635_1082095653 19 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095653 11:48127191-48127213 AGCAGGTGAGGGAAGGGCAGTGG 0: 1
1: 0
2: 13
3: 194
4: 2041
1082095635_1082095644 2 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095644 11:48127174-48127196 CAGCCTCCTGGGCCCAGAGCAGG 0: 1
1: 4
2: 11
3: 138
4: 652
1082095635_1082095655 29 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095655 11:48127201-48127223 GGAAGGGCAGTGGATATGTCGGG 0: 1
1: 0
2: 3
3: 7
4: 205
1082095635_1082095648 8 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095648 11:48127180-48127202 CCTGGGCCCAGAGCAGGTGAGGG 0: 1
1: 1
2: 4
3: 59
4: 515
1082095635_1082095642 -10 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095642 11:48127162-48127184 CTTGCACAAGGTCAGCCTCCTGG 0: 1
1: 0
2: 1
3: 29
4: 265
1082095635_1082095646 7 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095646 11:48127179-48127201 TCCTGGGCCCAGAGCAGGTGAGG 0: 1
1: 0
2: 3
3: 64
4: 485
1082095635_1082095649 12 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095649 11:48127184-48127206 GGCCCAGAGCAGGTGAGGGAAGG 0: 1
1: 1
2: 3
3: 81
4: 731
1082095635_1082095654 28 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095654 11:48127200-48127222 GGGAAGGGCAGTGGATATGTCGG 0: 1
1: 0
2: 2
3: 33
4: 449
1082095635_1082095650 13 Left 1082095635 11:48127149-48127171 CCCCCCATGATGCCTTGCACAAG 0: 1
1: 0
2: 0
3: 17
4: 169
Right 1082095650 11:48127185-48127207 GCCCAGAGCAGGTGAGGGAAGGG 0: 1
1: 2
2: 4
3: 65
4: 662

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082095635 Original CRISPR CTTGTGCAAGGCATCATGGG GGG (reversed) Intronic
901248525 1:7753746-7753768 CTTCTGCATGGCATCATAGCTGG - Intronic
903518007 1:23925401-23925423 CTTGTTCAAGGCCACATGGCAGG - Intergenic
904747464 1:32719943-32719965 CTTGTGCAGGGTATCAGGGTGGG + Intergenic
904862124 1:33546326-33546348 CTTGTGCTAGGCCTCATTCGTGG - Intronic
905045079 1:34991105-34991127 CTTTGGCAAGCCAACATGGGCGG - Intronic
908049694 1:60215564-60215586 CAAGTGCCAGGCATCATGGTAGG - Intergenic
909189804 1:72538135-72538157 CTTTTGTAATGCATCATGGCTGG - Intergenic
909843716 1:80363154-80363176 TTTATGCAAGGCATCATGCTAGG - Intergenic
910379460 1:86610084-86610106 CTTGTGGCAGGGATGATGGGTGG + Intergenic
911374209 1:97030798-97030820 CTTATTCATGGCAACATGGGTGG + Intergenic
912495524 1:110089023-110089045 CCTATGCAAGGCACCATGGCAGG + Intergenic
913415200 1:118597750-118597772 CTATTGCCAGGCATCGTGGGTGG + Intergenic
915106764 1:153539741-153539763 CCTGTGCTAGGGGTCATGGGTGG - Intronic
915493998 1:156268051-156268073 CTTCTGTAAAGCATCATGGCTGG + Intronic
917499731 1:175575413-175575435 CTTGTGCTAGGCACCGTGGTTGG + Intronic
924700023 1:246441980-246442002 CATGTGCAAGGCACTATGGAAGG + Intronic
1063011145 10:2022843-2022865 CTTGTGGAAGGCATGGTGTGAGG + Intergenic
1063417724 10:5888041-5888063 CTTGTGCAGGCCATCATCAGAGG + Exonic
1064305548 10:14162814-14162836 CTTGGGCACGTCATCCTGGGTGG - Intronic
