ID: 1082101562

View in Genome Browser
Species Human (GRCh38)
Location 11:48177043-48177065
Sequence CTGGGGTTGTGGATGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082101555_1082101562 -2 Left 1082101555 11:48177022-48177044 CCAGCTGAAGCAGGAGGGTATCT No data
Right 1082101562 11:48177043-48177065 CTGGGGTTGTGGATGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082101562 Original CRISPR CTGGGGTTGTGGATGGGACA TGG Intergenic
No off target data available for this crispr