ID: 1082105472

View in Genome Browser
Species Human (GRCh38)
Location 11:48216857-48216879
Sequence CACTCTGCACAGCTGGATCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 4, 3: 15, 4: 228}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082105472_1082105480 22 Left 1082105472 11:48216857-48216879 CCAGGATCCAGCTGTGCAGAGTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1082105480 11:48216902-48216924 CGTGTACCTTGCCACGGTGGTGG 0: 1
1: 0
2: 0
3: 3
4: 38
1082105472_1082105475 16 Left 1082105472 11:48216857-48216879 CCAGGATCCAGCTGTGCAGAGTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1082105475 11:48216896-48216918 TCTCCCCGTGTACCTTGCCACGG 0: 1
1: 0
2: 0
3: 7
4: 89
1082105472_1082105481 23 Left 1082105472 11:48216857-48216879 CCAGGATCCAGCTGTGCAGAGTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1082105481 11:48216903-48216925 GTGTACCTTGCCACGGTGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1082105472_1082105477 19 Left 1082105472 11:48216857-48216879 CCAGGATCCAGCTGTGCAGAGTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1082105477 11:48216899-48216921 CCCCGTGTACCTTGCCACGGTGG 0: 1
1: 0
2: 0
3: 3
4: 48
1082105472_1082105483 29 Left 1082105472 11:48216857-48216879 CCAGGATCCAGCTGTGCAGAGTG 0: 1
1: 0
2: 4
3: 15
4: 228
Right 1082105483 11:48216909-48216931 CTTGCCACGGTGGTGGGCAATGG 0: 1
1: 0
2: 0
3: 16
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082105472 Original CRISPR CACTCTGCACAGCTGGATCC TGG (reversed) Exonic
900665316 1:3811140-3811162 CCCTCTGCACAGCTGGCCTCAGG - Intergenic
900716567 1:4148838-4148860 CACCATGCACAGCTGGGTCTTGG - Intergenic
901348634 1:8570741-8570763 CAAGCTGCACAGATGGCTCCAGG + Intronic
901794397 1:11672112-11672134 CACTCTGCACAGCAGTGCCCTGG + Intronic
901830842 1:11891399-11891421 CTCTCTCCACAGCTGAATACAGG - Intergenic
902892114 1:19452051-19452073 CTCTCTGCACATCTGGGTCAGGG + Intronic
904411242 1:30326157-30326179 TCCTCTGCACAGCTGGAGGCCGG + Intergenic
904419107 1:30380009-30380031 CACTGTGCACAGCAGGAGCTGGG + Intergenic
904464637 1:30700568-30700590 AGCTCAGCACAGCTGGACCCAGG + Intergenic
904592926 1:31625324-31625346 GAATCTGCAAAACTGGATCCTGG - Intronic
904895927 1:33818220-33818242 CTCTCTGCACAGCTGGTGTCTGG + Intronic
911841368 1:102686389-102686411 CACTGTCCACAGCTGGCTCAGGG + Intergenic
913686538 1:121237346-121237368 CACATAGCACAGCTAGATCCGGG - Intronic
914038389 1:144024986-144025008 CACATAGCACAGCTAGATCCGGG - Intergenic
914151066 1:145042922-145042944 CACATAGCACAGCTAGATCCGGG + Intronic
917028886 1:170668490-170668512 CACCCGGCGCAGCTGGCTCCCGG + Intronic
918238247 1:182600312-182600334 CACTCTGTCCAGCTGCAGCCTGG - Exonic