1065885942 10:30077058-30077080 CCTCTGCAAGGCAGCCTGGGCGG + Intronic
1065995928 10:31059561-31059583 GTTGTGCAGGGCGTCATGGGAGG - Intergenic
1066156160 10:32680295-32680317 CTTATCCAAGGCCTCATGGAAGG - Intronic
1070776516 10:79113007-79113029 CTTGAGCAAGGCAGCAAGTGAGG + Intronic
1072767186 10:98104721-98104743 CATGTGCAAGGCATCATGCTAGG - Intergenic
1073042812 10:100618865-100618887 CTTGTGCAGGGAACTATGGGTGG - Intergenic
1073343683 10:102765600-102765622 TTTGTGCAAGGCATCGTGCTTGG + Intronic
1073453668 10:103623812-103623834 CCTGTGCAAGGCCTCCTGGTGGG + Intronic
1073542527 10:104325287-104325309 CTTGAGGAACGCTTCATGGGGGG - Intronic
1077473414 11:2775428-2775450 TTTGTGCCAGGCAGCAGGGGTGG - Intronic
1077860006 11:6169613-6169635 CTTGTGCCGAGCATCCTGGGAGG + Exonic
1077886628 11:6391910-6391932 CTGGTGCCAGACATCATGTGCGG - Exonic
1079340218 11:19605592-19605614 CCTGTGCAAGGGAGCATGTGAGG + Intronic
1082095635 11:48127149-48127171 CTTGTGCAAGGCATCATGGGGGG - Intronic
1083519161 11:63291606-63291628 CTGGTGGGAGGCATCATAGGTGG + Exonic
1086525496 11:87720965-87720987 GTTGTGCCAGGTATCATTGGTGG - Intergenic
1089206249 11:116765808-116765830 TTAGTGCTAGGCATGATGGGGGG - Intronic
1089642533 11:119857159-119857181 CTTGTGCCAGGCAGCAGAGGTGG + Intergenic
1091218751 11:133918707-133918729 CTGGTGGAAGGCAGGATGGGAGG - Intronic
1091397761 12:164130-164152 CATGTGCCAGGCATCATTGTAGG + Intronic
1095820004 12:46467755-46467777 CCTGTGCAAGGTATCTTGTGAGG - Intergenic
1096467823 12:51857202-51857224 CAATTGCTAGGCATCATGGGTGG + Intergenic
1099837524 12:87925814-87925836 TTTGTGCAAGGCATTATGCCAGG + Intergenic
1101847191 12:108372068-108372090 CTTATGCAAGGGCTCAGGGGTGG - Intergenic
1102624066 12:114220465-114220487 CTGCTGCAAAGCATCATGGTAGG + Intergenic
1102920372 12:116787318-116787340 CTTGCTCAAGGCACCATGGCTGG - Intronic
1105212203 13:18263576-18263598 CTTGTGCCAGGCTTCAGGGTGGG - Intergenic
1115352345 14:32408846-32408868 CTGGTGAAAGGCTTCATGTGTGG + Intronic
1117470465 14:56039427-56039449 CTTGTGACAGGCATCAGAGGTGG - Intergenic
1118317815 14:64736581-64736603 CTAATGCATTGCATCATGGGTGG + Intronic
1121330720 14:93047897-93047919 CTTGTGAAAGTCATTTTGGGTGG - Intronic
1121505095 14:94471105-94471127 CTTGTGAAAAGGATGATGGGGGG - Intronic
1124599128 15:31116890-31116912 CTTATGCAATGCATCATGTCTGG + Intronic
1125410674 15:39402744-39402766 CTTTTCCAAGCTATCATGGGAGG - Intergenic
1125700652 15:41680398-41680420 CTTATTCAATGCATCAGGGGGGG - Intronic
1126916151 15:53468309-53468331 CATGTGCAAGAAATAATGGGAGG - Intergenic
1127469062 15:59274216-59274238 CTTCTGCAAGACAGCATGGGTGG - Intronic
1128087621 15:64896841-64896863 CTTGTCCAAGGCCTCAGGGCTGG - Intronic
1129909219 15:79212361-79212383 CATGTGCCAGGCATCATGCCTGG - Intergenic
1131238793 15:90720232-90720254 TCTGTGCCAGGCATCATGGTAGG - Intronic
1131651722 15:94406818-94406840 CTAGTGGAAGGGATCATGGAAGG + Intronic
1137548345 16:49419226-49419248 CCTGTGCAAGGCAGCAGGGAGGG + Intergenic
