ID: 1082105748

View in Genome Browser
Species Human (GRCh38)
Location 11:48219515-48219537
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082105744_1082105748 21 Left 1082105744 11:48219471-48219493 CCCTTTAGGCTCATGCACAATCC No data
Right 1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG No data
1082105743_1082105748 25 Left 1082105743 11:48219467-48219489 CCAACCCTTTAGGCTCATGCACA No data
Right 1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG No data
1082105746_1082105748 0 Left 1082105746 11:48219492-48219514 CCTTGCTATATTAATTCTTATAG No data
Right 1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG No data
1082105745_1082105748 20 Left 1082105745 11:48219472-48219494 CCTTTAGGCTCATGCACAATCCT No data
Right 1082105748 11:48219515-48219537 GTTCCTTTTGAACACTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082105748 Original CRISPR GTTCCTTTTGAACACTTTCA TGG Intergenic