919723855 1:200869561-200869583 CTCTCTGCACTGCTGGAGCCAGG - Intergenic
919790047 1:201284823-201284845 CACTTTTCCAAGCTGGATCCCGG + Intronic
920473861 1:206255902-206255924 CACATAGCACAGCTAGATCCGGG - Intronic
921684414 1:218073546-218073568 CTCTCTGCACACCTAGAACCAGG - Intergenic
922488122 1:225992337-225992359 CAGTCTGAACAGCTGGCTTCAGG + Intronic
922674969 1:227544278-227544300 CACTGTGCACGGCTGGTCCCGGG + Intergenic
924724769 1:246659168-246659190 CACTGTGCACAGCTGCTTCTGGG - Intronic
1063160420 10:3414453-3414475 CCCTGTGGACAGCTGGATCTCGG + Intergenic
1064387420 10:14909168-14909190 CACTCTGCTCTGCAGCATCCTGG + Exonic
1064970273 10:21058864-21058886 TACTCAGCACATCTGAATCCTGG - Intronic
1065278756 10:24113629-24113651 CACTGAGCAGAGCTGGCTCCTGG + Intronic
1067990607 10:51207595-51207617 CACTTTTCAGAGCTGAATCCTGG - Intronic
1068739587 10:60453311-60453333 CACTCTGCACAGATGCTTTCTGG + Intronic
1069575857 10:69528147-69528169 CACTGTGCACAGTTGGACACTGG + Intergenic
1069597911 10:69684520-69684542 CACTCTGCACTCCTGCCTCCTGG - Intergenic
1070164958 10:73890364-73890386 CACTATGCCCAGCTGAAACCTGG - Intergenic
1070806131 10:79271810-79271832 CCCTCTGCCCAGCAGGCTCCAGG - Intronic
1071727471 10:88213987-88214009 CATTGGGCACAGCTGGATTCAGG + Intergenic
1071964986 10:90843296-90843318 CACTCTGCATAGCATGACCCAGG - Intronic
1072566215 10:96618910-96618932 CACTCTGGAGAGCTGAATGCAGG - Intronic
1072717088 10:97759438-97759460 CACTCTCTCCAGCTGGATTCTGG + Exonic
1075742439 10:124704077-124704099 CCAACTGCACAGCTGGACCCGGG + Intronic
1076300629 10:129423303-129423325 AGCTCTGCACAGCTGGATCCAGG - Intergenic
1076303730 10:129448139-129448161 CACTTAGCACACATGGATCCTGG + Intergenic
1076583317 10:131529584-131529606 CGCTCTGCAGAACTGGATGCGGG - Intergenic
1077053619 11:579194-579216 CACTCGGGACAGTTGGACCCTGG + Intronic
1077461913 11:2715009-2715031 CAATCTGCCCAGCTGCACCCTGG - Intronic
1077475932 11:2790487-2790509 CTGTGTGCACAGCTGGATGCTGG - Intronic
1079173228 11:18115918-18115940 GCCTCTGCTCAGCTGCATCCTGG + Intronic
1081516325 11:43833939-43833961 CATTGTGTACAGCTGGAGCCAGG + Intronic
1082105472 11:48216857-48216879 CACTCTGCACAGCTGGATCCTGG - Exonic
1082106520 11:48227476-48227498 CTCTCTGCACTGCTGGATCCTGG - Intergenic
1082132842 11:48512366-48512388 CATTTTGCACATCAGGATCCTGG - Intergenic
1084527748 11:69707300-69707322 CACGCCCCACAGCTGGTTCCTGG + Intergenic
1084593345 11:70103106-70103128 CTCTCTGCACAGCACGTTCCAGG - Exonic
1085295014 11:75426576-75426598 CCATCTGCACACCTGGATCAAGG - Exonic
1086103886 11:83128995-83129017 GAGTCTGCAGAGCTGGATCTGGG - Intergenic
1089668127 11:120033109-120033131 GACACTGACCAGCTGGATCCAGG - Intergenic