1137688627 16:50404251-50404273 CAGGTGCATGGCATCATGGCTGG + Intergenic
1137807629 16:51322329-51322351 CTTGTGCAAAGAATGAAGGGTGG + Intergenic
1142049820 16:87951095-87951117 CTTGCGCAGGGCACCCTGGGAGG + Intronic
1143562051 17:7702211-7702233 CTTGTGACAGACAGCATGGGGGG + Intronic
1144674562 17:17153568-17153590 CTTGTGCAAGGTAGCAGGGGAGG - Intronic
1145846497 17:28042608-28042630 CTTGTGGCAGGAATCCTGGGGGG + Exonic
1146683463 17:34824828-34824850 ATTGAGCAGGGGATCATGGGAGG - Intergenic
1147052219 17:37803778-37803800 TTTGTTCAAGGCATAATAGGAGG + Intergenic
1152306638 17:79524783-79524805 CTCGAACATGGCATCATGGGTGG + Intergenic
1152420363 17:80189573-80189595 CTTTTCCCAGGCATGATGGGTGG + Intronic
1154007966 18:10549618-10549640 TATGTGCAAGACATCATGTGAGG - Intronic
1154510674 18:15098256-15098278 CTTGTGAAAGACTTAATGGGAGG - Intergenic
1155696375 18:28691720-28691742 CTTCTGGAAGGCATCAAGAGGGG - Intergenic
1158846138 18:61444648-61444670 CCTGTGCAAGTCTACATGGGTGG + Intronic
1159561212 18:69997099-69997121 TTTGTGCAAGGCGTCATGAGAGG + Intergenic
1161296013 19:3520514-3520536 CCTCTGCAAGGCCTCATGGACGG - Intronic
1162604144 19:11694299-11694321 CTTGTTCAGGCCATCATGGAAGG - Intergenic
925409576 2:3632164-3632186 CTTGTGCAGGGTTTCATGGGTGG + Intronic
926967807 2:18434967-18434989 CTTCTGCAAGGCAGCATTGCTGG - Intergenic
928084522 2:28337444-28337466 ACTGTACAAGGCATCAGGGGTGG - Intronic
928318742 2:30266652-30266674 CTTGTGCAAGAGATCGGGGGAGG - Intronic
929885203 2:45871980-45872002 CCTATGCCAGGCACCATGGGAGG + Intronic
934301420 2:91778826-91778848 CTTGTGCCAGGCTTCAGGGTGGG + Intergenic
934979429 2:98827745-98827767 CCTGTGCCAGCCACCATGGGAGG - Intronic
936257356 2:110928341-110928363 TTTGTGCAAGGCATCATTTCAGG - Intronic
936611924 2:114010045-114010067 CTTGGGCAAGGCATGATTTGTGG + Intergenic
937079387 2:119129476-119129498 CTTGGGCATGGGACCATGGGCGG + Intergenic
937441698 2:121920913-121920935 CTTCTGCAAGGCAGGATGGGAGG - Intergenic
944190719 2:197000711-197000733 CTTATGCAAGGCACCATGTTAGG + Intronic
944638521 2:201697903-201697925 CTTTTGCCAGGCATCATGCCAGG - Intronic
944691392 2:202161659-202161681 TTTCTGCAGGGCCTCATGGGAGG - Intronic
947378567 2:229522834-229522856 CATGTGCCAGGTATCATGGGAGG + Intronic
948338230 2:237228149-237228171 TGTGTGCAAAGCATCATGGTAGG + Intergenic
1168798528 20:628654-628676 CCTGTGCAAAGCATCAGGGATGG - Intergenic
1171508391 20:25658442-25658464 CTGGTGCCAGGCATAATAGGGGG + Intergenic
1171798170 20:29582511-29582533 CTTGTGCGAGGCATTATGCTGGG - Intergenic
1171850066 20:30301650-30301672 CTTGTGCGAGGCATTATGCTGGG + Intergenic
1171857810 20:30363323-30363345 CCTCTGCAAGGCAACCTGGGAGG - Intergenic
1172484144 20:35288331-35288353 CATGTGCCAGGCATCATGCCAGG - Intronic
1174454992 20:50642599-50642621 CTTGACTAAGGCCTCATGGGGGG - Intronic
1176787191 21:13271153-13271175 CTTGTGAAAGACTTAATGGGAGG + Intergenic
1177986348 21:27979638-27979660 CTTGTGAAAGACTTAATGGGAGG + Intergenic
1180390603 22:12278642-12278664 CCTCTGCAAGGCAACCTGGGAGG + Intergenic
1180409140 22:12586115-12586137 CCTCTGCAAGGCAACCTGGGAGG - Intergenic
1180815017 22:18783896-18783918 CTTGTGCCAGGCTTCAGGGTGGG - Intergenic
1181201205 22:21218233-21218255 CTTGTGCCAGGCTTCAGGGTGGG - Intronic
1181700538 22:24618734-24618756 CTTGTGCCAGGCTTCAGGGTGGG + Intronic
1182487768 22:30649550-30649572 CTTCTGTAAGGCAGCCTGGGCGG - Intronic
1185031896 22:48448456-48448478 CTAGGGCAGAGCATCATGGGAGG - Intergenic
1203225708 22_KI270731v1_random:77198-77220 CTTGTGCCAGGCTTCAGGGTGGG + Intergenic
1203265120 22_KI270734v1_random:9586-9608 CTTGTGCCAGGCTTCAGGGTGGG - Intergenic
949918906 3:8986105-8986127 CCTGTGCAAGGCAGCATGCAGGG - Intronic
950627483 3:14258943-14258965 ACTGTGCTAGGCATGATGGGAGG + Intergenic
953187357 3:40651289-40651311 TGTGTGCCAGGCATCCTGGGAGG - Intergenic
953637130 3:44672994-44673016 CTTGAGCCAGGCCTGATGGGTGG + Intergenic
953759141 3:45673185-45673207 CCTGTGCTAGGCACCATGAGAGG + Intronic
953772891 3:45792449-45792471 CATGTGCCAGGCATCATGTGAGG - Intronic
954696243 3:52428599-52428621 CCTGGGCCAGGCATCATGAGGGG - Intergenic
955337345 3:58097697-58097719 CTTGTGTGTGCCATCATGGGAGG + Intronic
955411753 3:58660025-58660047 CTTGGGCAAGGCTTCATAGCAGG + Intronic
959679180 3:109073219-109073241 CATGTGCCATGCATCATGGGTGG + Intronic
959950882 3:112178607-112178629 CTTGTGTGAGACTTCATGGGTGG + Intronic
960293384 3:115913823-115913845 TCTGTGCCAGGCATCATGGTAGG - Intronic
961619574 3:128213070-128213092 CTTCTGCATTGCCTCATGGGTGG + Intronic
961809561 3:129514037-129514059 TTTGTGCCAGGCATCCTAGGAGG + Intronic
962369356 3:134807988-134808010 CTTGTTGAATTCATCATGGGAGG - Intronic
962424950 3:135261564-135261586 CTTGTGCAGGGCATCTGTGGGGG - Intergenic
967848419 3:194063102-194063124 CCTGGGCAAGGATTCATGGGAGG + Intergenic
968222026 3:196946765-196946787 CAAGGGTAAGGCATCATGGGAGG + Exonic
969865632 4:10075399-10075421 CTTGACAGAGGCATCATGGGAGG + Exonic
970546388 4:17134431-17134453 CTTCTGAAAGGCATTATGGGTGG - Intergenic
974704557 4:65495387-65495409 CTTGTGCATGCCATTGTGGGTGG + Exonic
980045765 4:127986726-127986748 CTTGTCCAAGCCATCATAGTGGG + Intronic
983642650 4:169957431-169957453 CATGTGCCAGGCACCATGGTTGG + Intergenic
984738144 4:183130734-183130756 ATTGTGCCAGGCATCATGCCAGG + Intronic
996026186 5:118648484-118648506 CTTGTTAGAGGCATCAAGGGAGG + Intergenic
998173176 5:139884218-139884240 CATGTCTAAGGCACCATGGGAGG + Intronic
999119359 5:149197365-149197387 CAGTTGCAAGGGATCATGGGAGG - Intronic
999240351 5:150124161-150124183 GTTGTGCAAGGCCTGAGGGGGGG + Intronic
1001763670 5:174227725-174227747 CTTGTCCAACCCATCAGGGGAGG - Intronic
1002089623 5:176796832-176796854 CAAGTGCAAAGCATCCTGGGGGG - Intergenic
1003268049 6:4583790-4583812 CTTGTGCAAGGATTCAGGAGAGG - Intergenic
1004310953 6:14544438-14544460 CTTGTGCCAGGCAACATAGTAGG + Intergenic
1004702063 6:18088464-18088486 CTTTAGGAAGGCAACATGGGAGG + Intergenic