1092525505 12:9307236-9307258 CAAAGTGCACAGCTGGATTCAGG - Intergenic
1092541772 12:9424584-9424606 CAAAGTGCACAGCTGGATTCAGG + Intergenic
1092549197 12:9479328-9479350 CACTGTGCCCGGCTGGATGCTGG - Intergenic
1094503795 12:31043139-31043161 CACTGTGCCCGGCTGGATGCTGG + Intergenic
1094511263 12:31097919-31097941 CAAAGTGCACAGCTGGATTCAGG - Exonic
1095127788 12:38502631-38502653 CAATCTGTTCAGCTGGTTCCAGG + Intergenic
1095320543 12:40820438-40820460 CACTCTACACAACTGTATTCTGG - Intronic
1096743881 12:53713161-53713183 CACTCTGCACAGCTGCCATCAGG + Exonic
1096806435 12:54143874-54143896 CACTCTTCATGACTGGATCCAGG + Intergenic
1100236054 12:92662097-92662119 CATCTTGCACAGCGGGATCCAGG + Intergenic
1100432960 12:94546847-94546869 GACTCTGGACAGCTGGTCCCAGG + Intergenic
1102780898 12:115563541-115563563 CCCTCTGCCCAGCTGGAGACTGG + Intergenic
1104086008 12:125474735-125474757 CTTTAGGCACAGCTGGATCCAGG + Intronic
1104191930 12:126490325-126490347 CATACTGCACAGCTGGAAACAGG + Intergenic
1107024727 13:35788275-35788297 CTCTCTGCTCAGCTGGACCACGG - Exonic
1107449588 13:40496637-40496659 CAGTCTGCTCAGCTAGGTCCTGG + Intergenic
1110175461 13:72550544-72550566 CAGTCTGCTCCGCTGGATGCAGG + Intergenic
1113457892 13:110461934-110461956 CACACTGGACAGCTGGATGGGGG + Intronic
1113515075 13:110888075-110888097 CCCTCTGCACTGCTGGAATCTGG - Intronic
1115072996 14:29348902-29348924 CAATCCACACAGCTGGATTCAGG - Intergenic
1117114141 14:52492591-52492613 CACCCAGCACAGCTGGCTTCAGG + Intronic
1117384738 14:55200167-55200189 CACTGTGCCCAGCTGTATACTGG + Intergenic
1117823092 14:59671810-59671832 CACTCTACAGAGCTGGACCTGGG + Intronic
1120189445 14:81427272-81427294 CACTTTGCAGAGGTGGGTCCTGG - Intronic
1121401871 14:93686808-93686830 CTCTTTGCAAAGCTGGACCCTGG - Intronic
1121895056 14:97639222-97639244 CCCACTGCACAGCAGGAGCCTGG - Intergenic
1122681055 14:103463423-103463445 CCCTTTGCTCAGCTGGGTCCTGG - Intronic
1122780351 14:104140841-104140863 CACTCAGCACACCGGGGTCCCGG + Intronic
1123989649 15:25673963-25673985 AACACAGCACAGCTGGAGCCGGG - Intergenic
1124126518 15:26942353-26942375 CACCATGCACAGCAGGCTCCAGG + Intronic
1125372245 15:38990889-38990911 TACTCTGCTCAGCTGGCTGCTGG - Intergenic
1125919492 15:43517229-43517251 CTCTCTCCTCAGATGGATCCAGG - Intronic
1128717069 15:69916556-69916578 AACTGTGCTCAGCTGCATCCTGG - Intergenic
1128732295 15:70029464-70029486 CATCCTGCACAGCTGGGCCCAGG + Intergenic
1129907128 15:79196190-79196212 CAAACTGCACAGCTGGCTCCAGG + Intergenic
1132456463 16:26378-26400 GCCTCAGCAGAGCTGGATCCTGG - Intergenic
1132669009 16:1095135-1095157 CACCCTGCACACCTGGAGTCGGG + Intronic
1132718046 16:1301794-1301816 CACCCTTCACCGCTGCATCCCGG + Intergenic
1133023299 16:2976375-2976397 GACGCTGCACAGCTGGCGCCAGG + Intronic