1005257709 6:24021903-24021925 CTTCTGGAAGGCATCACTGGAGG + Intergenic
1006004378 6:30990808-30990830 CTTCTGCAGGGCTGCATGGGTGG - Intergenic
1013217046 6:108037051-108037073 TTTGTGCAAGGCTTTATGGTTGG - Intergenic
1017254011 6:152312910-152312932 CTTGTGCAAGAAATAATGTGGGG + Intronic
1019298881 7:293182-293204 CCTGTGCAAGCCAGCATGGAGGG - Intergenic
1020455291 7:8366347-8366369 CATGTGCTTGGCATCATGGTGGG + Intergenic
1021122998 7:16818216-16818238 CTTGTGCGAGGCATCATGCAAGG - Intronic
1022019290 7:26382773-26382795 CTTGTGCAAGGCCACCAGGGAGG + Intergenic
1022303277 7:29121680-29121702 AATGGGAAAGGCATCATGGGTGG + Intronic
1023626946 7:42125226-42125248 CCTGTACAAGGCACCATGGCAGG - Intronic
1024338420 7:48233042-48233064 CCTTTACATGGCATCATGGGAGG - Intronic
1024971267 7:55073264-55073286 CTTGTGCAAGGCAGCGTGGCTGG - Intronic
1027247535 7:76377358-76377380 CTTGTGTAAGACACCATGTGGGG - Intergenic
1028956691 7:96701427-96701449 CTTGTGCAAGGCAGGAAGAGTGG + Intronic
1029378836 7:100199442-100199464 CTTGTACAAGGCAGCAACGGTGG + Intronic
1030542325 7:110846242-110846264 CTTGGCCAAGGTAACATGGGTGG + Intronic
1033260998 7:139843919-139843941 CTTGTGCAAGGCATTCTGCCAGG - Intronic
1036504931 8:9346704-9346726 CAGGTGCAAGCCATCATGGCTGG + Intergenic
1038796606 8:30716090-30716112 CTTGTGCCAGGCATTATGCAAGG + Intronic
1041151481 8:54939807-54939829 CCTGTGCACGAGATCATGGGAGG - Intergenic
1044950186 8:97428257-97428279 CTTCTGCAGAGCATCATGGAGGG - Intergenic
1047722479 8:127653888-127653910 TGTGTGCAAGGCATCATGGCAGG - Intergenic
1049525224 8:143122005-143122027 GGTGTGCAAGGCATCCTGGGCGG - Intergenic
1049591449 8:143464772-143464794 CTTGTCCCTGGCATCTTGGGAGG - Intronic
1052331206 9:27270410-27270432 CTTGTGCAGGGCCTCAAGGTTGG - Intergenic
1053723912 9:40976833-40976855 CCTCTGCAAGGCAACCTGGGAGG - Intergenic
1053787841 9:41664943-41664965 CTTGTGCGAGGCATTATGCTGGG + Intergenic
1054157288 9:61649824-61649846 CTTGTGCGAGGCATTATGCTGGG - Intergenic
1054176117 9:61876285-61876307 CTTGTGCGAGGCATTATGCTGGG + Intergenic
1054342052 9:63875166-63875188 CCTCTGCAAGGCAACCTGGGAGG + Intergenic
1054477062 9:65580829-65580851 CTTGTGCGAGGCATTATGCTGGG - Intergenic
1054661422 9:67704523-67704545 CTTGTGCGAGGCATTATGCTGGG - Intergenic
1054870504 9:70044109-70044131 CTAGTGAAAGGGATCGTGGGAGG - Exonic
1055794622 9:79962179-79962201 CTTGTGCAAGGTCCCATGGATGG + Intergenic
1056259140 9:84830212-84830234 TGTGTGAAAGGCATCATGGGAGG - Intronic
1187279865 X:17850057-17850079 ATTCAGTAAGGCATCATGGGAGG - Intronic
1194439725 X:93917036-93917058 GTTCTGCAAGTCATCATAGGTGG - Intergenic
1195081024 X:101370685-101370707 CATGTACAAGGCATCATGCTAGG + Intronic
1195438495 X:104873674-104873696 CTTGACCAATGCAACATGGGTGG - Intronic
1195613952 X:106897995-106898017 CTGGTGGAAGCCATAATGGGGGG - Intronic
1199741718 X:150741713-150741735 CGTGTGCAAGGCATCATGCCTGG - Intronic
1201189094 Y:11430907-11430929 CGTGTGCCAGGCATCATGCCAGG - Intergenic