1135822442 16:25695927-25695949 CTCTCTGCACAGCTGGCTTGGGG + Intronic
1136064130 16:27747397-27747419 CTTTAGGCACAGCTGGATCCAGG + Intronic
1136636937 16:31529934-31529956 CACTCTCCCAAGCTGGATCTAGG - Intergenic
1138189044 16:54999358-54999380 CACGCTGCACAGATGGAGGCTGG + Intergenic
1140121479 16:72086564-72086586 AACACAGCACAGCTGGATTCAGG + Exonic
1140728524 16:77835443-77835465 GACTCAGCACAGCTGGACCATGG - Intronic
1140887528 16:79258295-79258317 CACTCTGCTGGGCTGGCTCCCGG - Intergenic
1141699285 16:85635091-85635113 CCCTCTGCCAAGCTGGAACCCGG - Intronic
1141898754 16:86976508-86976530 CACACTGCAAAGCTGAATGCAGG - Intergenic
1142009785 16:87708006-87708028 CACTCAACACGGCTGGGTCCTGG + Exonic
1142495520 17:304578-304600 CACTCTGAGCAGCTGGTGCCTGG + Intronic
1142639463 17:1277472-1277494 CATTCTGCCCAACTGGATACCGG + Intergenic
1144632850 17:16882713-16882735 TCCTGTGCACAGCTGGACCCCGG - Intergenic
1145016208 17:19400044-19400066 GACTATGCCCAACTGGATCCAGG - Intergenic
1147423444 17:40334035-40334057 CACTCTGTCCATCTGGAGCCTGG + Intronic
1147614452 17:41819953-41819975 CTCCCAGCACAGCTGGGTCCTGG - Intronic
1147893192 17:43732025-43732047 CACTGTGCCCAGCTGGGCCCAGG + Intergenic
1148344021 17:46891418-46891440 CTCACTGCACAGCTGGGCCCTGG - Intergenic
1151333796 17:73428166-73428188 CACTGTGCCCAGCTGGATTTTGG - Intronic
1152273175 17:79337361-79337383 CGCACAGCACAGCTGCATCCGGG + Intronic
1153863154 18:9234402-9234424 CACTTTTCACAGCTGTATGCAGG + Intronic
1155344078 18:24841511-24841533 GATTCTGCACAGCTGGCTTCAGG - Intergenic
1155866742 18:30974647-30974669 CACTATGCACAGCTGGTACCTGG + Intergenic
1155893349 18:31293302-31293324 CACTCGGGAGAGCTAGATCCTGG - Intergenic
1156211952 18:34953873-34953895 CACTCTGCTGAGCAGAATCCAGG - Intergenic
1156928661 18:42614730-42614752 CTGTCTACACAGCTGCATCCTGG + Intergenic
1160591603 18:79947877-79947899 CCCTCTGCACAGCAGGACCTGGG + Intronic
1161061980 19:2219833-2219855 CCCTCCCCACAGCTGGACCCCGG + Intronic
1161463699 19:4415133-4415155 CATTCTACCCAGCTGGAGCCCGG - Intronic
1162111417 19:8401893-8401915 CACATTTCAGAGCTGGATCCAGG + Intronic
1162801445 19:13112908-13112930 CAGCCTGCACAGCTGCATCCAGG + Exonic
1163642799 19:18471007-18471029 AGCTCTGCACAGCTGGATGTGGG - Intronic
1164468016 19:28504808-28504830 CTCTCTGCAAAGCTGTGTCCTGG + Intergenic
1164603623 19:29580082-29580104 CCCTCTGCACAGCTGCCTTCTGG + Intergenic
1164673169 19:30084647-30084669 ACCTCTGCACATCTGAATCCAGG - Intergenic
1165804230 19:38570827-38570849 CAGGCTGGACACCTGGATCCTGG + Intronic
1166715184 19:44962442-44962464 CCCTGCCCACAGCTGGATCCTGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925041549 2:735141-735163 CTCTCTGCCCAGCTGGGCCCAGG + Intergenic
926702520 2:15813294-15813316 CCATCTGGACAGCTGGATGCCGG + Intergenic
927319023 2:21721019-21721041 CACTCTGGACTGCAAGATCCTGG + Intergenic
932283909 2:70517002-70517024 AACACTGTACAGCTGAATCCAGG + Intronic
935250156 2:101253485-101253507 CACACGGCACAGCTGGCTTCAGG - Intronic
936864185 2:117058148-117058170 CACTGTGCCCAGCTGGCTTCTGG - Intergenic
938127093 2:128682447-128682469 CTCTCTGCACAGCAAGACCCTGG - Intergenic
944488085 2:200227766-200227788 CACTGTGCCCAGCTGAACCCTGG - Intergenic
944941327 2:204631533-204631555 CACTGTGCCCAGCTGGGTCTTGG + Intronic
946032407 2:216715709-216715731 GACTCCACACAGCTGGCTCCGGG + Intergenic
946994076 2:225371048-225371070 GCCTCAGCACAGCTGGATCTAGG - Intergenic
948141352 2:235674436-235674458 CTCACAGCACAGCTGGTTCCAGG - Intronic
1170817494 20:19727090-19727112 CACTCTGCAGAGATGGAAGCAGG + Intergenic
1171977818 20:31606572-31606594 CCCTCTTCACAGCTGGTTCTGGG + Intergenic
1172299896 20:33841993-33842015 CACTGTGCACTGCGGGGTCCTGG + Intronic
1174113590 20:48212575-48212597 CACACTCCACATCAGGATCCTGG + Intergenic
1175390465 20:58624212-58624234 CGCTGTGCCCAGCTGGAACCCGG + Intergenic
1176025759 20:62984802-62984824 CACTCAACAAAGCTGGATCTTGG + Intergenic
1176254437 20:64143608-64143630 CCCTCTGCAGAGCTGGCTCCAGG + Intergenic
1178371096 21:32028353-32028375 CGCTCTGCACAGCTGTACCTGGG + Intronic
1179094073 21:38296461-38296483 CACTTGACACAGCTGGGTCCTGG - Intronic
1182038570 22:27218645-27218667 TTCTCTGCACAGCTGGACTCAGG - Intergenic
1182631039 22:31685619-31685641 GACTCTGCACAGCTGCCTTCTGG + Exonic
1182761070 22:32722697-32722719 CACTCTGGACAGCTGACTCAAGG + Intronic
1183050075 22:35253778-35253800 CCCTCTGGACAGCTGGGTCCGGG - Intergenic
1184154515 22:42658423-42658445 CACTGTGCCCAGCTGAACCCAGG + Intergenic
1184607557 22:45582732-45582754 CACTCTGCACAGTTGTTTCTGGG + Intronic
1184878565 22:47290827-47290849 CACCCAGCACAGCTGCAGCCAGG + Intergenic
1185173596 22:49306971-49306993 CTCTGTGCAGAGCTGGAGCCGGG - Intergenic
1185242575 22:49754613-49754635 CACTGGGCACAGCTGGGGCCTGG - Intergenic
949959775 3:9302421-9302443 CGCTCTGCCCAGCTGCAGCCAGG + Intronic
950667421 3:14505849-14505871 CACTCAGCACAGCTGGAAATGGG - Intronic
953026119 3:39146244-39146266 CACTCTGCAGAGCTGCATCCCGG + Intronic
954901731 3:54025946-54025968 GACACTGCACAGCAGGATCCAGG - Intergenic
957497218 3:81007740-81007762 CACTCTGGAGTGATGGATCCAGG + Intergenic
961283771 3:125783759-125783781 CCCTGTGCACAGGAGGATCCTGG - Intergenic
961368072 3:126413939-126413961 CTTTAGGCACAGCTGGATCCAGG + Intronic
961619870 3:128215691-128215713 CTTTAAGCACAGCTGGATCCAGG + Intronic
963589062 3:147233636-147233658 GACTCTGCCTTGCTGGATCCTGG - Intergenic
966815267 3:183885034-183885056 CCCACTGCTCAGCTGGCTCCGGG + Intergenic
967051628 3:185790020-185790042 CACTGTGCCCAGCTGCAACCAGG + Intronic
968189282 3:196655701-196655723 CACTCTGCAGAGCGGCAGCCCGG + Intronic
968520265 4:1031922-1031944 CACTCTCCACAGAGGGACCCAGG + Intergenic
968969882 4:3788266-3788288 CACACTGCTCATCTGGAGCCTGG + Intergenic
969426851 4:7129470-7129492 CACTCTGCACGGCTGCTGCCTGG + Intergenic
969468083 4:7369648-7369670 CACTCAGCAAAGCTGGGGCCAGG - Intronic
969608903 4:8216326-8216348 TGCTCAGCACAGCGGGATCCAGG - Intronic
974564425 4:63565400-63565422 CACTATGCACTTCTGGATCCAGG - Intergenic
975984008 4:80186626-80186648 CACTCTTCACAGCTACACCCTGG + Intronic
977825330 4:101524410-101524432 AAATCTGCACAGATGCATCCAGG - Intronic
982023398 4:151227987-151228009 CAGTCTGCACAGCTGGAATGTGG + Intronic
982143339 4:152352895-152352917 CAGTCTGCATTGCTGAATCCTGG - Intronic
986203981 5:5605690-5605712 CACTCTGTTCTGCTGGATTCTGG + Intergenic
987066296 5:14293141-14293163 CACTCGGAACAGCTGGACCCTGG + Intronic
989183151 5:38598072-38598094 CACTTTCCCCAGCTGCATCCAGG + Intronic
991578267 5:68127347-68127369 CAATCTGCAAATCTGGAGCCAGG + Intergenic
997447668 5:133953278-133953300 GACTCAGCACAGCTTGAGCCAGG - Intergenic
997481466 5:134188262-134188284 CACTCAGCTCAGCTGGTGCCTGG + Intronic
997891398 5:137680131-137680153 CCCTCTCCACAGCTGCTTCCTGG + Intronic
998157324 5:139794593-139794615 CACTGAGCACAGCAGGATCAAGG + Intergenic
999742360 5:154566017-154566039 CCATTTGCACAGCTGGTTCCTGG - Intergenic
1000825053 5:166034712-166034734 CACGGTGCCCAGCTGGAACCTGG - Intergenic
1001340038 5:170834756-170834778 CACTCTGCAAAGCATGATGCTGG - Intergenic
1001454505 5:171850336-171850358 CTTTAGGCACAGCTGGATCCAGG - Intergenic
1002526799 5:179819702-179819724 CACTCTCCACCGCCGGATGCAGG + Intronic
1003254237 6:4460207-4460229 CATCCTGCACAGCTGGGCCCGGG + Intergenic
1003442840 6:6159483-6159505 CACTTTGCACAGTTGCATCCTGG - Intronic
1003568102 6:7237514-7237536 CACTCTGCCCAGCTGGCTGATGG + Intronic
1004075599 6:12341578-12341600 CAGTCTTCACAGCTTCATCCCGG - Intergenic
1006085135 6:31589840-31589862 CACTCTGCACACGTAGATGCTGG + Exonic
1006225766 6:32535177-32535199 CCCTCTACGCAGCAGGATCCAGG + Intergenic
1010357310 6:74949060-74949082 GACTCTGCACAGCTTGACTCTGG + Intergenic
1012210555 6:96513094-96513116 CACTCTGCATTACTGGCTCCTGG + Intergenic
1012908414 6:105093351-105093373 CACTGTGCCCAGCTGGATCCTGG - Intergenic
1015731384 6:136351900-136351922 CACTGTGCACTGCAGGAGCCAGG - Intronic
1019206893 6:170369331-170369353 CGCACTGCACAGCTGGTTCCAGG - Intronic
1019516497 7:1442504-1442526 CATCAGGCACAGCTGGATCCAGG + Intronic
1019813832 7:3184681-3184703 CTCTCGGGACAGCTGGCTCCAGG + Intergenic
1021483009 7:21138719-21138741 TAATCTGCAGAGCTGGAACCAGG - Intergenic
1021694377 7:23261975-23261997 CACTCAGCACCCCAGGATCCTGG + Intronic
1022552238 7:31251752-31251774 CAATCTGCACAGGTGCTTCCTGG - Intergenic
1022790584 7:33684933-33684955 CACTCTTCACAGAAGGATCTAGG - Intergenic
1023095856 7:36659130-36659152 CACTCTGAACATCTGTTTCCAGG - Intronic
1023162443 7:37310129-37310151 CTCTCTGCAAAGCTGGCCCCAGG - Intronic
1024240333 7:47429910-47429932 CACTCTTTGCAGCTGAATCCTGG + Intronic
1024529849 7:50382759-50382781 CACTCTGCCCGCCTGGGTCCCGG + Intronic
1026136479 7:67666478-67666500 CACTCTGAACAGGTCGATCTGGG + Intergenic
1026404653 7:70052489-70052511 CAACCTGTACAGCTGTATCCAGG - Intronic
1026836907 7:73645691-73645713 CACTCTGCACACCTGTAACCTGG - Intergenic
1035224967 7:157427942-157427964 CACTCTGCTCAGCCGGGTCCTGG - Intergenic
1037506801 8:19538755-19538777 CACTCTGCACATCTGGGTCAAGG + Intronic
1038350697 8:26773875-26773897 CAGTCTTCACAGGTGAATCCTGG + Intronic
1040523020 8:48193909-48193931 CACACTGCAAAACTAGATCCAGG - Intergenic
1045016736 8:98007113-98007135 CACTGTGCACAGCAGGACCATGG + Exonic
1049142570 8:140969238-140969260 TACTCTGCACAGGAGGAACCAGG + Intronic
1049142658 8:140970177-140970199 CACTGTGAACAGCTGCTTCCTGG + Intronic
1051331843 9:16031878-16031900 CTGCCTGTACAGCTGGATCCTGG - Intronic
1052969005 9:34364962-34364984 CTCTCTGCACATCTGGATCTGGG - Intergenic
1056225761 9:84493635-84493657 CAGTCTGCACAGTTGGTTTCTGG + Intergenic
1057763029 9:97891655-97891677 CCCTCTGCACAGCGAGTTCCTGG + Intergenic
1057972024 9:99567664-99567686 CACTCTAATCATCTGGATCCTGG - Intergenic
1059275957 9:113097308-113097330 CACTCTACACTGCTCAATCCAGG + Intergenic
1059296361 9:113274943-113274965 CTCTCTGCCCTGCTGGATGCTGG - Intronic
1060055191 9:120407114-120407136 CACTCTGCAGAGCAGGCTCAAGG - Exonic
1061014105 9:127972098-127972120 CCCTCTGCACAGCCGGCTCTGGG - Intronic
1061391438 9:130319338-130319360 CACTCAGCACAGGTTGACCCTGG + Intronic
1062122432 9:134841041-134841063 CCCTCTGCAGGGCTGCATCCTGG + Intronic
1062326827 9:136016532-136016554 CACTCTGCCCACCTGGGCCCAGG + Intronic
1189859118 X:45253981-45254003 CACTGTGCCCAGCTGCATCATGG + Intergenic
1190738744 X:53273513-53273535 AAATCTGAACAGCTGGATACAGG + Intronic
1195173626 X:102293974-102293996 GACTCTACACAGCTGCACCCAGG + Intergenic
1195185239 X:102393118-102393140 GACTCTACACAGCTGCACCCAGG - Intronic
1195667936 X:107447729-107447751 CATACTGGACAGCTGGTTCCTGG + Intergenic
1199248143 X:145630859-145630881 CAGCCAGCACAGCTGCATCCAGG - Intergenic
1199580461 X:149355070-149355092 CACTCAGCATAGTTGTATCCAGG - Intergenic
1200399899 X:156013345-156013367 GCCTCAGCAGAGCTGGATCCTGG + Intergenic